ID: 1147220189

View in Genome Browser
Species Human (GRCh38)
Location 17:38924112-38924134
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147220178_1147220189 11 Left 1147220178 17:38924078-38924100 CCACTGCAAGCTGAGCAGTGCAC No data
Right 1147220189 17:38924112-38924134 GGGCCTTCCGGACCAACAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147220189 Original CRISPR GGGCCTTCCGGACCAACAGG GGG Intergenic
No off target data available for this crispr