ID: 1147232730

View in Genome Browser
Species Human (GRCh38)
Location 17:39030860-39030882
Sequence GCTTGGTCCTGGCCTGCTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 109}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147232730_1147232739 25 Left 1147232730 17:39030860-39030882 CCAATAGCAGGCCAGGACCAAGC 0: 1
1: 0
2: 1
3: 10
4: 109
Right 1147232739 17:39030908-39030930 ACATTTCAACCTTTAGACCTGGG No data
1147232730_1147232738 24 Left 1147232730 17:39030860-39030882 CCAATAGCAGGCCAGGACCAAGC 0: 1
1: 0
2: 1
3: 10
4: 109
Right 1147232738 17:39030907-39030929 CACATTTCAACCTTTAGACCTGG 0: 1
1: 0
2: 13
3: 24
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147232730 Original CRISPR GCTTGGTCCTGGCCTGCTAT TGG (reversed) Intergenic
902086832 1:13869105-13869127 GCTGGCTGCTGGGCTGCTATTGG - Intergenic
903221090 1:21870077-21870099 GCTGGGGCCTGGCCTGGCATAGG + Intronic
907797150 1:57729180-57729202 GTTTGGTCCTGCCCTGGTGTGGG + Intronic
912332028 1:108828594-108828616 GCTGTGCCCTGGCCTGCTGTTGG + Intronic
914490032 1:148146229-148146251 GCTGGGCCCTGGCCTCCTAACGG + Intronic
919452626 1:197788880-197788902 GCTTGGGGCTGGCCTGCTGCTGG - Intergenic
921390506 1:214608985-214609007 GCTGGGCCCTGGCCTCCTAACGG - Intronic
922666845 1:227477412-227477434 GCCTGGTCCTGGGCTTCTTTTGG - Intergenic
922705742 1:227789192-227789214 GCTCGGTCCTGGTCTGCTCAGGG - Intergenic
923147822 1:231210168-231210190 CCTTGCTCCTGGTCTGCTAAGGG + Intronic
1062856268 10:780959-780981 GCAGGGCCCTGGCCTGCAATGGG + Intergenic
1066226993 10:33393363-33393385 GCTTTGTCCTGGCCGACCATGGG + Intergenic
1067560955 10:47304092-47304114 GCTGGGGCCTGGCCTGCTCTGGG - Intronic
1072796654 10:98361198-98361220 TCTTGTTCCTTGCCGGCTATTGG - Intergenic
1072931863 10:99671878-99671900 GCTTGGTACTGGCCTTCCATAGG + Intronic
1077984540 11:7338039-7338061 GCTTGTTACTGGCCTGTTAAGGG + Intronic
1081463043 11:43289334-43289356 GCTGGGTCCTGGGCTTTTATGGG - Intergenic
1083387554 11:62322846-62322868 GCTTGCAGCTGGCCTGCCATGGG + Intergenic
1083600657 11:63945537-63945559 GCTGGGGGCTGGCCTGCTGTAGG + Intronic
1084071156 11:66736025-66736047 GCTTGGTCTTGGCCAGCTTGGGG + Intergenic
1084448832 11:69220689-69220711 GCTTGCTCCTTGCCAGCTATAGG + Intergenic
1084558379 11:69888929-69888951 GCTGGGTCCTGGCCAGCCAAGGG + Intergenic
1084605311 11:70168699-70168721 GCTTGTTCCTGGTCTGCTGGAGG + Intronic
1089260374 11:117220084-117220106 CCTTTGCCCTGCCCTGCTATTGG - Intronic
1089650698 11:119910896-119910918 GCCTAGTCCTGGCCTGCTCCTGG - Intergenic
1089814717 11:121162194-121162216 GCTTCTTCCAGCCCTGCTATGGG + Exonic
1089932745 11:122330457-122330479 ACATGATCATGGCCTGCTATGGG + Intergenic
1091281810 11:134385854-134385876 GCTTGCTCTTGGCATGCTCTGGG + Intronic
1092010105 12:5102629-5102651 GCTTGGTCCTGGCCCTTCATGGG - Intergenic
1092262105 12:6958353-6958375 GCTTGGGCCTGGCCAGCAACTGG - Intronic
1114379760 14:22190160-22190182 GCTCTGCCCTGGCCTGCTGTGGG + Intergenic
1122664927 14:103322364-103322386 GCTTGGGACTGCCGTGCTATGGG + Intergenic
1125513100 15:40303255-40303277 GCTTGAGCCTGGGCTGCTACTGG + Intronic
1129072078 15:72960039-72960061 CCTTGGTCCTGGGGTGCTCTTGG - Intergenic
1131649029 15:94378769-94378791 GATGGGTCCTGGCCTTCTCTAGG - Intronic
1132722833 16:1325429-1325451 GCCTGGTCCTGGCCCGCGGTGGG - Exonic
1133078866 16:3302574-3302596 GCTTGATCGTAGCCTGCCATTGG - Intronic
1138391187 16:56670820-56670842 GCTTGAGCCAGGCCTGCTGTTGG + Intronic
1139592800 16:67942793-67942815 GCTTGGGCCATGCCTGCTGTGGG + Intronic
1140595245 16:76401336-76401358 GCTTGGTTCTTGGCTGTTATTGG + Intronic
1143318829 17:6054470-6054492 GCCTGGCCCTGTCCTGCTCTGGG + Intronic
1145190638 17:20840880-20840902 GCTGGGCCCTGGCCTCCTAACGG + Intronic
1146223623 17:31047952-31047974 GCTTGATCCTGACCTGGTGTTGG + Intergenic
1146812239 17:35913282-35913304 GCTTGATCCTGGCCTTCTGTTGG + Intergenic
1146812361 17:35914202-35914224 GCTTGGTTTTGGCTTGCTGTTGG + Intergenic
1147232730 17:39030860-39030882 GCTTGGTCCTGGCCTGCTATTGG - Intergenic
1147232781 17:39031212-39031234 GCTTGATCCTGACCTGGTGTTGG - Intergenic
1147232814 17:39031404-39031426 GCTTGATCCTGACCTGGTGTTGG - Intergenic
1147232866 17:39031764-39031786 GCTTGATCCTGGCCTCGTGTTGG - Intergenic
1147922003 17:43923426-43923448 GCTTGATCCTGACCTGGTGTTGG + Intergenic
1148173985 17:45548543-45548565 GCTTGATCCTGACCTGGTGTTGG + Intergenic
1148275282 17:46296904-46296926 GCTTGATCCTGACCTGGTGTTGG - Exonic
1148297388 17:46514483-46514505 GCTTGATCCTGACCTGGTGTTGG - Exonic
1148361942 17:47018963-47018985 GCTTGATCCTGACCTGGTGTTGG - Intronic
1148694628 17:49551538-49551560 GTTTTGTCCTGGGCTGCTCTGGG + Intergenic
1150405199 17:64895465-64895487 GCTTGATCCTGACCTGGTGTTGG + Exonic
1150784229 17:68150071-68150093 GCTTGATCCTGACCTGGTGTTGG + Intergenic
1150784285 17:68150428-68150450 GCTTGATCCTGACCTGGTGTTGG + Intergenic
1156363425 18:36404168-36404190 TCTTGGTCCTGCCCTCCTGTAGG + Intronic
1158749804 18:60245533-60245555 GCTTGGTCCTTGCCTGTGAGAGG + Intergenic
1160136486 18:76275939-76275961 GGGTGATCCTGTCCTGCTATTGG + Intergenic
1160995873 19:1881711-1881733 GCTGGGCCCTGGCCTCCTAACGG - Exonic
1161030530 19:2056066-2056088 GCCTGGCCCTGCCCTGCTGTGGG + Intergenic
1161030539 19:2056093-2056115 GCCTGGCCCTGCCCTGCTTTGGG + Intergenic
1167035095 19:46990478-46990500 GCTGGGTCTTGGCCTGCCAGAGG - Intronic
926868716 2:17388964-17388986 GCTTAGACCTGGCCTTCTGTGGG + Intergenic
928082033 2:28320210-28320232 ACTGGGTCCTGGGCTGCTGTCGG - Intronic
928340717 2:30441004-30441026 TCTTGGTCCTAGCCTACAATTGG - Intergenic
939503858 2:143019626-143019648 GCTATGTCCTTGTCTGCTATTGG + Intronic
940335129 2:152518784-152518806 GCTTAGTCCTGGCCTCCTACTGG + Intronic
940474384 2:154143318-154143340 TACTGGTCCTGGCCTGTTATAGG - Intronic
944859861 2:203805175-203805197 GCTAGTTCCTGCCCTGCTAAAGG + Intergenic
946054012 2:216885459-216885481 GCTTAGGCATGGCCTGCTGTAGG - Intergenic
1170812769 20:19687520-19687542 GCTTGGTTATGGCCAGCTAATGG - Intronic
1171171085 20:23015836-23015858 GCCTGGTCCTGGGCTGATCTTGG + Intergenic
1171193640 20:23180030-23180052 GCTTTGACCTGGGCTGCTGTTGG + Intergenic
1173081292 20:39870426-39870448 CCTTGGAACTGGCCTGCTATGGG + Intergenic
1174400894 20:50275242-50275264 GCTTAGGCCAGGCCTGCTAGAGG - Intergenic
1178578303 21:33814821-33814843 GCTGGGTCCAGGCCTGCCCTAGG - Intronic
1181119139 22:20653843-20653865 CCTGGCTCCTGGACTGCTATTGG + Intergenic
1181121645 22:20671112-20671134 GCTGGGCCCTGGCCTCCTAATGG - Intergenic
1184938433 22:47741818-47741840 GCCTGGGCCTGTCCTGCTCTGGG + Intergenic
949795582 3:7846851-7846873 ACTTGCTCATTGCCTGCTATGGG - Intergenic
958586569 3:96094745-96094767 GCCTGGTCCTGGACTGTTTTTGG - Intergenic
961259808 3:125593168-125593190 GCTTCGTCCTGACCTGCTATGGG - Intronic
962795066 3:138842772-138842794 GCTTGGACCTGGCCATATATAGG - Intergenic
964202632 3:154135197-154135219 GCTTGGTCCTGGGCTTTTCTTGG + Intronic
968947008 4:3670453-3670475 GCTTGTTCCTTGCCTCCTGTGGG - Intergenic
972739592 4:41877751-41877773 GCTTGGTCCTGGCTGTCTAAGGG - Intergenic
974593659 4:63988510-63988532 GCTTGGTCTTGTCCTGCTTTTGG - Intergenic
975195503 4:71518774-71518796 CCATGCTCCTGGCCTGCTCTGGG - Intronic
976386202 4:84461492-84461514 GCTGGGTCATGGAATGCTATGGG - Intergenic
979888567 4:126062165-126062187 GATAGCTCTTGGCCTGCTATTGG - Intergenic
982093034 4:151896870-151896892 GCTTTGCACTGGCCTGGTATTGG - Intergenic
982898149 4:160960648-160960670 GCTTGGTGATGGCCTGTTTTGGG + Intergenic
987967647 5:24896349-24896371 GATAGGTCTTGGCCTGCTATTGG + Intergenic
989194529 5:38703455-38703477 GCCTGGTCCTGGCCTTTTTTTGG - Intergenic
990880471 5:60532218-60532240 GAAGGGTCCTGGCCTGCTATGGG - Intergenic
998510183 5:142706676-142706698 TCAGGGTCCTAGCCTGCTATGGG + Intergenic
1001599368 5:172919057-172919079 GCTTGGCGCTGGGCTGCAATGGG + Intronic
1001635658 5:173208348-173208370 GCTGGGTCCAGGCCTGCTCCTGG + Intergenic
1002401515 5:178993973-178993995 GCGTGTCCCTGGGCTGCTATGGG - Intronic
1003302289 6:4894383-4894405 GCTTGGCCCTGCCCTGCTCCTGG + Intronic
1007347588 6:41244429-41244451 GTCTGGTCCTGGACTGCTTTTGG - Intergenic
1011525225 6:88257121-88257143 GTCTGGTCCTGGCCTTTTATTGG - Intergenic
1013339360 6:109198337-109198359 TCTTGGTCTTGCCCTTCTATAGG + Intergenic
1022097028 7:27147543-27147565 ACTCGGTCCTGGCCTGCAACCGG - Exonic
1027226032 7:76244128-76244150 GCTGGGTCCTGGCCTGGTTAGGG - Intronic
1031675790 7:124610393-124610415 CCTTGGTAGTGGCTTGCTATGGG - Intergenic
1038227668 8:25671658-25671680 TCTTGGTCCTGGAGTGCTTTCGG + Intergenic
1044604179 8:94034524-94034546 GCTTATTCATGGTCTGCTATAGG - Intergenic
1044822236 8:96162020-96162042 GCTCTGCCCTGGACTGCTATGGG + Intergenic
1049303243 8:141882917-141882939 GCGTGGTCCAGGCTTGCTCTGGG - Intergenic
1052040528 9:23733735-23733757 CCTTACTCCTGGCCTGCTGTAGG + Intronic
1055198783 9:73630245-73630267 GCTTGGTCTGGACCTGCTAAAGG + Intergenic
1056620074 9:88205166-88205188 GCTAGTACCTGGCCTGCTAGAGG + Intergenic
1189316445 X:40060401-40060423 CCTTAGTCCAGGCCTGCTATAGG + Intronic
1196192900 X:112813073-112813095 GCTTGGTGTTGGTCTGCTCTGGG + Intronic
1199514652 X:148662598-148662620 GCCTGGTCCTGGCCATCCATGGG - Exonic
1199600261 X:149537501-149537523 GTTTCGTGCTGACCTGCTATTGG + Intergenic
1199650322 X:149942439-149942461 GTTTCGTGCTGACCTGCTATTGG - Intergenic