ID: 1147232781

View in Genome Browser
Species Human (GRCh38)
Location 17:39031212-39031234
Sequence GCTTGATCCTGACCTGGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147232781_1147232786 24 Left 1147232781 17:39031212-39031234 CCAACACCAGGTCAGGATCAAGC No data
Right 1147232786 17:39031259-39031281 CACAGTTCAGCCTTTGGGCCTGG 0: 1
1: 0
2: 10
3: 31
4: 221
1147232781_1147232784 18 Left 1147232781 17:39031212-39031234 CCAACACCAGGTCAGGATCAAGC No data
Right 1147232784 17:39031253-39031275 CAGTGTCACAGTTCAGCCTTTGG 0: 1
1: 2
2: 8
3: 16
4: 165
1147232781_1147232788 26 Left 1147232781 17:39031212-39031234 CCAACACCAGGTCAGGATCAAGC No data
Right 1147232788 17:39031261-39031283 CAGTTCAGCCTTTGGGCCTGGGG 0: 1
1: 0
2: 10
3: 33
4: 264
1147232781_1147232785 19 Left 1147232781 17:39031212-39031234 CCAACACCAGGTCAGGATCAAGC No data
Right 1147232785 17:39031254-39031276 AGTGTCACAGTTCAGCCTTTGGG 0: 1
1: 0
2: 0
3: 17
4: 153
1147232781_1147232787 25 Left 1147232781 17:39031212-39031234 CCAACACCAGGTCAGGATCAAGC No data
Right 1147232787 17:39031260-39031282 ACAGTTCAGCCTTTGGGCCTGGG 0: 1
1: 0
2: 13
3: 44
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147232781 Original CRISPR GCTTGATCCTGACCTGGTGT TGG (reversed) Intergenic
No off target data available for this crispr