ID: 1147232814

View in Genome Browser
Species Human (GRCh38)
Location 17:39031404-39031426
Sequence GCTTGATCCTGACCTGGTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147232814_1147232820 24 Left 1147232814 17:39031404-39031426 CCAACACCAGGTCAGGATCAAGC No data
Right 1147232820 17:39031451-39031473 TACAGCTCAACCTTTGGACCTGG 0: 1
1: 2
2: 16
3: 24
4: 86
1147232814_1147232821 25 Left 1147232814 17:39031404-39031426 CCAACACCAGGTCAGGATCAAGC No data
Right 1147232821 17:39031452-39031474 ACAGCTCAACCTTTGGACCTGGG 0: 1
1: 11
2: 16
3: 14
4: 96
1147232814_1147232819 18 Left 1147232814 17:39031404-39031426 CCAACACCAGGTCAGGATCAAGC No data
Right 1147232819 17:39031445-39031467 CAGCGTTACAGCTCAACCTTTGG 0: 1
1: 0
2: 8
3: 4
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147232814 Original CRISPR GCTTGATCCTGACCTGGTGT TGG (reversed) Intergenic
No off target data available for this crispr