ID: 1147232819

View in Genome Browser
Species Human (GRCh38)
Location 17:39031445-39031467
Sequence CAGCGTTACAGCTCAACCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 8, 3: 4, 4: 56}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147232815_1147232819 12 Left 1147232815 17:39031410-39031432 CCAGGTCAGGATCAAGCTCAGCA No data
Right 1147232819 17:39031445-39031467 CAGCGTTACAGCTCAACCTTTGG 0: 1
1: 0
2: 8
3: 4
4: 56
1147232814_1147232819 18 Left 1147232814 17:39031404-39031426 CCAACACCAGGTCAGGATCAAGC No data
Right 1147232819 17:39031445-39031467 CAGCGTTACAGCTCAACCTTTGG 0: 1
1: 0
2: 8
3: 4
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147232819 Original CRISPR CAGCGTTACAGCTCAACCTT TGG Intergenic
924305628 1:242685893-242685915 CAGCATTACAACTCTTCCTTGGG - Intergenic
1065589275 10:27249635-27249657 CAGCATTACAGTTCAACCTTTGG - Intergenic
1072215128 10:93281407-93281429 CGGGGTCCCAGCTCAACCTTTGG + Intergenic
1074760791 10:116665901-116665923 CAGCATTTCAGCCCACCCTTTGG + Intronic
1077558980 11:3245158-3245180 CTTAGTTGCAGCTCAACCTTTGG + Intergenic
1078594998 11:12678238-12678260 GAGCGTTACAGCTGCCCCTTTGG + Intronic
1083241978 11:61395350-61395372 CAACGTTAAAGCACAAACTTAGG + Intronic
1085039036 11:73316120-73316142 CAGTGTTCAAGCTCAAGCTTAGG - Intronic
1085849939 11:80108426-80108448 AAGCGTTACAGAGCAACCTAGGG - Intergenic
1091458744 12:628156-628178 CAGCATCTCAGCTCAACCTGGGG - Intronic
1097024417 12:56043871-56043893 CTGCCTTACAGCTTAACCTGAGG - Intronic
1100698202 12:97118405-97118427 AAGACTTGCAGCTCAACCTTAGG - Intergenic
1101595015 12:106156420-106156442 AAGAGATACAGCTGAACCTTTGG - Intergenic
1101992711 12:109500565-109500587 CAGCGTGACACCTCAGCCTGAGG + Intronic
1103229229 12:119314145-119314167 CAGCTTTACAGCTCTTCTTTTGG + Intergenic
1109994867 13:70109473-70109495 TACGTTTACAGCTCAACCTTGGG - Intergenic
1121823177 14:96988194-96988216 CAGCGTTACAGAACAAAATTTGG - Intergenic
1122721376 14:103724292-103724314 CACCGTTCCAGCCCAACCCTGGG - Intronic
1132100750 15:99021308-99021330 CAGATTTACAGCTCAGCCCTGGG + Intergenic
1133898572 16:9951994-9952016 CAACGATACCGCTCACCCTTGGG + Intronic
1134356009 16:13482941-13482963 CCGAGTTACATCTCAGCCTTGGG - Intergenic
1142713179 17:1734286-1734308 CAGCATTACAGCCCCACCCTCGG - Intronic
1145870521 17:28269694-28269716 CAGTTTCACAGTTCAACCTTTGG - Intergenic
1146223618 17:31047911-31047933 CAGCATTACAGTTCAACCTTTGG - Intergenic
1146223642 17:31048103-31048125 CAGTGTCACTGTTCAACCTTTGG - Intergenic
1146811741 17:35909385-35909407 TAGCGTTACAGTTCAACCTCTGG - Intergenic
1146811771 17:35909577-35909599 CAGTGTCACACTTCAACCTTTGG - Intergenic
1146812233 17:35913241-35913263 CAGTGTCACAGTTCAACCTTTGG - Intergenic
1146812311 17:35913802-35913824 CAGTGTCACACTTCAACCTTTGG - Intergenic
1146929410 17:36767205-36767227 CAGAGATACAGCTCTGCCTTGGG + Intergenic
1147232441 17:39029222-39029244 CAGCGTTACAGTGAAACCTGCGG + Intergenic
1147232506 17:39029590-39029612 CAACGTTACAGTTAAACCTGTGG + Intergenic
1147232784 17:39031253-39031275 CAGTGTCACAGTTCAGCCTTTGG + Intergenic
1147232819 17:39031445-39031467 CAGCGTTACAGCTCAACCTTTGG + Intergenic
1147232871 17:39031805-39031827 CAGAGTCACAGTTCAACCTTTGG + Intergenic
1147921998 17:43923385-43923407 CAGCATTACAGTTCAACCTTTGG - Intergenic
1147922025 17:43923577-43923599 CAGTATCACAGTTCAACCTTTGG - Intergenic
1148173980 17:45548502-45548524 CAGCGTTACAGTTCAACTTTTGG - Intergenic
1148275287 17:46296945-46296967 CAGCGTTACAGTTCAACTTTTGG + Exonic
1148297393 17:46514524-46514546 CAGCGTTACAGTTCAACTTTTGG + Exonic
1148361947 17:47019004-47019026 CAGCGTTACAGTTCAACTTTTGG + Intronic
1150405194 17:64895424-64895446 CAGCGTTACAGTTCAACTTTTGG - Exonic
1150784280 17:68150387-68150409 CAGTGTCACAGTTCAACCTTTGG - Intergenic
1151552244 17:74828758-74828780 CAGCGTCTCAGCTCCACCCTAGG + Intronic
1157596834 18:48869397-48869419 CAGGGTTACAGATCACCCCTCGG + Intergenic
1159394745 18:67841551-67841573 CAGAGATATAGTTCAACCTTGGG - Intergenic
1164855860 19:31520186-31520208 CAGTGTTCAAGCCCAACCTTTGG + Intergenic
1171006690 20:21473003-21473025 CAGCATACCAGCTGAACCTTGGG + Intergenic
1177319949 21:19508541-19508563 GAGTGTTTCAGCTCAGCCTTGGG + Intergenic
956913942 3:73851147-73851169 AAGGGTTACAGCTCAAACCTGGG + Intergenic
977459957 4:97312577-97312599 CAGCCTCACACCCCAACCTTTGG - Intronic
979491569 4:121334383-121334405 CAGCGTGACACTTCAAACTTGGG - Intronic
984253341 4:177361030-177361052 CAGCGCTACATCAAAACCTTTGG + Intronic
989729369 5:44629972-44629994 CAGCGTTAGGGCTCAATCGTAGG - Intergenic
990750163 5:59006167-59006189 CAGCGTTACAGCTAGAGCTCAGG + Intronic
1005419487 6:25634067-25634089 CAGAGTTAGAGCTCAGTCTTGGG - Intergenic
1014568114 6:122976159-122976181 CAGAGTTACAGTTCAAGATTTGG - Intergenic
1030179582 7:106691471-106691493 CAGCCCTACAGCTCAAACTCAGG - Intergenic
1032830003 7:135613458-135613480 AAGAGTTACATCTCAACCTCTGG - Intronic
1037187867 8:16086374-16086396 CAGCCTCACATCTCAAGCTTCGG - Intergenic
1038102273 8:24391109-24391131 CAGCATTACAGCAGAACTTTGGG + Intronic
1043477613 8:80620559-80620581 AAGAATTACAGCTCAGCCTTAGG + Intergenic
1045948948 8:107829942-107829964 CAGTGTGACAGTTCAAGCTTAGG - Intergenic
1055265783 9:74494626-74494648 CTGTGGTACAGCTCAACCTGAGG + Intergenic
1060256513 9:122035459-122035481 CAGCATAACAGTTCAACCTCAGG + Intronic
1061930389 9:133829562-133829584 CAGTGTCACAGATCATCCTTGGG - Intronic
1062113242 9:134793997-134794019 CAGCCATACAGATCCACCTTGGG + Intronic
1188904663 X:35778082-35778104 CAGAGTTGCAGGTCGACCTTTGG + Intergenic
1192201656 X:69070111-69070133 CTGGGTTACAGCTCAAACTGGGG - Intergenic