ID: 1147232819 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 17:39031445-39031467 |
Sequence | CAGCGTTACAGCTCAACCTT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 69 | |||
Summary | {0: 1, 1: 0, 2: 8, 3: 4, 4: 56} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1147232814_1147232819 | 18 | Left | 1147232814 | 17:39031404-39031426 | CCAACACCAGGTCAGGATCAAGC | No data | ||
Right | 1147232819 | 17:39031445-39031467 | CAGCGTTACAGCTCAACCTTTGG | 0: 1 1: 0 2: 8 3: 4 4: 56 |
||||
1147232815_1147232819 | 12 | Left | 1147232815 | 17:39031410-39031432 | CCAGGTCAGGATCAAGCTCAGCA | No data | ||
Right | 1147232819 | 17:39031445-39031467 | CAGCGTTACAGCTCAACCTTTGG | 0: 1 1: 0 2: 8 3: 4 4: 56 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1147232819 | Original CRISPR | CAGCGTTACAGCTCAACCTT TGG | Intergenic | ||