ID: 1147232820

View in Genome Browser
Species Human (GRCh38)
Location 17:39031451-39031473
Sequence TACAGCTCAACCTTTGGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 2, 2: 16, 3: 24, 4: 86}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147232815_1147232820 18 Left 1147232815 17:39031410-39031432 CCAGGTCAGGATCAAGCTCAGCA No data
Right 1147232820 17:39031451-39031473 TACAGCTCAACCTTTGGACCTGG 0: 1
1: 2
2: 16
3: 24
4: 86
1147232816_1147232820 -6 Left 1147232816 17:39031434-39031456 CCAATGTCACCCAGCGTTACAGC 0: 1
1: 0
2: 9
3: 5
4: 93
Right 1147232820 17:39031451-39031473 TACAGCTCAACCTTTGGACCTGG 0: 1
1: 2
2: 16
3: 24
4: 86
1147232814_1147232820 24 Left 1147232814 17:39031404-39031426 CCAACACCAGGTCAGGATCAAGC No data
Right 1147232820 17:39031451-39031473 TACAGCTCAACCTTTGGACCTGG 0: 1
1: 2
2: 16
3: 24
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147232820 Original CRISPR TACAGCTCAACCTTTGGACC TGG Intergenic