ID: 1147232820

View in Genome Browser
Species Human (GRCh38)
Location 17:39031451-39031473
Sequence TACAGCTCAACCTTTGGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 2, 2: 16, 3: 24, 4: 86}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147232814_1147232820 24 Left 1147232814 17:39031404-39031426 CCAACACCAGGTCAGGATCAAGC No data
Right 1147232820 17:39031451-39031473 TACAGCTCAACCTTTGGACCTGG 0: 1
1: 2
2: 16
3: 24
4: 86
1147232816_1147232820 -6 Left 1147232816 17:39031434-39031456 CCAATGTCACCCAGCGTTACAGC 0: 1
1: 0
2: 9
3: 5
4: 93
Right 1147232820 17:39031451-39031473 TACAGCTCAACCTTTGGACCTGG 0: 1
1: 2
2: 16
3: 24
4: 86
1147232815_1147232820 18 Left 1147232815 17:39031410-39031432 CCAGGTCAGGATCAAGCTCAGCA No data
Right 1147232820 17:39031451-39031473 TACAGCTCAACCTTTGGACCTGG 0: 1
1: 2
2: 16
3: 24
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147232820 Original CRISPR TACAGCTCAACCTTTGGACC TGG Intergenic
904238820 1:29131098-29131120 GGCAGCTCAACCTGTGGCCCCGG - Intergenic
904299595 1:29545804-29545826 CCCAGGTCAACCTTTGGTCCAGG - Intergenic
905608571 1:39327557-39327579 TACAACTAACCCTTTAGACCTGG + Intronic
911485701 1:98502008-98502030 TACAGTTTGACCTTTTGACCTGG - Intergenic
921848387 1:219907851-219907873 TACAGCTGAACCTGAGGAACAGG + Intronic
922651679 1:227345440-227345462 CAGAGCTGAACCTCTGGACCTGG + Intergenic
1065589248 10:27249464-27249486 CACAGTTCAACCTTTGGATTTGG - Intergenic
1065589274 10:27249629-27249651 TACAGTTCAACCTTTGGACCTGG - Intergenic
1065589304 10:27249821-27249843 CACAGTTCAACCTTTGGACCTGG - Intergenic
1068748465 10:60563169-60563191 TAAATCTGAACATTTGGACCAGG - Intronic
1070915457 10:80151555-80151577 TACAGCCCTACCTTAGGACCTGG - Exonic
1075931851 10:126303974-126303996 TACAGCTCAATCTCTGGAGGAGG - Intronic
1078836443 11:15035069-15035091 TAAAGCCCTACCTTTGGGCCAGG - Intronic
1080354409 11:31425174-31425196 TGCAGCAAAAACTTTGGACCAGG + Intronic
1089386730 11:118073397-118073419 TAGAGCTCAAGCTCTTGACCAGG + Intergenic
1092413400 12:8271324-8271346 TAAAGCTCAACCTCTGGAATGGG - Intergenic
1092650910 12:10633966-10633988 TAAAGCTCAAACTTTGGGGCTGG - Intronic
1094073946 12:26451777-26451799 GACAGCTCAACCCTTGAAGCAGG + Intronic
1095347964 12:41174735-41174757 TCCAGATCAACCTTTGGAAGAGG + Intergenic
1095642452 12:44500794-44500816 TGCAGCTCCACCTGTGGCCCTGG + Intergenic
1102472985 12:113170054-113170076 CACAGATCAACCTAGGGACCGGG - Intronic
1110751329 13:79119591-79119613 GACAGCTCCACCTGTGGCCCCGG - Intergenic
1113757873 13:112826477-112826499 CACAGCTCAGCCCCTGGACCCGG + Intronic
1116403397 14:44537725-44537747 TATAGCTCCACATTTGGGCCTGG + Intergenic
1119931356 14:78550683-78550705 TACAGTCCAACCTTTAGGCCAGG - Intronic
1128867158 15:71122893-71122915 TACAGCTCTTGCTTTTGACCTGG - Intronic
1131332288 15:91513116-91513138 CACAGCTCAACCTTTGCCACTGG - Intergenic
1131854226 15:96575598-96575620 TACAGGTCAATCTTTGGAAGTGG - Intergenic
1133538161 16:6721963-6721985 TACAGATGAACCTTAGGACAGGG - Intronic
1134803201 16:17104378-17104400 TTCAGCACAATCTTGGGACCAGG + Exonic
1140969442 16:79998815-79998837 GATAGCTCAACCTCAGGACCAGG - Intergenic
1142373480 16:89695503-89695525 TCCAGCTCTGCCTCTGGACCTGG - Intronic
1145870469 17:28269331-28269353 CACAGTTCAACCTTTGGATCAGG - Intergenic
1145870494 17:28269496-28269518 TACAGTTCAACCTATGCACCTGG - Intergenic
1145870520 17:28269688-28269710 CACAGTTCAACCTTTGGATCTGG - Intergenic
1146223572 17:31047580-31047602 CACAGTTCAACCTCTGGACCTGG - Intergenic
1146223594 17:31047740-31047762 CACAGTTCAACCTTTGGATCTGG - Intergenic
1146223617 17:31047905-31047927 TACAGTTCAACCTTTGGACCTGG - Intergenic
1146223641 17:31048097-31048119 CACTGTTCAACCTTTGGACCTGG - Intergenic
1146341412 17:32022388-32022410 CACAGTTCAACCTCTGGACCTGG + Exonic
1146811675 17:35908915-35908937 CACAGTTCAATCTTTGGACCTGG - Intergenic
1146811740 17:35909379-35909401 TACAGTTCAACCTCTGGACCTGG - Intergenic
1146811770 17:35909571-35909593 CACACTTCAACCTTTGGACCTGG - Intergenic
1146812211 17:35913069-35913091 CACAGTTCAACTTTTGGACTTGG - Intergenic
1146812232 17:35913235-35913257 CACAGTTCAACCTTTGGATCTGG - Intergenic
1146812284 17:35913604-35913626 TATAGTTAAACCTCTGGACCTGG - Intergenic
1146812310 17:35913796-35913818 CACACTTCAACCTTTGGACCTGG - Intergenic
1147232738 17:39030907-39030929 CACATTTCAACCTTTAGACCTGG + Intergenic
1147232764 17:39031070-39031092 CATAGTTCAACCTTTGCACCTGG + Intergenic
1147232786 17:39031259-39031281 CACAGTTCAGCCTTTGGGCCTGG + Intergenic
1147232820 17:39031451-39031473 TACAGCTCAACCTTTGGACCTGG + Intergenic
1147232844 17:39031610-39031632 CACAGTTCAACCTTTGGATCTGG + Intergenic
1147232872 17:39031811-39031833 CACAGTTCAACCTTTGGATCTGG + Intergenic
1147232896 17:39031976-39031998 CACAGTTCAACCTCTGGACCTGG + Intergenic
1147921971 17:43923215-43923237 CACAGTTGAACCTCTGGACCTGG - Intergenic
1147921996 17:43923379-43923401 TACAGTTCAACCTTTGGACTGGG - Intergenic
1147922024 17:43923571-43923593 CACAGTTCAACCTTTGGACCTGG - Intergenic
1148173928 17:45548166-45548188 CACCGTTCAACCTCTGGACCTGG - Intergenic
1148173955 17:45548331-45548353 CACAGTTCAACCTTTGGACCTGG - Intergenic
1148173979 17:45548496-45548518 TACAGTTCAACTTTTGGACCTGG - Intergenic
1148174009 17:45548688-45548710 CACAGTTCAACCTTTGGATCTGG - Intergenic
1148275258 17:46296759-46296781 CACAGTTCAACCTTTGGATCTGG + Exonic
1148275288 17:46296951-46296973 TACAGTTCAACTTTTGGACCTGG + Exonic
1148275312 17:46297116-46297138 CACAGTTCAACCTTTGGACCTGG + Exonic
1148275339 17:46297281-46297303 CACCGTTCAACCTCTGGACCTGG + Exonic
1148297364 17:46514338-46514360 CACAGTTCAACCTTTGGATCTGG + Exonic
1148297394 17:46514530-46514552 TACAGTTCAACTTTTGGACCTGG + Exonic
1148297418 17:46514695-46514717 CACAGTTCAACCTTTGGACCTGG + Exonic
1148297445 17:46514860-46514882 CACCGTTCAACCTCTGGACCTGG + Exonic
1148361918 17:47018818-47018840 CGCAGTTCAACCTTTGGATCTGG + Intronic
1148361948 17:47019010-47019032 TACAGTTCAACTTTTGGACCTGG + Intronic
1148361973 17:47019175-47019197 CACAGTTCAACCTTTGGACCTGG + Intronic
1148362000 17:47019340-47019362 CACCGTTCAACCTCTGGACCTGG + Intronic
1150356324 17:64488605-64488627 AACAGCTCAACCTTGTGACTAGG - Intronic
1150405141 17:64895088-64895110 CACCGTTCAACCTCTGGACCTGG - Exonic
1150405168 17:64895253-64895275 CACAGTTCAACCTTTGGACCTGG - Exonic
1150405193 17:64895418-64895440 TACAGTTCAACTTTTGGACCTGG - Exonic
1150405223 17:64895610-64895632 CACAGTTCAACCTTTGGATCTGG - Exonic
1150784178 17:68149697-68149719 CACAGTCCAACCTCTGGACCTGG - Intergenic
1150784199 17:68149859-68149881 CACAGTTCAACCTTTGGACCTGG - Intergenic
1150784224 17:68150024-68150046 CATAGTTCAACCTGTGGACCTGG - Intergenic
1150784254 17:68150216-68150238 CACAGTTCAACCTGTGGACCTGG - Intergenic
1150784279 17:68150381-68150403 CACAGTTCAACCTTTGGACCTGG - Intergenic
1152937951 17:83151643-83151665 CACAGCTCAACTTTTGCACACGG - Intergenic
1156858099 18:41806345-41806367 TACTTCTCAACCTATGCACCTGG - Intergenic
1157834312 18:50885149-50885171 TACAGTTAAAACTTTGGGCCTGG - Intronic
1162765042 19:12914076-12914098 TACAGTTCAACTTTCTGACCCGG - Intronic
929982820 2:46697962-46697984 TACAAATCGACCTTTGAACCCGG + Intergenic
930506972 2:52294811-52294833 TACAAGTCAACCTTTGTTCCTGG + Intergenic
937180036 2:119986741-119986763 TACAGCTTAACTTGTGGAACTGG - Intergenic
937442674 2:121930377-121930399 TTCAGCTGAACCCTGGGACCAGG - Intergenic
938238848 2:129727503-129727525 GACAGCTCACCCTGTGGGCCTGG + Intergenic
1182910700 22:33981854-33981876 TAGAGCTTAACCTCTGGATCAGG + Intergenic
1183945821 22:41325182-41325204 TCCAGCTCTACCTCTGGCCCTGG - Intronic
952495229 3:33909966-33909988 TCCAGCCCAACTTTTGGTCCAGG - Intergenic
956001176 3:64731520-64731542 TACTGCTCCACCCTTGGATCTGG - Intergenic
959311171 3:104739639-104739661 TACAGATCAGCCTTTGTATCTGG - Intergenic
959861982 3:111226878-111226900 TTAACCTCAACCTTTGAACCAGG - Intronic
960690566 3:120342193-120342215 TAAGGCCCCACCTTTGGACCAGG + Intronic
962930121 3:140028228-140028250 GACAGCACAACCTTGAGACCAGG - Intronic
981798811 4:148631952-148631974 TAGAACTCATCCTTTGGATCAGG - Intergenic
982287098 4:153746919-153746941 TGCAGCTCAACCTGTGGCTCTGG - Intronic
982379583 4:154735579-154735601 TCTGGCTAAACCTTTGGACCTGG + Intronic
983379158 4:166968952-166968974 GACAGCTCAACCCTTGCACCAGG + Intronic
985997381 5:3604505-3604527 TCCAGCTCAACCTTTGGGCTGGG - Intergenic
986990950 5:13552500-13552522 TACAGTTCACCCTCTGGGCCTGG - Intergenic
991353927 5:65748229-65748251 CACAGCTCAACCCTTCGACCTGG - Intronic
993748843 5:91640359-91640381 TACAGCTTATCCCTTTGACCAGG - Intergenic
995780738 5:115772832-115772854 CACAGCTCACTCTTTGGTCCTGG + Intergenic
1008508357 6:52253160-52253182 TACTGCTCAAAGTTTGGTCCTGG + Intergenic
1017100073 6:150841030-150841052 TACAGCACAACTTTTGGAAATGG + Exonic
1019800456 7:3084511-3084533 AAAAGCTCCACCCTTGGACCTGG + Intergenic
1020016089 7:4833012-4833034 ATCAGCTCAATCTCTGGACCAGG + Intronic
1024825140 7:53382424-53382446 TAAAGCTAAACCTGTGGGCCTGG - Intergenic
1028737941 7:94239070-94239092 TTCAGCTGGAACTTTGGACCTGG + Intergenic
1034684192 7:152955286-152955308 TACAACTGAACCTTTGTACCAGG - Intergenic
1035253351 7:157611498-157611520 CGCAGCTCAACCCTGGGACCTGG - Intronic
1038492983 8:27983188-27983210 GACAGCTCACCCATTGGACAAGG - Intronic
1040300164 8:46183821-46183843 TACACCTCAGGCTTTGGAGCAGG - Intergenic
1041079402 8:54202284-54202306 TTCAGCTCAACCTTGGGATGTGG + Intergenic
1042304670 8:67318697-67318719 TACAGGTGAACCATTGCACCTGG - Intronic
1043170675 8:76961985-76962007 CAAAGCTGAACTTTTGGACCTGG - Intergenic
1045869220 8:106906380-106906402 TATAGCTCAGCCCTTGGACTAGG + Intergenic
1046441560 8:114261921-114261943 TACAACTCAGCCTCTTGACCAGG + Intergenic
1050744328 9:8858421-8858443 TGCAGCCCAGTCTTTGGACCTGG + Intronic
1056725551 9:89111718-89111740 TAAAGCTCAATCTTTAGACTTGG + Intronic
1061727598 9:132589989-132590011 TACAGCTCAGCCGCTGGCCCAGG - Exonic
1196740565 X:119021742-119021764 TCCAGCTCTACCTGTGGAGCTGG + Intergenic
1201293158 Y:12441497-12441519 TGCAGCTCCACCTCTGGACGGGG - Intergenic