ID: 1147232821

View in Genome Browser
Species Human (GRCh38)
Location 17:39031452-39031474
Sequence ACAGCTCAACCTTTGGACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 11, 2: 16, 3: 14, 4: 96}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147232814_1147232821 25 Left 1147232814 17:39031404-39031426 CCAACACCAGGTCAGGATCAAGC No data
Right 1147232821 17:39031452-39031474 ACAGCTCAACCTTTGGACCTGGG 0: 1
1: 11
2: 16
3: 14
4: 96
1147232815_1147232821 19 Left 1147232815 17:39031410-39031432 CCAGGTCAGGATCAAGCTCAGCA No data
Right 1147232821 17:39031452-39031474 ACAGCTCAACCTTTGGACCTGGG 0: 1
1: 11
2: 16
3: 14
4: 96
1147232816_1147232821 -5 Left 1147232816 17:39031434-39031456 CCAATGTCACCCAGCGTTACAGC 0: 1
1: 0
2: 9
3: 5
4: 93
Right 1147232821 17:39031452-39031474 ACAGCTCAACCTTTGGACCTGGG 0: 1
1: 11
2: 16
3: 14
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147232821 Original CRISPR ACAGCTCAACCTTTGGACCT GGG Intergenic
900020209 1:182894-182916 GCAGGTCTACCTTTGGCCCTGGG + Intergenic
900911362 1:5599102-5599124 ACAGCTCAAGATTTAGATCTGGG + Intergenic
904083430 1:27886474-27886496 AGAACACAACCTTAGGACCTTGG + Exonic
904423714 1:30410174-30410196 ACAGCTTAAGAGTTGGACCTGGG - Intergenic
911485700 1:98502007-98502029 ACAGTTTGACCTTTTGACCTGGG - Intergenic
915597148 1:156902247-156902269 ACAGCTCAGCCCTGGGGCCTGGG - Exonic
918693335 1:187510381-187510403 AAAGCTCCACCTTGGGAACTTGG + Intergenic
920039090 1:203084497-203084519 CCAGCCCACCCTTTGGGCCTTGG + Intronic
1063094201 10:2895083-2895105 ACAGCTCATGCTTTGGAACAAGG + Intergenic
1063414238 10:5860185-5860207 ACATCTCAAAATCTGGACCTAGG - Intergenic
1064591241 10:16892937-16892959 ACAACTCTACCTTTTGGCCTGGG + Intronic
1065589247 10:27249463-27249485 ACAGTTCAACCTTTGGATTTGGG - Intergenic
1065589273 10:27249628-27249650 ACAGTTCAACCTTTGGACCTGGG - Intergenic
1065589303 10:27249820-27249842 ACAGTTCAACCTTTGGACCTGGG - Intergenic
1066390341 10:34973060-34973082 ACAGAGCAAACTTTGGAACTTGG - Intergenic
1068994470 10:63186940-63186962 CCAGCTCAGCCTTGGGAGCTGGG - Intronic
1074001636 10:109379479-109379501 ACAGCTGAACTTTAGGCCCTGGG - Intergenic
1074692698 10:116020934-116020956 AGAGGTCAGCCTCTGGACCTGGG + Intergenic
1076137673 10:128056332-128056354 ACTGCTCAGCATTTGCACCTAGG + Intronic
1076278634 10:129226087-129226109 ACAGCTAAACATTTTGTCCTCGG - Intergenic
1077113978 11:874791-874813 ACTGCTCTACCTTTGGAGCCAGG - Intronic
1077903211 11:6507034-6507056 ACAGCTGAATCTTTGGTTCTGGG + Intronic
1079944602 11:26726083-26726105 AAAGCTCAACCTTCTGACTTTGG - Intergenic
1081760442 11:45573008-45573030 ACAGCTCAACCTCAGGCTCTAGG + Intergenic
1083620991 11:64049331-64049353 ACAGCACAGCCTTTGGGCATCGG - Intronic
1092650909 12:10633965-10633987 AAAGCTCAAACTTTGGGGCTGGG - Intronic
1092875279 12:12842352-12842374 ACAGCACCAACTTTAGACCTGGG + Intergenic
1094073947 12:26451778-26451800 ACAGCTCAACCCTTGAAGCAGGG + Intronic
1098474447 12:70884010-70884032 ACAGCCAAAGCTTTAGACCTGGG - Intronic
1104206877 12:126647740-126647762 ACAGCTCAACCTCCTGACTTGGG + Intergenic
1105358625 13:19685215-19685237 CCAGCCCAACCTTTGGCCCTTGG + Intronic
1109416379 13:62046485-62046507 GCAGCTCAGCCTGTGGCCCTGGG - Intergenic
1112459007 13:99586645-99586667 ACAGCCAAATGTTTGGACCTCGG + Intergenic
1113960139 13:114121638-114121660 ACAGCTCGACCTTTGACCTTCGG + Intronic
1119522795 14:75298604-75298626 CCAGCTCAACTTGTGGAGCTTGG + Intergenic
1119605739 14:76014837-76014859 TCAGCTTCACCTTTGGACCCTGG + Intronic
1122252664 14:100450946-100450968 GCAGCTCAGGCTTTAGACCTCGG + Intronic
1125251060 15:37704997-37705019 AGAGGTCAACTTTTGGAGCTTGG + Intergenic
1130088672 15:80800892-80800914 ACAGCTCAGCCTTGGGGCCCAGG + Intronic
1130876245 15:88017309-88017331 ACAGCTCCCCCTTTAGACCTAGG + Intronic
1134811031 16:17167139-17167161 ACAGCTCAGGCTCTGGCCCTGGG - Intronic
1140969441 16:79998814-79998836 ATAGCTCAACCTCAGGACCAGGG - Intergenic
1141786590 16:86204879-86204901 ATAGCTTGACCTTTTGACCTGGG + Intergenic
1145870468 17:28269330-28269352 ACAGTTCAACCTTTGGATCAGGG - Intergenic
1145870493 17:28269495-28269517 ACAGTTCAACCTATGCACCTGGG - Intergenic
1145870519 17:28269687-28269709 ACAGTTCAACCTTTGGATCTGGG - Intergenic
1146223616 17:31047904-31047926 ACAGTTCAACCTTTGGACCTGGG - Intergenic
1146223640 17:31048096-31048118 ACTGTTCAACCTTTGGACCTGGG - Intergenic
1146811769 17:35909570-35909592 ACACTTCAACCTTTGGACCTGGG - Intergenic
1146811811 17:35909933-35909955 ACATTTCAACCTTTAGACCTAGG - Intergenic
1146812231 17:35913234-35913256 ACAGTTCAACCTTTGGATCTGGG - Intergenic
1146812283 17:35913603-35913625 ATAGTTAAACCTCTGGACCTGGG - Intergenic
1146812309 17:35913795-35913817 ACACTTCAACCTTTGGACCTGGG - Intergenic
1147232739 17:39030908-39030930 ACATTTCAACCTTTAGACCTGGG + Intergenic
1147232787 17:39031260-39031282 ACAGTTCAGCCTTTGGGCCTGGG + Intergenic
1147232821 17:39031452-39031474 ACAGCTCAACCTTTGGACCTGGG + Intergenic
1147232873 17:39031812-39031834 ACAGTTCAACCTTTGGATCTGGG + Intergenic
1147922023 17:43923570-43923592 ACAGTTCAACCTTTGGACCTGGG - Intergenic
1148173954 17:45548330-45548352 ACAGTTCAACCTTTGGACCTGGG - Intergenic
1148173978 17:45548495-45548517 ACAGTTCAACTTTTGGACCTGGG - Intergenic
1148174008 17:45548687-45548709 ACAGTTCAACCTTTGGATCTGGG - Intergenic
1148275259 17:46296760-46296782 ACAGTTCAACCTTTGGATCTGGG + Exonic
1148275289 17:46296952-46296974 ACAGTTCAACTTTTGGACCTGGG + Exonic
1148275313 17:46297117-46297139 ACAGTTCAACCTTTGGACCTGGG + Exonic
1148297365 17:46514339-46514361 ACAGTTCAACCTTTGGATCTGGG + Exonic
1148297395 17:46514531-46514553 ACAGTTCAACTTTTGGACCTGGG + Exonic
1148297419 17:46514696-46514718 ACAGTTCAACCTTTGGACCTGGG + Exonic
1148361919 17:47018819-47018841 GCAGTTCAACCTTTGGATCTGGG + Intronic
1148361949 17:47019011-47019033 ACAGTTCAACTTTTGGACCTGGG + Intronic
1148361974 17:47019176-47019198 ACAGTTCAACCTTTGGACCTGGG + Intronic
1150356323 17:64488604-64488626 ACAGCTCAACCTTGTGACTAGGG - Intronic
1150405167 17:64895252-64895274 ACAGTTCAACCTTTGGACCTGGG - Exonic
1150405192 17:64895417-64895439 ACAGTTCAACTTTTGGACCTGGG - Exonic
1150405222 17:64895609-64895631 ACAGTTCAACCTTTGGATCTGGG - Exonic
1150784198 17:68149858-68149880 ACAGTTCAACCTTTGGACCTGGG - Intergenic
1150784223 17:68150023-68150045 ATAGTTCAACCTGTGGACCTGGG - Intergenic
1150784253 17:68150215-68150237 ACAGTTCAACCTGTGGACCTGGG - Intergenic
1150784278 17:68150380-68150402 ACAGTTCAACCTTTGGACCTGGG - Intergenic
1157393901 18:47326023-47326045 ACAGCTCAACCTTCCCTCCTGGG - Intergenic
1159124677 18:64208787-64208809 ACAGCTTGACCTTTTGACTTGGG - Intergenic
1164180089 19:22810737-22810759 ACAGTTTGACCTTTGGAGCTGGG + Intergenic
1167586537 19:50378621-50378643 GCAGCTCAGCCTCTGGGCCTGGG + Exonic
927551938 2:24009115-24009137 ACAGTTTGACCTTTTGACCTGGG + Intergenic
931017608 2:58002620-58002642 TCAGCTCAGCCTTTAGAGCTTGG - Intronic
931388927 2:61822912-61822934 AGATTTCAACATTTGGACCTAGG - Intergenic
931653294 2:64488141-64488163 GGAGCTCTACCTTTGCACCTTGG - Intergenic
937121187 2:119440853-119440875 GCAGCTGAACCTTTGAAGCTAGG + Intronic
940143563 2:150522161-150522183 ACAGCCCTACCTCTGGACCCAGG - Intronic
1170474031 20:16697045-16697067 ACAACTAAACATTTGGACCATGG + Intergenic
1171306226 20:24108879-24108901 GCAGCTAAACCTTTGGGCCCCGG - Intergenic
1173440259 20:43069165-43069187 GGAGCTCAGCCTTTGGACCTAGG - Intronic
1182678086 22:32055816-32055838 ACAGCACCACCTTTGGGCCAAGG - Intronic
1184938430 22:47741802-47741824 TCAGCTCAGCCTTAGGGCCTGGG + Intergenic
949300726 3:2580932-2580954 AAAGCCCAGGCTTTGGACCTGGG - Intronic
950674664 3:14547472-14547494 TTAGCTCAAGCTTTGGAACTTGG + Intergenic
953341444 3:42137593-42137615 ACTTCTCAAACTTTGGACCAAGG + Intronic
954647022 3:52137860-52137882 TCAACTCAACCTCTGGACCAAGG + Intronic
955952980 3:64260805-64260827 ACAGTTCAACCTTTGTTCCCTGG + Intronic
956001175 3:64731519-64731541 ACTGCTCCACCCTTGGATCTGGG - Intergenic
957718025 3:83957457-83957479 ACAACTCAGCCTTTGGAGCCTGG + Intergenic
960894598 3:122489400-122489422 CCACCTCAACCTTGGGACTTAGG + Intronic
966530089 3:180968046-180968068 ACAGCTCAGAATTTGTACCTTGG - Exonic
969183488 4:5459256-5459278 CCAGCTCCACCTGTGGACCCTGG + Intronic
969691409 4:8706094-8706116 AAAGCTACAGCTTTGGACCTGGG - Intergenic
972807628 4:42546147-42546169 ACAGCATAACCTTTGGACCGAGG - Intronic
985997379 5:3604504-3604526 CCAGCTCAACCTTTGGGCTGGGG - Intergenic
986990949 5:13552499-13552521 ACAGTTCACCCTCTGGGCCTGGG - Intergenic
991917026 5:71615531-71615553 ACATCTCTACTTTTGAACCTCGG + Intronic
993440549 5:87951702-87951724 ACAGCTCAACCTGAGGTCATGGG - Intergenic
995218350 5:109620589-109620611 ACAGCTCAATATTAGTACCTTGG + Intergenic
995248306 5:109960731-109960753 TCAGCTCAACCTCTGGTCTTTGG - Intergenic
998313299 5:141156464-141156486 ATAGCTCAAGATTTGGACGTAGG + Intergenic
998376667 5:141695350-141695372 ACAGGTAGACCTTTAGACCTGGG - Intergenic
1006788675 6:36684598-36684620 ACAGGTCAGCCCTTGGACCATGG - Intronic
1007832136 6:44646783-44646805 CCAGCTCAACCTTTGGGTTTGGG - Intergenic
1008131598 6:47725559-47725581 ACATCTACACCTTTGGGCCTGGG + Intergenic
1008508358 6:52253161-52253183 ACTGCTCAAAGTTTGGTCCTGGG + Intergenic
1019441506 7:1049877-1049899 ACAGCTGAAGCTGTGCACCTGGG + Intronic
1019800457 7:3084512-3084534 AAAGCTCCACCCTTGGACCTGGG + Intergenic
1024050376 7:45617397-45617419 ACAGCTGACCCTTCAGACCTAGG - Intronic
1025264012 7:57440749-57440771 ACAGCTGGACCTTTGAATCTAGG + Intergenic
1025635225 7:63315359-63315381 ACAGCTGGACCTTTGAATCTAGG - Intergenic
1025647470 7:63432811-63432833 ACAGCTGGACCTTTGAATCTAGG + Intergenic
1028737942 7:94239071-94239093 TCAGCTGGAACTTTGGACCTGGG + Intergenic
1043345861 8:79297011-79297033 ACAGCTTAAACTATGCACCTGGG + Intergenic
1043809716 8:84722411-84722433 ACAGCTCAACCCTATGACCTTGG - Intronic
1045343246 8:101272688-101272710 ACAGCTCCTCCTTTGGTGCTGGG + Intergenic
1047709357 8:127535757-127535779 GAAGCTCAACCTTAGAACCTTGG + Intergenic
1047790386 8:128197673-128197695 AAAACTCAAAATTTGGACCTGGG - Intergenic
1048781331 8:138005636-138005658 ACAGCTCCACCTCTGCTCCTGGG - Intergenic
1051470054 9:17428134-17428156 ACCTCTCATCCTTTGGGCCTTGG - Intronic
1055935342 9:81599287-81599309 ACAGCTCCACTTTTGCAGCTGGG - Intronic
1056536823 9:87535452-87535474 ACAGCTGAACATTTGAAACTTGG + Intronic
1057954545 9:99397099-99397121 ACAGCTTAACCGTAAGACCTCGG + Intergenic
1060025790 9:120170017-120170039 AGAGCTCAAGCTTTGGAGATAGG - Intergenic
1190771394 X:53517620-53517642 ACAGATCAAGCTTTGGTACTTGG - Intergenic
1196645371 X:118112092-118112114 AGAGCTCAAGCTCTGGAGCTAGG - Intronic
1197883727 X:131195964-131195986 ACAGCTGAAGCTTTGGACAATGG - Intergenic