ID: 1147242139

View in Genome Browser
Species Human (GRCh38)
Location 17:39097363-39097385
Sequence TAGTAAACCCCAAATGATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 179}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147242139_1147242143 22 Left 1147242139 17:39097363-39097385 CCATGATCATTTGGGGTTTACTA 0: 1
1: 0
2: 0
3: 16
4: 179
Right 1147242143 17:39097408-39097430 CAAACAAATTCCCTGCTTGCCGG 0: 1
1: 1
2: 0
3: 12
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147242139 Original CRISPR TAGTAAACCCCAAATGATCA TGG (reversed) Intronic
900748717 1:4379727-4379749 TAGGAAACCACAGATGAGCACGG - Intergenic
902090989 1:13903035-13903057 TGGGAAACCCCAAAGCATCAGGG + Intergenic
902774314 1:18664830-18664852 TGGTAAACCCCAAATCCTGAAGG + Intronic
903764240 1:25723396-25723418 TAGAAAACCCCAAAGGCTCTGGG - Intronic
906548177 1:46637544-46637566 AATTAAACCCCAAAAGGTCATGG + Intronic
907211005 1:52821702-52821724 TAGAAACCCCCAAAACATCAGGG - Exonic
908169007 1:61486353-61486375 TAGTAAATAACAAATTATCATGG + Intergenic
909097239 1:71303015-71303037 TGGTTTACCCAAAATGATCATGG + Intergenic
909370998 1:74883280-74883302 TAATAAAACTCAAGTGATCATGG - Intergenic
912433871 1:109644635-109644657 CAGTAAACCCCAAATGACAAAGG + Intergenic
914443729 1:147731183-147731205 GAATAAACCCCATTTGATCATGG + Intergenic
914952553 1:152129557-152129579 TAGTAAAACCCAAAACAGCACGG - Intergenic
916047243 1:161009318-161009340 TGGTAAACCCCAAGTGAAAAGGG + Intronic
917155928 1:171998976-171998998 TACAAAACCCCACATGATCTGGG - Intronic
917330931 1:173879627-173879649 TTGTAAACCCCAAAAGAACACGG + Intronic
918257699 1:182764583-182764605 TCGTAAACCCCACAAGATGATGG - Intergenic
919015427 1:192027414-192027436 GAGTAAAGCCTAATTGATCATGG + Intergenic
919696759 1:200584506-200584528 TGATAAACCCCACTTGATCATGG - Intronic
922071634 1:222200590-222200612 TAGCAAACCTCAAAAGATTACGG + Intergenic
924945430 1:248843196-248843218 TAGTAACCCCCATGTGATCTGGG - Intronic
1062903074 10:1160284-1160306 TAGAAAACCCCAAATAATAGAGG + Intergenic
1063558293 10:7101636-7101658 TAGTAAAGCCCAAATGCACAGGG - Intergenic
1063807765 10:9666791-9666813 TGGTAAAACCCAAATGAGCTAGG + Intergenic
1064877672 10:20013429-20013451 CATTAAACCACAAAAGATCAGGG - Intronic
1065208993 10:23384648-23384670 TAGCAAATCACAAATGAACATGG + Intergenic
1067225290 10:44372356-44372378 TAGTTCACCCCAAAGGACCACGG + Intronic
1067430880 10:46244469-46244491 GAGTAAATCCCACTTGATCATGG - Intergenic
1070004692 10:72412060-72412082 TAGTAAGCTCCAAAAAATCAAGG - Intronic
1070052591 10:72903826-72903848 CAATAAACCCCAAATAATGATGG + Intronic
1070435170 10:76384047-76384069 TAGTAAACTCCCAAAGAGCATGG + Intronic
1072777836 10:98218368-98218390 GAATAAACCCCACTTGATCATGG - Intronic
1073348637 10:102803026-102803048 AAGTAAAACCAAAATGACCAAGG + Intronic
1073658417 10:105444294-105444316 GAATAAACCCAAATTGATCATGG + Intergenic
1077826441 11:5813820-5813842 TGATAAAGCCCAAGTGATCATGG - Intronic
1080195696 11:29605947-29605969 TAGTAAACCCAACATGAGAAAGG - Intergenic
1080269619 11:30437271-30437293 TAGAAAAACCTAAATGAACAGGG - Intronic
1080616613 11:33949991-33950013 AAGTAAATGACAAATGATCAAGG + Intergenic
1085318590 11:75561169-75561191 TAGGAAACCCTAAATAATCTGGG - Intergenic
1085860680 11:80230797-80230819 GAATAAACCCCACTTGATCATGG - Intergenic
1086669843 11:89532751-89532773 TAGTAATCCCCACATGTTGACGG + Intergenic
1092981931 12:13804393-13804415 TAGTGAACCCTAAATGATTGTGG - Intronic
1093996257 12:25646142-25646164 TAGTAAACCCCAAGCTATGAGGG + Intronic
1095499406 12:42820153-42820175 TAGTAAACCCCATAAAATGAGGG - Intergenic
1097650236 12:62288930-62288952 GAGTAAAACCCACTTGATCATGG + Intronic
1098164519 12:67679983-67680005 TTGTAAACCCCAAAAGAAAAAGG - Intergenic
1100009961 12:89941072-89941094 TAGAAAGCCCCAGATGACCAGGG - Intergenic
1101299258 12:103460938-103460960 GAGAAAATCCCAGATGATCATGG - Intronic
1101795494 12:107969285-107969307 TAGTCAACTCCCAGTGATCATGG - Intergenic
1104702804 12:130919981-130920003 TATTCCAACCCAAATGATCAGGG - Intergenic
1105249158 13:18680907-18680929 AATTGAACCCCAAATCATCAGGG - Intergenic
1109156089 13:58911319-58911341 TAGTAAAACTCAAATCAGCAAGG + Intergenic
1110008525 13:70302399-70302421 TTGTAATCCCCAAGTGACCATGG - Intergenic
1110062887 13:71064387-71064409 TTGTAATCCCCACATGTTCAGGG - Intergenic
1111438008 13:88237783-88237805 AAATAAAACTCAAATGATCAAGG - Intergenic
1113490068 13:110684474-110684496 TGGTCAACCCCGAATGACCAGGG + Intronic
1113728005 13:112619383-112619405 TCCTAAACCCCAAACGTTCATGG - Intergenic
1114410706 14:22497717-22497739 TAGTAAACCACAAAAACTCACGG - Intergenic
1115850496 14:37586157-37586179 TAGAGAACCCCAAAAGATCACGG + Intergenic
1117386842 14:55223514-55223536 TAGGAAATCCTAAGTGATCAAGG + Intergenic
1118562743 14:67104208-67104230 CAGTAAATCCCACTTGATCATGG + Intronic
1119029834 14:71183316-71183338 TTGTAAACCCCACATGGTCCAGG - Intergenic
1122314066 14:100815400-100815422 TAAGCAACCCCAAATGAACAAGG - Intergenic
1123795136 15:23763506-23763528 TCATAATTCCCAAATGATCAGGG - Intergenic
1125208681 15:37185100-37185122 GAGTAAACCACAGTTGATCATGG - Intergenic
1128954874 15:71929627-71929649 GAATAAACCCCAACTGATCATGG + Intronic
1129770253 15:78198855-78198877 TAGCAAACCCAAAATGCTCATGG + Intronic
1131039611 15:89251655-89251677 TATTAAATCCCACTTGATCATGG - Intronic
1138043098 16:53695742-53695764 TAGTAAACCCCAAATCTTAAGGG + Intronic
1140060286 16:71563404-71563426 TAATAAATCCCACTTGATCATGG + Intronic
1140152636 16:72386390-72386412 TAATAAATCCCACTTGATCATGG - Intergenic
1142916556 17:3144243-3144265 GAATAAACCCCACTTGATCATGG + Intergenic
1143420378 17:6786658-6786680 TAAAAACCCCCAAATCATCATGG + Intronic
1146019386 17:29264026-29264048 AAGTAAAACCAAAAAGATCAAGG + Exonic
1146327927 17:31903065-31903087 TAGTAAACTCCATATGGGCAGGG + Intergenic
1147242139 17:39097363-39097385 TAGTAAACCCCAAATGATCATGG - Intronic
1147295943 17:39482404-39482426 CAGTAAACTCCAAATGAACCAGG + Intronic
1149117390 17:53113945-53113967 TAGTAGATCCCAAATTATAATGG + Intergenic
1150534686 17:66023968-66023990 GAGTAAAACCCACTTGATCATGG - Intronic
1151254792 17:72868080-72868102 TATTAAACCACAAGTGATCAGGG - Intronic
1152513978 17:80811418-80811440 TGGTAAACCCCAGCTGGTCATGG + Intronic
1153085557 18:1281978-1282000 GAATAAAGCCCAAATGATCATGG - Intergenic
1153635772 18:7112166-7112188 TTTTAAACCCCAAAAGATCTAGG + Intronic
1154439725 18:14378323-14378345 AATTGAACCCCAAATTATCAGGG + Intergenic
1155825299 18:30434874-30434896 CAGTAAAAGCCAAATGATAATGG + Intergenic
1159316395 18:66779288-66779310 TAGTATGCAACAAATGATCAAGG + Intergenic
1159356536 18:67343625-67343647 TAGTAAACCTGAAAAGATGAAGG - Intergenic
1161786847 19:6331944-6331966 TAGGAATGCACAAATGATCACGG - Intronic
1162303298 19:9856639-9856661 CAGTAACCCCCAAGTGACCAAGG - Intronic
1165698879 19:37922056-37922078 CAGCAAACCCCAAATGCTGATGG + Intronic
925937962 2:8785665-8785687 TCCTAAAGCCCAAATGAGCATGG + Intronic
927328971 2:21840558-21840580 TTGTAAACCCCATATGTTGAGGG + Intergenic
927366554 2:22303995-22304017 TAATAAATCCCAAATGGTCAAGG - Intergenic
929102499 2:38329746-38329768 GAGTAAATCCCACTTGATCATGG - Intronic
930058407 2:47269623-47269645 TGAAAAGCCCCAAATGATCACGG + Intergenic
935508766 2:103943720-103943742 AAATAAATCCCACATGATCATGG - Intergenic
937536075 2:122889067-122889089 TAGTTAAATCCAAATGCTCAAGG + Intergenic
937753747 2:125510783-125510805 TAAAAAAACACAAATGATCAAGG - Intergenic
937754523 2:125520000-125520022 GAGTAAAGCCCAGTTGATCATGG - Intergenic
938964098 2:136372693-136372715 TAGAAACCCCCAAATGACCTGGG - Intergenic
939698773 2:145362772-145362794 TAGTATGCACCAAGTGATCAAGG + Intergenic
940284733 2:152022846-152022868 CATTAAAACCCAGATGATCAGGG + Intronic
940793563 2:158053357-158053379 TAGTACACCCCAAATTCTCAAGG + Intronic
941374790 2:164714322-164714344 TAGTAAAAGCCCAATGATGAGGG + Intronic
943063400 2:183061797-183061819 TTGTGAACCTCAAATGAACAGGG - Intergenic
943215849 2:185033146-185033168 TAATAAATCCCACATGATAATGG + Intergenic
943962111 2:194278770-194278792 TTCAAAACCCCAATTGATCACGG + Intergenic
946516220 2:220414108-220414130 AAATAAACCCCAAATGGACATGG - Intergenic
946868824 2:224067577-224067599 AAGTAAACCCCACATGAGCAGGG - Intergenic
947110674 2:226716038-226716060 AAATAAACCCCACTTGATCATGG + Intergenic
1169556378 20:6755128-6755150 TTGTAAACCCCACATGTTGAGGG + Intergenic
1173623621 20:44455373-44455395 AAGAAAACCCCAAATAAACAAGG - Intronic
1176997276 21:15570305-15570327 TACTAAATGCCAAAGGATCATGG + Intergenic
1180321877 22:11329380-11329402 TTGTAATCCCCAGATGTTCAGGG - Intergenic
953425060 3:42789010-42789032 AAGTAAAAACCTAATGATCATGG - Intronic
954967715 3:54625869-54625891 TAGGACCCCCAAAATGATCACGG - Intronic
956472913 3:69587610-69587632 TAGTAAATTCCACTTGATCATGG - Intergenic
957366871 3:79236383-79236405 TGTTAAATCCCAAATGAACAAGG + Intronic
957379307 3:79405118-79405140 TATTATACCACAAATGATTATGG + Intronic
957548968 3:81679421-81679443 TAGTGAACCCTGATTGATCAAGG - Intronic
958469689 3:94501410-94501432 TGGAAAATCCTAAATGATCAAGG + Intergenic
959118318 3:102204538-102204560 TAATAAACTCCCAAAGATCAAGG - Intronic
960764959 3:121116020-121116042 TTGTAATCCCTAAATGTTCAAGG - Intronic
963655693 3:148046787-148046809 GAATAAACCCCACTTGATCATGG + Intergenic
964009973 3:151880971-151880993 TACTAAAACCCAAATGGCCAAGG - Exonic
964066929 3:152591494-152591516 TAATAAGCTCCAAGTGATCAAGG + Intergenic
964904456 3:161702079-161702101 TAATAAACTCCCAAAGATCAAGG + Intergenic
965949482 3:174288930-174288952 CAATAAAACTCAAATGATCAAGG - Intergenic
967834883 3:193953024-193953046 GAGTAAACCCCACTTAATCATGG + Intergenic
971560207 4:28069802-28069824 TGGTAAAACCCATTTGATCATGG - Intergenic
972219105 4:36933618-36933640 GAATAAACCCCACTTGATCATGG - Intergenic
973107256 4:46355672-46355694 CAGGAACCCCCAAATAATCAGGG + Intronic
973885444 4:55316295-55316317 TAGAAAACCCCAACAGATCATGG + Intergenic
975846112 4:78526731-78526753 TTGTAACCCCCAAATCAACATGG + Intronic
976886274 4:89988519-89988541 TAATAAACTCCAAAAGGTCAAGG - Intergenic
977107183 4:92901702-92901724 GAGTAAAACCCACTTGATCATGG + Intronic
977513900 4:97995827-97995849 TTGTAAACCCCACATGTTGAAGG + Intronic
980695943 4:136355886-136355908 AATTGAACCCCAAATCATCAGGG + Intergenic
981794152 4:148576291-148576313 TAGTATTCCACAAATGTTCATGG - Intergenic
983338342 4:166424603-166424625 TAGTAAGCACCAAATGTTCAAGG + Intergenic
988068050 5:26248462-26248484 TAATAAACCACAAATCATGAAGG + Intergenic
988990732 5:36668295-36668317 GACAAAACCCCAAATGAGCAGGG - Intronic
989192654 5:38686331-38686353 TAGAAAGCCCCAAATGTCCAAGG - Intergenic
989254313 5:39350289-39350311 TTGTAATCCCCACATGTTCAAGG - Intronic
989403182 5:41031406-41031428 TTGTAATCCCCAAATGTTGAGGG - Intronic
990088871 5:52015521-52015543 TAGTAATCCCCACCTGCTCATGG + Intronic
994645826 5:102467567-102467589 TAATAACCCCCACATGATAAGGG - Intronic
994975631 5:106800852-106800874 TAGGGTACCCCAAATAATCAGGG - Intergenic
996816403 5:127578165-127578187 GAATAAATCCCACATGATCATGG - Intergenic
999504833 5:152183944-152183966 TAGTAGACCCATAATAATCAAGG + Intergenic
999776196 5:154814606-154814628 TGACAAACCCCAGATGATCAAGG - Exonic
1001094956 5:168768857-168768879 TATTAAACCTCAAATGATCTGGG - Intronic
1003811808 6:9791723-9791745 TAATAAATCCCACTTGATCATGG - Intronic
1005736659 6:28754106-28754128 GAATAAACCCCACTTGATCATGG - Intergenic
1005880316 6:30052982-30053004 TAGTAGAAACCAAATCATCATGG - Intergenic
1006047741 6:31312040-31312062 TGGAAAACCCCAAATAATCTGGG - Intronic
1006569880 6:34993679-34993701 TAGTAAACGTCAAATGTTGAGGG + Intronic
1008314223 6:50019607-50019629 AAATAAACCCCAAATATTCAGGG - Intronic
1008741341 6:54612906-54612928 GAATAAACCCCACTTGATCATGG + Intergenic
1009023750 6:57973148-57973170 TGGTAGACCCCAAATGCACAGGG + Intergenic
1010843582 6:80677975-80677997 TTGTGATCCCCAAATGCTCAGGG - Intergenic
1015558444 6:134487417-134487439 GAGTAAACCCCACTTGATTATGG + Intergenic
1016559558 6:145379610-145379632 TAGTAAAACACAAAGAATCAGGG + Intergenic
1017570262 6:155736408-155736430 AATTAAACCTCAAATTATCATGG - Intergenic
1018698283 6:166407457-166407479 TAGGAAACCCTAATTGTTCATGG - Intergenic
1018965376 6:168482703-168482725 GAATAAATCCCACATGATCATGG - Intronic
1019087663 6:169496066-169496088 GAGTAAATCCCAGTTGATCATGG - Intronic
1021027939 7:15692262-15692284 TTGTAAGCCACATATGATCATGG + Intergenic
1024926759 7:54624212-54624234 TAATAAATCCCATATGGTCATGG - Intergenic
1027613475 7:80391709-80391731 TAATAAACCCCAAATGTCAAGGG - Intronic
1027931171 7:84537039-84537061 CAGTAAACCCCATTTGATAAAGG + Intergenic
1028003360 7:85530128-85530150 TAGTCGACCCCAAAACATCATGG + Intergenic
1033795656 7:144841866-144841888 TTATAAACCCCAAATGATATTGG + Intergenic
1041344946 8:56887453-56887475 GAGTAAAACCCGAATGAACAAGG + Intergenic
1042830376 8:73020729-73020751 AATTGAACCCCAAATCATCAGGG - Exonic
1044142717 8:88674729-88674751 TAGTAAACACCTCGTGATCAGGG + Intergenic
1044450933 8:92335436-92335458 TAGAGAACCCAAACTGATCAGGG - Intergenic
1044533891 8:93338231-93338253 CAATAAACCCCAAATTATGAAGG - Intergenic
1055675999 9:78661836-78661858 GAACAAACCCCAAAAGATCAGGG - Intergenic
1058163569 9:101595340-101595362 AAGTAAACCCCAAAGGAGAAGGG + Intronic
1058781974 9:108346873-108346895 GGGTAAGCCTCAAATGATCAAGG + Intergenic
1186848654 X:13557134-13557156 TACTAAGTCCCAAATGCTCAAGG - Intergenic
1186918848 X:14254468-14254490 TAGTAAATCCCAAATGAATTAGG + Intergenic
1187652616 X:21425822-21425844 GAGTAAAATCCAAATGATAATGG + Intronic
1188228404 X:27630667-27630689 GAATAAACCCCACTTGATCATGG - Intronic
1188441833 X:30221194-30221216 TAGATAACCTCAAAAGATCAGGG + Intergenic
1189823541 X:44893975-44893997 GAGTAAAACCCAATTGGTCATGG + Intronic
1191665811 X:63701211-63701233 TCCTAAACCCCAGATGATCCAGG - Intronic
1192884973 X:75327549-75327571 AATTGAACCCCAAATCATCAGGG + Intergenic
1193620642 X:83749652-83749674 AATTGAACCCCAAATCATCAGGG + Intergenic
1194029436 X:88793473-88793495 TAATAAAGCCTATATGATCATGG - Intergenic
1194954633 X:100164870-100164892 TAATAAACTCCCAATGGTCAAGG - Intergenic
1196500256 X:116372636-116372658 AAACAAACCCAAAATGATCAAGG - Intergenic
1197997996 X:132400775-132400797 TAGTAAAATCCAGATGATCATGG + Intronic
1199395233 X:147329718-147329740 CAGAAAACCCCAAAATATCATGG + Intergenic
1199752576 X:150834789-150834811 AAGTAAAACCAAAATGAACATGG - Intronic
1201457410 Y:14184653-14184675 TAATGAACCCCAATTGATTATGG + Intergenic