ID: 1147242815

View in Genome Browser
Species Human (GRCh38)
Location 17:39101674-39101696
Sequence TTGCTCCCAGAACCATAAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 118}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147242806_1147242815 29 Left 1147242806 17:39101622-39101644 CCTTATTTGCCGCTTAGCAGTGG 0: 1
1: 0
2: 0
3: 3
4: 44
Right 1147242815 17:39101674-39101696 TTGCTCCCAGAACCATAAGCCGG 0: 1
1: 0
2: 0
3: 10
4: 118
1147242812_1147242815 -10 Left 1147242812 17:39101661-39101683 CCACCAGAGCCATTTGCTCCCAG 0: 1
1: 0
2: 0
3: 17
4: 213
Right 1147242815 17:39101674-39101696 TTGCTCCCAGAACCATAAGCCGG 0: 1
1: 0
2: 0
3: 10
4: 118
1147242810_1147242815 -2 Left 1147242810 17:39101653-39101675 CCCTCAAGCCACCAGAGCCATTT 0: 1
1: 0
2: 1
3: 27
4: 209
Right 1147242815 17:39101674-39101696 TTGCTCCCAGAACCATAAGCCGG 0: 1
1: 0
2: 0
3: 10
4: 118
1147242809_1147242815 20 Left 1147242809 17:39101631-39101653 CCGCTTAGCAGTGGGCGCTTTGC 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1147242815 17:39101674-39101696 TTGCTCCCAGAACCATAAGCCGG 0: 1
1: 0
2: 0
3: 10
4: 118
1147242811_1147242815 -3 Left 1147242811 17:39101654-39101676 CCTCAAGCCACCAGAGCCATTTG 0: 1
1: 0
2: 3
3: 12
4: 171
Right 1147242815 17:39101674-39101696 TTGCTCCCAGAACCATAAGCCGG 0: 1
1: 0
2: 0
3: 10
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147242815 Original CRISPR TTGCTCCCAGAACCATAAGC CGG Intronic
900582496 1:3415958-3415980 TTGCTCCCTGAGCCATCAACTGG - Intronic
900701574 1:4051859-4051881 TTTCTCCTAGGACCAAAAGCTGG + Intergenic
900741833 1:4334974-4334996 TTGCTCCTAGAGACATAACCTGG + Intergenic
904963445 1:34352751-34352773 TTGCTCCCAGAAGAGTCAGCAGG - Intergenic
905083853 1:35351258-35351280 TTGCTTTCAGAATCATAACCAGG - Intronic
910788355 1:91024456-91024478 TTGCTTTCAGAATCATAACCAGG - Intergenic
910969181 1:92837469-92837491 TTGCTTTCAGAATCATAACCAGG - Exonic
918290394 1:183102007-183102029 TTACTCCCAGATCCAGCAGCAGG + Intronic
924062512 1:240189672-240189694 CTGCTCCCATAACAATAAGCTGG - Intronic
1066209848 10:33225953-33225975 ATGTTCCCAGATCCAGAAGCCGG - Intronic
1067144214 10:43681999-43682021 TTGCTCCCAGAATAAAAAGTTGG - Intergenic
1082695426 11:56357864-56357886 TTGCTTTCAGAATCATAATCAGG - Intergenic
1084223598 11:67700316-67700338 TTGGTCCCAGAGCCATTAGATGG - Intergenic
1084591786 11:70094555-70094577 TTCCTACCAGAACCATGAGTAGG + Intronic
1089021148 11:115216236-115216258 TTGCTCACACAACCATATACTGG + Intronic
1089099602 11:115951436-115951458 TTGCTTTCAGAATCATAACCAGG + Intergenic
1091235037 11:134015965-134015987 CTGCTGCCAGAACCCTAGGCTGG + Intergenic
1094625540 12:32120347-32120369 TTGCTCCCATAAATATAAACAGG - Intronic
1104398219 12:128453662-128453684 TTGCTCCCAGCTCCAGAAGGTGG - Intronic
1106224679 13:27775926-27775948 TTTCCCCCAGTACCCTAAGCAGG + Intergenic
1106916193 13:34517257-34517279 TTGGGACCAGAACCATCAGCCGG + Intergenic
1107688330 13:42926427-42926449 TTGCTACCAGAAACACAAACAGG + Exonic
1108511658 13:51161778-51161800 TTGATTTCAGAACCATAACCAGG + Intergenic
1111843462 13:93478638-93478660 TTGCTCCCAGTGCCAAAACCAGG - Intronic
1112470531 13:99684513-99684535 TTCCTTCCAGAATCATAAGAAGG - Intronic
1115824537 14:37252940-37252962 TTGCTACCAGCAAGATAAGCTGG + Intronic
1116572898 14:46540439-46540461 TGGCTCCCAGATCCTTAAGAAGG + Intergenic
1121502156 14:94446560-94446582 TCGCTACCAGACCCAGAAGCAGG - Exonic
1123904599 15:24909260-24909282 TTGCTTTCAGAACCATAACCAGG + Intronic
1124226084 15:27896232-27896254 TTGCTTTCAGAACCATAACCAGG - Intronic
1128860147 15:71063430-71063452 TTGCTTTCAGAATCATAACCAGG + Intergenic
1131363989 15:91821991-91822013 TTTCCCGCAGAAGCATAAGCTGG - Intergenic
1137963956 16:52912740-52912762 TTGCTCACAGCACCATCTGCTGG + Intergenic
1139846493 16:69924995-69925017 TTTCTCCAAGAACCACACGCAGG - Intronic
1142502139 17:339132-339154 TTGCTCACAGAAACACAAACAGG + Intronic
1143121942 17:4613589-4613611 TTCCTTCCACAACAATAAGCAGG + Intergenic
1146043747 17:29484381-29484403 TTTCACCTAGAACCATAATCAGG - Intronic
1146254938 17:31386436-31386458 TTGCTCACAGAAACATATTCTGG + Intergenic
1147242815 17:39101674-39101696 TTGCTCCCAGAACCATAAGCCGG + Intronic
1147302417 17:39540691-39540713 CTGCTCCCAGAGCCATAAAGTGG + Intronic
1147380980 17:40056100-40056122 TTGCTTCCAGAGCCTTAAGTGGG - Intronic
1148897583 17:50848487-50848509 TTGCCTTCAGAATCATAAGCAGG - Intergenic
1151734160 17:75928390-75928412 CTCATCCCAGAACCATGAGCTGG - Intronic
1152988072 18:337486-337508 TTGCTCACAGATTTATAAGCAGG + Intronic
1153733028 18:8034671-8034693 TTGAGCCCAGAAGCAGAAGCCGG - Intronic
1153942729 18:9991521-9991543 TTGGTCCCAGAGCCACAAGGAGG - Intergenic
1159741195 18:72173337-72173359 TTTCTCCTAGGACCATCAGCAGG - Intergenic
1159928321 18:74288951-74288973 TTGTTCCCAGAACCACATGTTGG + Intronic
1160077650 18:75693466-75693488 GTGCTACCAGAACCCCAAGCAGG - Intergenic
1164214029 19:23128209-23128231 TTGCTTTCAGAATCATAACCAGG - Intronic
1164289644 19:23855856-23855878 TTGGTCCCAGAGCCATTAGGTGG + Intergenic
1165711524 19:38014438-38014460 CTGCCCCCAGAACCTTCAGCTGG - Intronic
1167718864 19:51163500-51163522 TTGCTGCCAGAAACAAAGGCTGG - Intergenic
931177483 2:59868582-59868604 CTGCTCCCAGAACCCTGTGCAGG + Intergenic
932610860 2:73198854-73198876 TTTCTCCCAGCACCATATGTTGG - Intergenic
933539329 2:83618823-83618845 TGCCTCCCAGAACCATGAGGTGG - Intergenic
934774288 2:96927322-96927344 CTGCTCCCAGAGCCAGGAGCAGG + Intronic
936262047 2:110968374-110968396 TTGCTTTCAGAATCATAACCAGG - Intronic
939844857 2:147230579-147230601 ATGCTCCCATAACAATCAGCTGG - Intergenic
943560868 2:189460358-189460380 TTACTCCCCAAACCATAATCGGG - Intronic
944897324 2:204178217-204178239 TGGCTCACAGAACCCTAACCAGG - Intergenic
945789066 2:214280959-214280981 TTGCTTTCAGAATCATAACCGGG + Intronic
946185745 2:217979564-217979586 TTCCTCCCATTACCAGAAGCTGG + Intronic
948967366 2:241393318-241393340 TTGCACTAAGAACCATAAGGAGG - Intronic
1170521270 20:17188022-17188044 TTCCACCCAGAACAATAAACAGG - Intergenic
1172265661 20:33610863-33610885 GTGCTCCCAGAGCAATAAGAAGG - Intronic
1178179081 21:30139077-30139099 TTGCTCCCAGACCTTTAACCAGG + Intergenic
1178915381 21:36702919-36702941 TTCCTCCCAGAGTCCTAAGCTGG - Intronic
1179145812 21:38766426-38766448 TGGCTTCCAGAACCATAAGGGGG + Intergenic
1181624735 22:24115587-24115609 CTGCTCCCAGAACTATCTGCTGG - Intronic
1184174093 22:42776734-42776756 TTGCTTTCAGAATCATAACCAGG + Intergenic
949865204 3:8541632-8541654 TTGTTCCCATAACCTTTAGCAGG - Intronic
950010282 3:9718148-9718170 TTGGCCCCAAAGCCATAAGCTGG - Exonic
950875758 3:16271125-16271147 TGCCTCCCACAACCATCAGCAGG - Intronic
952053292 3:29412784-29412806 TGTCTCCTAGAACCTTAAGCAGG + Intronic
953180088 3:40586865-40586887 TTGCTTTCAGAATCATAAGCAGG + Intergenic
956739592 3:72265218-72265240 TAGCTCACAGAACCACAATCTGG - Intergenic
962802185 3:138899826-138899848 TTGCTCCATGCACCATCAGCTGG + Intergenic
963222410 3:142826549-142826571 TTACTCCCATCAACATAAGCAGG + Intronic
963227372 3:142876048-142876070 TTTCTCCAAGAACCATCAGTGGG + Intronic
967989998 3:195123631-195123653 TTGGTCTCAGAACCATCAGCTGG - Intronic
971873025 4:32268919-32268941 TTGCTCACAGAACCAGCAGCTGG + Intergenic
974660490 4:64881909-64881931 TTGCTCACAGATCTAAAAGCTGG - Intergenic
977516422 4:98025925-98025947 TTGCTTTCAGAATCATAACCAGG - Intronic
980381508 4:132025684-132025706 TTGTTTCCAAAACCACAAGCTGG - Intergenic
988508785 5:31847804-31847826 TTGCTTTCAGAATCATAACCAGG - Intronic
989180880 5:38575791-38575813 TTGGTCCCAGAACCCAGAGCAGG - Intronic
990407108 5:55502749-55502771 TTGATTCCAGAAACATAAGAGGG + Intronic
990732339 5:58823049-58823071 TTGCTTTCAGAATCACAAGCAGG - Intronic
991308687 5:65210661-65210683 TTGCTTTCAGAATCATAACCAGG - Intronic
993247096 5:85464970-85464992 TTGCTTTCAGAATCATAACCAGG - Intergenic
994046200 5:95313154-95313176 TTCCTCCCAGACCCAGCAGCAGG + Intergenic
994135166 5:96278261-96278283 TTCCTCCTAGAACCACAGGCTGG + Intergenic
996178508 5:120389846-120389868 TTTCTCACAGATCCAGAAGCCGG + Intergenic
996548046 5:124701481-124701503 TAGCTCCCTGAATCATAAGCAGG + Intronic
1000045923 5:157521899-157521921 GTGCACACAGAACCATCAGCTGG - Intronic
1003592279 6:7446181-7446203 TTTCTCCCAGAAACAAAAGCAGG + Intergenic
1004347792 6:14864436-14864458 TTTCTTCCAGAGACATAAGCAGG - Intergenic
1004819238 6:19348716-19348738 TTGCTTTCAGAATCATAACCAGG - Intergenic
1005792948 6:29326076-29326098 TTGGTCCCAGTATCATAAGATGG - Intergenic
1009487436 6:64242320-64242342 TTGATACCAGAACCCAAAGCTGG + Intronic
1013217679 6:108043854-108043876 CTGCTCGCTGAACCTTAAGCTGG + Exonic
1014933690 6:127363053-127363075 TTGCTTTCAGAATCATAACCAGG - Intergenic
1015883603 6:137893482-137893504 TTGCTCCCAAAGCCCAAAGCAGG + Intergenic
1015933497 6:138385583-138385605 TTGCTCACAGAACCCTAATTTGG + Intergenic
1018911936 6:168106321-168106343 TTGCTCCCTGGGCCATAGGCAGG + Intergenic
1023842664 7:44105833-44105855 ATCCTCCCAGGACCCTAAGCAGG - Intronic
1024479166 7:49846377-49846399 CTGCTCCCAGAACTACATGCAGG + Intronic
1024833679 7:53491287-53491309 TTGGTGCCAGAACCAACAGCGGG + Intergenic
1026604895 7:71807216-71807238 TTGCTCCCATATCCACAAACGGG - Intronic
1028715572 7:93963261-93963283 TAGCCCCAAGAACCATGAGCTGG + Intronic
1034996587 7:155581142-155581164 CTCCTCCCAGAACAATAGGCAGG - Intergenic
1035127619 7:156619819-156619841 TTGCCTCCACAACCAAAAGCGGG + Intergenic
1035620348 8:1032047-1032069 ATGCTCCTTGAATCATAAGCCGG - Intergenic
1038335348 8:26641431-26641453 TTGATCCTTGAACCAAAAGCGGG + Intronic
1038528854 8:28300223-28300245 TTGCTTTCAGAATCATAACCAGG - Intergenic
1038547458 8:28436366-28436388 TTTCCGCCAGAAGCATAAGCGGG - Intronic
1039973696 8:42342086-42342108 TTGCTTTCAGAATCATAACCAGG + Intronic
1040667176 8:49648349-49648371 CTGCTCCCATTACCACAAGCAGG - Intergenic
1041231505 8:55757494-55757516 TTGTTCCCTGTACCATTAGCAGG - Intronic
1045523517 8:102923696-102923718 TTGCTTTCAGAATCATAACCAGG + Intronic
1049261911 8:141643813-141643835 TAGCTTCCAAAACAATAAGCTGG + Intergenic
1053406240 9:37878641-37878663 TTGCTCCCAGAACTGTACACCGG + Intronic
1061912288 9:133731583-133731605 TTTCTCCCAGAAGCCTTAGCCGG + Intronic
1189246923 X:39570479-39570501 TTTTTCCCAGAACCACAAGTTGG + Intergenic
1190031804 X:46980576-46980598 TTGCTCTCAGAAGCATATCCAGG - Intronic
1191056643 X:56248636-56248658 TTGCTGCCAGAACCATGCGTAGG - Intronic
1191939357 X:66461662-66461684 TTCCTCCCTGAACCAGAAGCTGG - Intergenic
1199238551 X:145518880-145518902 TGTTTCCCAGAACAATAAGCAGG - Intergenic