ID: 1147245371

View in Genome Browser
Species Human (GRCh38)
Location 17:39116805-39116827
Sequence TAGGCAGCCCTCTTTGGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 1, 2: 0, 3: 7, 4: 109}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147245371_1147245378 18 Left 1147245371 17:39116805-39116827 CCTGGTCCAAAGAGGGCTGCCTA 0: 1
1: 1
2: 0
3: 7
4: 109
Right 1147245378 17:39116846-39116868 GCTTCCTTGTCGGGTTCAAAAGG 0: 1
1: 0
2: 0
3: 2
4: 49
1147245371_1147245376 8 Left 1147245371 17:39116805-39116827 CCTGGTCCAAAGAGGGCTGCCTA 0: 1
1: 1
2: 0
3: 7
4: 109
Right 1147245376 17:39116836-39116858 GAGGCAGCATGCTTCCTTGTCGG 0: 1
1: 0
2: 1
3: 10
4: 176
1147245371_1147245377 9 Left 1147245371 17:39116805-39116827 CCTGGTCCAAAGAGGGCTGCCTA 0: 1
1: 1
2: 0
3: 7
4: 109
Right 1147245377 17:39116837-39116859 AGGCAGCATGCTTCCTTGTCGGG 0: 1
1: 0
2: 1
3: 12
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147245371 Original CRISPR TAGGCAGCCCTCTTTGGACC AGG (reversed) Intronic
903082366 1:20820623-20820645 TAGGCAGCCATGGTTGGGCCTGG - Intronic
903156882 1:21451466-21451488 TAGACAGGCCTCTTTGGAAGGGG - Intronic
913444659 1:118937926-118937948 CAGGCAGCCCTGTCTGTACCAGG + Intronic
913986429 1:143569987-143570009 TAAGCTGGCCTCTCTGGACCAGG + Intergenic
917794208 1:178521160-178521182 CAGGCTGCCCTTCTTGGACCAGG + Intronic
919929254 1:202210493-202210515 AGGGCAGCCCTCTTCAGACCTGG + Intronic
920096353 1:203488743-203488765 GAGGCAGCCCTGTCTGGACCGGG - Exonic
921061312 1:211587242-211587264 TAGCCAGACCTCTGTGGTCCAGG + Intergenic
1064594077 10:16925658-16925680 TGGTCAGGCCACTTTGGACCAGG + Exonic
1065844491 10:29734425-29734447 TAAACAGTCCTCTTTGGAACAGG + Intronic
1067010743 10:42711209-42711231 TGGTCAGGCCACTTTGGACCAGG + Intergenic
1067312769 10:45130003-45130025 TGGTCAGGCCACTTTGGACCAGG - Intergenic
1067469409 10:46525008-46525030 AAGGTGGCCCTCTTTGGGCCGGG + Intergenic
1068892934 10:62166691-62166713 CTGGCATCCCTCTTTGGAGCAGG - Intergenic
1071871532 10:89800466-89800488 TAGGTTGCCCTCTATGGAGCTGG + Intergenic
1073155338 10:101341948-101341970 TTCCCAGCCCTCTCTGGACCTGG + Intergenic
1076872752 10:133201720-133201742 TGGGCCGACCCCTTTGGACCTGG - Exonic
1079353265 11:19711389-19711411 AAGGCAGTCTTCTGTGGACCAGG - Intronic
1079359253 11:19756894-19756916 TTGGCAGCTCTCTCTGTACCAGG - Intronic
1081265379 11:41014667-41014689 TAGACAGCCCTTTTTGAACAAGG - Intronic
1083599003 11:63934661-63934683 TTGCCAGCCCTCTAGGGACCAGG - Intergenic
1087130730 11:94667471-94667493 AAGGCAGCCGTCTATGAACCAGG + Intergenic
1088607633 11:111546652-111546674 TATGCAGTGCTCTTTGGTCCTGG + Intronic
1089280144 11:117368514-117368536 TAGGCAGCCCTCTTAGGACCAGG + Intronic
1089332778 11:117701518-117701540 CAGGCAGGCCTCTTTGGAGGAGG + Intronic
1090414927 11:126534283-126534305 AAGCCAGCCCTCATTGGCCCGGG - Intronic
1093423090 12:18997640-18997662 TAGGCAGATCACTTTAGACCAGG + Intergenic
1094160267 12:27382713-27382735 CAGGCAGCCCTCTGTTGATCTGG - Intronic
1095306600 12:40645736-40645758 TGGGCACCTCTCTTTGGGCCTGG + Intergenic
1105805491 13:23949682-23949704 AAGGCTGCGCTCTTTGGACATGG + Intergenic
1106727319 13:32499171-32499193 TAGGAAGCCTTCCTTGAACCTGG + Intronic
1110051465 13:70906398-70906420 TTGGCAATCCTCTTTGGATCAGG + Intergenic
1111396864 13:87676426-87676448 TCGGCAGCCCTCTAAGGACTTGG + Exonic
1113370944 13:109724976-109724998 CTTGCAGCTCTCTTTGGACCTGG - Intergenic
1118264325 14:64280076-64280098 TGAGCATCCCTCTTTGAACCTGG + Exonic
1121461333 14:94080998-94081020 GCGGCCGCCCTCTCTGGACCCGG + Intronic
1122297422 14:100713290-100713312 TGGGCAGACCTCCTTGGACAGGG - Intergenic
1124099360 15:26679014-26679036 TAGGCAGGTCTCTATGGAACAGG + Intronic
1127416068 15:58758337-58758359 GAGGCTGCCCTCTTTGGACAGGG + Intergenic
1132330419 15:101008703-101008725 TGTGCAGGCCTCTTGGGACCCGG + Intronic
1135666713 16:24341833-24341855 TCAGCAGCCCTCTTTAGACTGGG - Intronic
1137497432 16:48981606-48981628 TAGGCAGCAATCTCTGGCCCAGG - Intergenic
1139392863 16:66616520-66616542 CAGGCAGCCCCCTTTGGGCCTGG + Exonic
1139733703 16:68969523-68969545 TTGGCAGCCGTCTGTGGAACAGG + Intronic
1140654816 16:77129467-77129489 AAGGCAATCCTCTTTGGACAAGG - Intergenic
1141303400 16:82838640-82838662 TAAGCAGCCCTCTGTGAACCAGG - Intronic
1144505726 17:15828951-15828973 CAGGCAGCCCTCTTGGTACAGGG + Intergenic
1145169901 17:20646883-20646905 CAGGCAGCCCTCTTGGTACAGGG + Intergenic
1147245371 17:39116805-39116827 TAGGCAGCCCTCTTTGGACCAGG - Intronic
1150838421 17:68585642-68585664 TGGGCAGCCCTCCATGAACCTGG - Intronic
1151562076 17:74875807-74875829 CAGGCAGCCCTCTTGGCACGAGG - Intergenic
1152269629 17:79316419-79316441 TGGGCAGCCCTCCTTGGGCAGGG + Intronic
1152739750 17:82013693-82013715 CCGGCAGCCCTCTGTGGCCCTGG + Intronic
1159043406 18:63346003-63346025 TATGCAGCCCTTTTTCGCCCTGG + Intronic
1162298531 19:9829841-9829863 AAGGAAGCCCATTTTGGACCAGG - Intronic
1162512964 19:11130916-11130938 TAGGTAGCCTTCTCTGAACCAGG + Intronic
1162977748 19:14218239-14218261 TGGGCAGCCTTCTTTGTGCCAGG - Intergenic
1163478382 19:17540009-17540031 CAAGCAGCCCCCTTAGGACCTGG - Intronic
1164729581 19:30492834-30492856 TAGCCAGCCCTATCAGGACCAGG + Intronic
1165994162 19:39832979-39833001 CAGGCACCCCTCTTTATACCAGG + Intronic
931364136 2:61604004-61604026 TTGACAGCCCTGTTTGGGCCTGG - Intergenic
936094722 2:109523075-109523097 CAGGCAGCCCTCTGTGGTCCTGG + Intergenic
943783675 2:191852359-191852381 AAGGAAGTCCTCTTTGAACCAGG + Intergenic
1171299788 20:24050246-24050268 CATGCAGCCCTGTTGGGACCTGG - Intergenic
1171356198 20:24547286-24547308 CAGGCCGACCTCTTCGGACCTGG - Intronic
1178693080 21:34766181-34766203 TAGGCAGCTCTCTTGAGCCCAGG + Intergenic
1181002252 22:19993315-19993337 AAAGCAGCCCTCTTTGGTTCTGG - Intronic
1181106392 22:20578361-20578383 TCTGCAGCCCTCTCTGGTCCTGG + Intronic
1183211735 22:36455376-36455398 TAGGGACCCCTCTCGGGACCTGG - Intergenic
1184757953 22:46527392-46527414 CAGTCAGCCCTCTCTCGACCCGG + Intronic
949344309 3:3062430-3062452 CTGGCAGCCCTCTCTGTACCAGG + Intergenic
949485382 3:4532918-4532940 TGGTCAGCCCTCTTTGAATCGGG - Intronic
949939414 3:9143323-9143345 TAGGCAACCCACTTTGGTGCTGG - Intronic
950459298 3:13111764-13111786 AAGGCAGCCGTCTGTGAACCAGG + Intergenic
951356088 3:21668202-21668224 AAGGCAGCTCCCTTTGGCCCAGG - Intronic
955797535 3:62653338-62653360 TAGGCAGCTGTCTTTTTACCAGG - Intronic
956105331 3:65811443-65811465 CAGGCAGCCATATTTGGACTGGG + Intronic
961870535 3:129984507-129984529 TTGGCAGCCATCCTTGGAGCTGG - Intergenic
963327732 3:143880964-143880986 GAGGCACCCCTCTTTGGATGTGG - Intergenic
969649078 4:8452923-8452945 CAGGCAGTCCTTTGTGGACCTGG + Exonic
970447622 4:16137118-16137140 TAGGCAGCCCTGTGTGCCCCAGG - Intergenic
973233206 4:47866234-47866256 TAGGCAGACTTCTTTAGACCCGG + Intronic
973991622 4:56414159-56414181 TAGGAAGCCCTCCTTGCACCAGG + Intronic
979278752 4:118841121-118841143 TAGGCAGGGCTCTTGGGGCCAGG + Intergenic
984661277 4:182378436-182378458 GAGGGAGACTTCTTTGGACCAGG + Intronic
985902201 5:2805285-2805307 GAGGGCGCCCTCTGTGGACCAGG + Intergenic
999822359 5:155240629-155240651 TAGACAGCCTGCTTAGGACCTGG + Intergenic
1022797238 7:33741843-33741865 GAGACAGGCCTCTATGGACCTGG + Intergenic
1023503733 7:40878410-40878432 TTGGCATTCCTCTTTGGACAGGG + Intergenic
1024724618 7:52178233-52178255 TTGGCCACCCTCTTTGGAGCTGG - Intergenic
1028815618 7:95140616-95140638 TAGGTAGACCACTTGGGACCAGG - Intronic
1032700200 7:134372554-134372576 TGGACAGCCCACCTTGGACCTGG + Intergenic
1033584965 7:142767654-142767676 CAGGCAGCCCACTGTGGCCCTGG - Intergenic
1033586449 7:142778267-142778289 CAGGCAGCCCACTGTGGCCCTGG - Intergenic
1034527465 7:151674679-151674701 TAGGATGCCCTCTTTGGAAGGGG - Intronic
1035865151 8:3074394-3074416 TAGACAGCTCCCTATGGACCTGG - Intronic
1036237757 8:7055869-7055891 TAGGGAGCCTTGTTAGGACCTGG - Intronic
1037190661 8:16120417-16120439 AAGGCAGCTCACTTTGGACAAGG - Exonic
1038257344 8:25962316-25962338 AAGACAGCCCTCTTTGCAACTGG - Intronic
1041206365 8:55502205-55502227 TAGTCAGCCCTCTTTGCCCATGG - Intronic
1042741128 8:72048258-72048280 CAGGCTGCCCTCTTGGAACCAGG + Intronic
1042756783 8:72223066-72223088 CAGGCTGCCCTCTTAGAACCAGG + Intergenic
1049254827 8:141608185-141608207 AAGACAGCCATCTATGGACCAGG + Intergenic
1049569398 8:143361535-143361557 GAGGCAGCCTTCTGTGGAGCAGG + Intergenic
1050466037 9:5925129-5925151 TAGGCAGACCTCTTGAGCCCAGG + Intronic
1051433478 9:17005183-17005205 GAGGCTGCCCTCTTTGGAGATGG + Intergenic
1052902206 9:33802923-33802945 CAGGCAGCCCGCTGTGGCCCTGG - Intergenic
1053414599 9:37939112-37939134 TAGGAAGCCCTATCTGGCCCTGG - Intronic
1055429228 9:76227127-76227149 TATACGGCCCTCTGTGGACCAGG + Intronic
1056423470 9:86453141-86453163 GAAGCAGCCCTCTCTGAACCAGG - Intergenic
1061387814 9:130300855-130300877 TAGACATCCCTGTTAGGACCAGG - Intronic
1061717870 9:132532225-132532247 CACGCAGCTCTCTTTGGGCCGGG - Intronic
1062468680 9:136692624-136692646 CAGGCAGCCCCCAGTGGACCTGG + Intergenic
1187968069 X:24632270-24632292 TTGGCACCCTTCTTTGGAGCAGG - Intronic
1189533697 X:41913858-41913880 TAGGCAGCCCCCTTCTGATCTGG - Intronic
1189737914 X:44090125-44090147 TGGGGAGCCCACTTTGGATCTGG + Intergenic
1196740816 X:119024296-119024318 TAGGGAGGCATCTTTGGCCCTGG - Intergenic
1198850378 X:140960235-140960257 CAGCCAGCCATCTTTGAACCAGG + Intergenic