ID: 1147245381

View in Genome Browser
Species Human (GRCh38)
Location 17:39116874-39116896
Sequence TGTGTTCCACTCTTGGTGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 144}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147245381_1147245392 27 Left 1147245381 17:39116874-39116896 CCTCGCACCAAGAGTGGAACACA 0: 1
1: 0
2: 0
3: 5
4: 144
Right 1147245392 17:39116924-39116946 CCCGATTATTACAAGGGCCAGGG 0: 1
1: 0
2: 0
3: 0
4: 38
1147245381_1147245386 20 Left 1147245381 17:39116874-39116896 CCTCGCACCAAGAGTGGAACACA 0: 1
1: 0
2: 0
3: 5
4: 144
Right 1147245386 17:39116917-39116939 TGTGGCCCCCGATTATTACAAGG 0: 1
1: 0
2: 0
3: 1
4: 31
1147245381_1147245390 26 Left 1147245381 17:39116874-39116896 CCTCGCACCAAGAGTGGAACACA 0: 1
1: 0
2: 0
3: 5
4: 144
Right 1147245390 17:39116923-39116945 CCCCGATTATTACAAGGGCCAGG 0: 1
1: 0
2: 0
3: 3
4: 35
1147245381_1147245383 2 Left 1147245381 17:39116874-39116896 CCTCGCACCAAGAGTGGAACACA 0: 1
1: 0
2: 0
3: 5
4: 144
Right 1147245383 17:39116899-39116921 ATCTTCCCTTCAGTCTGATGTGG 0: 1
1: 0
2: 0
3: 17
4: 254
1147245381_1147245387 21 Left 1147245381 17:39116874-39116896 CCTCGCACCAAGAGTGGAACACA 0: 1
1: 0
2: 0
3: 5
4: 144
Right 1147245387 17:39116918-39116940 GTGGCCCCCGATTATTACAAGGG 0: 1
1: 0
2: 0
3: 3
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147245381 Original CRISPR TGTGTTCCACTCTTGGTGCG AGG (reversed) Intronic
903416433 1:23186480-23186502 AGAGTTCCACTCTTGTTGCCAGG - Intergenic
904175644 1:28626554-28626576 AGAGTTTCACTCTTGTTGCGCGG - Intronic
905847616 1:41245684-41245706 TGTGTTCCAGGTATGGTGCGAGG - Intergenic
910989858 1:93044291-93044313 TGTGTTTCACTCTATTTGCGTGG + Intergenic
912018910 1:105079037-105079059 TGTGAGCCACTCATGGTGCCTGG + Intergenic
912419122 1:109531551-109531573 TGGGTTCCACTCTCTGTGGGTGG + Intergenic
913718080 1:121559433-121559455 TGTGTTTCACTGTTGATGCTAGG + Intergenic
920872921 1:209808958-209808980 TGTGTTCTAGTCTTGGTTTGTGG - Intergenic
921321184 1:213941142-213941164 TGTGTTCCAGTCATGATGCAAGG - Intergenic
921680083 1:218020831-218020853 TGCATTCCACCCTTGGTGGGAGG - Intergenic
923759698 1:236830345-236830367 TGTTTTCCACTCTTAGTGCTTGG - Intronic
1065028814 10:21564841-21564863 GGTATTCCACTCTTGGTGAGTGG + Intronic
1066659325 10:37724919-37724941 TGTGTTTCACTATTGGTGCATGG - Intergenic
1067520339 10:46995800-46995822 TTTTTTGCACTCTTGGTGCTGGG + Intronic
1070874769 10:79792838-79792860 TGTGTTCCACTTTAGCTGCTTGG + Intergenic
1071641694 10:87315007-87315029 TGTGTTCCACTTTAGCTGCTTGG + Intergenic
1072317216 10:94214792-94214814 TGTGATTCACTCTTGGTCCTCGG - Intronic
1077953505 11:6988489-6988511 TGGTTTCCCCTCTTGGTGCCTGG - Intergenic
1079190482 11:18272899-18272921 TGTGTTACAATCTTGTTGCTAGG - Intergenic
1081668467 11:44930163-44930185 TTTCTTCCACTCTTGGAGCTGGG - Exonic
1086364694 11:86096883-86096905 TGTGTTCCAGGCATGGTGCTAGG - Intergenic
1086783104 11:90931320-90931342 TGTGTTCCACCCTTCATGGGAGG - Intergenic
1087668615 11:101080003-101080025 TGTGTACAACTCTGGGTGCTTGG + Intronic
1088173160 11:107019051-107019073 TGTGTTCCCCGCCTCGTGCGAGG + Intergenic
1088715280 11:112543608-112543630 TGTGTTCCACCCCTCGTGGGAGG + Intergenic
1091003785 11:131933496-131933518 TGTTTTCCACTCTAGCTGCTGGG + Intronic
1098228780 12:68351793-68351815 TGTGTTGCTCCCTTGGTGAGTGG + Intergenic
1101174088 12:102130828-102130850 GGTGTTTCACTCTTGTTGCCTGG - Intronic
1101961854 12:109256584-109256606 TGTATGCCACTGTTGGTGGGAGG + Intronic
1102907803 12:116690378-116690400 TGTGTTCCTCTCTTGGGGGTAGG + Intergenic
1105803857 13:23937587-23937609 GGTGTTTCACTATTGGTGCATGG - Intergenic
1108121121 13:47188656-47188678 TGTGTTGCAATCATAGTGCGGGG - Intergenic
1110834958 13:80073136-80073158 TCCTTTCCACTCTTGGTTCGGGG + Intergenic
1111653907 13:91129398-91129420 AGTGTTTCACTCTTGTTGCCTGG + Intergenic
1119551503 14:75517250-75517272 TTTGTTCTACTCTTGGGGCCGGG - Intergenic
1120737721 14:88072953-88072975 TCTCTTCTACTCTTGGTGCCTGG - Intergenic
1120934697 14:89883054-89883076 TTTCTTCCACTCTTGGTGGAAGG - Intronic
1124725062 15:32149037-32149059 TGGGGCCCACTCTTGGTGTGAGG - Intronic
1125767203 15:42143821-42143843 TGGGTTCCACTCTGTGTGTGAGG - Intronic
1125849796 15:42892015-42892037 TGTATTCCACTTTTGTTGGGTGG - Intronic
1135816250 16:25636705-25636727 TGTGTGCCACTCATGGTTCTAGG + Intergenic
1136539133 16:30919021-30919043 TGAGTTTCACTCTTGTTGCCAGG + Intergenic
1136774851 16:32866524-32866546 TCTCTGCCACTCTTGGTGCCAGG + Intergenic
1136895765 16:33994988-33995010 TCTCTGCCACTCTTGGTGCCAGG - Intergenic
1140909364 16:79437878-79437900 TGTGTCCCACTCTAGGTGAAAGG - Intergenic
1141902679 16:87002910-87002932 TGTGTTGCAATCATGGTGGGTGG + Intergenic
1203077273 16_KI270728v1_random:1128639-1128661 TCTCTGCCACTCTTGGTGCCAGG + Intergenic
1145027271 17:19477432-19477454 TGTGTTCTACTGTTGTTGGGTGG + Intergenic
1146875284 17:36405189-36405211 AGTATTCCACTCTTGCTGGGTGG + Intronic
1147064104 17:37907680-37907702 AGTATTCCACTCTTGCTGGGTGG - Intergenic
1147245381 17:39116874-39116896 TGTGTTCCACTCTTGGTGCGAGG - Intronic
1150662181 17:67092477-67092499 TGTGTCCCACTGTTGTTGCGGGG - Intronic
1153158849 18:2180028-2180050 TGTGTTCCACCCCTTGTGGGAGG - Intergenic
1159977257 18:74729027-74729049 TGTTTTCCAGTTTTGGTGCCAGG + Intronic
1160237397 18:77097111-77097133 TGTGTTGCCCTGTTGGTGGGGGG - Intronic
1163396715 19:17067770-17067792 TGTCTTCCACTCTGGGTGGCTGG - Intronic
1165222585 19:34329076-34329098 TGTGTTCCAGTCATTGTGCCAGG + Intronic
1166952012 19:46435318-46435340 TGTGTTCCGATCCTGGTGTGGGG + Intergenic
926083793 2:10008796-10008818 TTTGTTCCTCTCTTGCTGAGTGG - Intergenic
927147959 2:20179330-20179352 AGTGTTTCAGTCTTGGTTCGGGG + Intergenic
931351064 2:61489386-61489408 GGAGTTTCACTCTTGGTGCCCGG - Intronic
936657686 2:114506700-114506722 TGTGTTCCACCTTTTGTGGGAGG - Intronic
936975215 2:118213070-118213092 TCTGTTCCACTGTTGTTGAGTGG - Intergenic
939588327 2:144032350-144032372 TATGTTCCACATTTGGTGCTGGG - Intronic
943073073 2:183164917-183164939 TGAGTTTCGCTCTTGTTGCGTGG + Intergenic
944765674 2:202862005-202862027 TGTATTCTGCTCTTGGTGGGTGG - Intronic
947615808 2:231556213-231556235 AGAGTTTCACTCTTGGTGCCCGG - Intergenic
948111745 2:235461833-235461855 TGTGTTCTAATCCTGGTGCTGGG - Intergenic
1169370269 20:5023570-5023592 TGAGTTTCACTCTTGTTGCCAGG + Intergenic
1170059620 20:12245425-12245447 TGAGTTTCACTCTTGTTGCCTGG - Intergenic
1170378723 20:15732079-15732101 TGTGTTCCACAAGTGGTGCAAGG - Intronic
1170759567 20:19237711-19237733 TGAGATTCACTCTTGGTGAGAGG + Intronic
1170812885 20:19688252-19688274 TGTGTGCCACACTTGGAGCACGG + Intronic
1170901274 20:20465737-20465759 TGCCCTCCACTCTTGGTGCATGG - Intronic
1175199895 20:57269647-57269669 TGTGATCCATGCTTGGTGGGGGG + Intergenic
1177555162 21:22679396-22679418 TGTGTTCCACCCTTCGTGTCGGG - Intergenic
1181530443 22:23514261-23514283 TGGGTTCCAGTCTTGGAGCCAGG + Intergenic
1184807536 22:46805128-46805150 TGTGATCCTCTCTTGGGCCGTGG + Intronic
949544825 3:5063482-5063504 TGTGTTCCAGGCATGGTGCTGGG - Intergenic
960478082 3:118155497-118155519 TGTATTCTGCTCTTGGTGGGTGG - Intergenic
965948084 3:174267266-174267288 TGGCTTCCACTCATGGTGGGAGG + Intronic
967777755 3:193401880-193401902 TGTGTGCCACTTTTGGGGTGAGG + Intergenic
969883487 4:10195209-10195231 TGTGTTCCACTCTTGACTTGGGG + Intergenic
970131448 4:12876075-12876097 TGTGTTCTACTCCTTGTGGGAGG + Intergenic
970756075 4:19428703-19428725 TGTGTTCCACCCCTTGTGGGAGG + Intergenic
974271456 4:59656234-59656256 GGTTTTCCACTGTTGGAGCGAGG + Intergenic
978597954 4:110399341-110399363 TGAGTTTCACTCTTGTTGCCAGG + Intronic
978626839 4:110694875-110694897 TGTGTTCTACTGTTGTTGGGTGG + Intergenic
979090834 4:116480289-116480311 TGTGCACCACACTTGGTGTGGGG - Intergenic
979885033 4:126016523-126016545 TGTTTTCCAATTTTGGTGCTTGG - Intergenic
981762306 4:148208073-148208095 TGTGTTCCACACATGGTTCTAGG - Intronic
985830384 5:2223822-2223844 TGTGATCATCTCGTGGTGCGGGG + Intergenic
986167918 5:5291760-5291782 TGTGTTGCCCTGTTGGTGCCTGG + Intronic
987452990 5:18109328-18109350 TGTGTGCCAGGCTTGGTGCCAGG + Intergenic
987687174 5:21219787-21219809 TGTTTTCCACTCTTTATGCCCGG + Intergenic
987709653 5:21491635-21491657 TGTTTCCCACCCTTGGTGGGAGG + Intergenic
988545746 5:32155929-32155951 AGTGTTTCACTCTTGTTGCCCGG - Intronic
989960482 5:50408418-50408440 TGTGTTTCGCTCTTGATGCCAGG - Intronic
990176481 5:53114077-53114099 TGTGTTCCACCCCTCGTGGGAGG + Intergenic
991075433 5:62531359-62531381 GGAGTTTCACTCTTGTTGCGTGG + Intronic
991738218 5:69645743-69645765 TGTTTCCCACCCTTGGTGGGAGG - Intergenic
991759976 5:69910679-69910701 TGTTTCCCACCCTTGGTGGGAGG + Intergenic
991787356 5:70207419-70207441 TGTTTCCCACCCTTGGTGGGAGG - Intergenic
991789794 5:70225469-70225491 TGTTTCCCACCCTTGGTGGGAGG - Intergenic
991814543 5:70500578-70500600 TGTTTCCCACCCTTGGTGGGAGG - Intergenic
991817678 5:70521862-70521884 TGTTTCCCACCCTTGGTGGGAGG - Intergenic
991839206 5:70785742-70785764 TGTTTCCCACCCTTGGTGGGAGG + Intergenic
991879802 5:71207804-71207826 TGTTTCCCACCCTTGGTGGGAGG - Intergenic
991882242 5:71225828-71225850 TGTTTCCCACCCTTGGTGGGAGG - Intergenic
994421779 5:99532933-99532955 TGTTTCCCACCCTTGGTGGGAGG + Intergenic
994461064 5:100067628-100067650 TGTTTCCCACCCTTGGTGGGAGG - Intergenic
994485212 5:100381072-100381094 TGTTTCCCACCCTTGGTGGGAGG - Intergenic
994523457 5:100872836-100872858 AGTGTACCAATCTTGGTGCTAGG + Intronic
995741840 5:115364000-115364022 TGTGTTCCACCCTTCGTGGGAGG + Intergenic
1001732248 5:173969133-173969155 TCTGTTCCACCCTAGCTGCGGGG - Intergenic
1002292540 5:178209673-178209695 TGTGTTACACTCTGGGGGAGGGG + Intronic
1003094177 6:3129829-3129851 TGAGTTTCACTCTTGTTGCCTGG + Intronic
1004352793 6:14904804-14904826 GGAGTTTCACTCTTGTTGCGAGG - Intergenic
1005548023 6:26888871-26888893 TGTTTCCCACCCTTGGTGGGAGG - Intergenic
1006858782 6:37155365-37155387 TGTGTTCAAGTCTTGATGCTAGG + Intergenic
1007165948 6:39829219-39829241 TGTGTTCCACACAGGGTGTGTGG + Intronic
1009018782 6:57929965-57929987 TGTTTCCCACCCTTGGTGGGAGG - Intergenic
1010734517 6:79428765-79428787 TTTATTCCACTCTTGGAGCCTGG + Intergenic
1012447095 6:99317916-99317938 TGTGTATCACCCTTGGTGCCAGG - Intronic
1012843230 6:104356391-104356413 TGCGTTCCACCCTTTGTGGGAGG - Intergenic
1015410228 6:132885923-132885945 CGTGTTCCACTCCTTGTGCCTGG - Intergenic
1019313198 7:372769-372791 TGTGCTCCACCCTTGGAGAGTGG + Intergenic
1021246185 7:18264196-18264218 TGTATTCCACTGTTGTTGGGTGG - Intronic
1028706290 7:93851279-93851301 TGTATTCCACTCCTGGTGAAAGG + Intronic
1033527076 7:142226735-142226757 TTTGTTCCACTCCTGCTGTGAGG + Intergenic
1036429115 8:8673431-8673453 GGTGTTTCACTCTTGTTGCCCGG - Intergenic
1043423299 8:80122680-80122702 TGTATTACACTCTTGGAGAGAGG - Intronic
1046795671 8:118369096-118369118 TGTGCTCCACACTTTGTGTGAGG - Intronic
1048673724 8:136752721-136752743 TGTGTTGCACTGTTCTTGCGTGG + Intergenic
1052029789 9:23615532-23615554 TGTGATTCAGTCTTGGTGAGAGG + Intergenic
1052652453 9:31321656-31321678 CCTGCTCCACTCTTGGTGTGAGG - Intergenic
1053055906 9:34992932-34992954 TGTGGCCCACTCTTGGGGCTAGG - Intronic
1053275292 9:36778897-36778919 TGTGCTCCTCTCTTGCTGCTTGG + Intergenic
1053358616 9:37466947-37466969 TGTGTTCCATTCTTAAAGCGGGG - Intergenic
1054775484 9:69120979-69121001 TGTGGGCCACTGTGGGTGCGTGG - Intergenic
1055658553 9:78477126-78477148 TGGGTTGCCCTCTTGGAGCGTGG + Intergenic
1059169881 9:112114977-112114999 TGTTTCCCACTCCTGGTGCCTGG + Intronic
1059512660 9:114864153-114864175 TGAGTTTCACTCTTGTTGCCAGG + Intergenic
1059653675 9:116337824-116337846 TGTGTTCCACTCTAGCTTCAGGG + Intronic
1187127401 X:16466984-16467006 TGTGTATCACTCTTGGTTGGAGG - Intergenic
1194268158 X:91779732-91779754 TGAGGTCCACACTTAGTGCGCGG + Intronic
1195070864 X:101277947-101277969 TGTGTGCCAGTCTTGATGTGTGG - Intronic
1197765944 X:130059796-130059818 TCTGTTCAAGTCTTGGTGGGAGG + Intergenic
1200325253 X:155231163-155231185 TGTATTCCACCCTTGGTGACAGG - Intronic
1200585359 Y:5000653-5000675 TGAGGTCCACACTTAGTGCGCGG + Intronic