ID: 1147250391

View in Genome Browser
Species Human (GRCh38)
Location 17:39149750-39149772
Sequence CTGGGGAAGGGGGAATTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1146
Summary {0: 1, 1: 0, 2: 4, 3: 95, 4: 1046}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147250391_1147250405 10 Left 1147250391 17:39149750-39149772 CCTCCCAATTCCCCCTTCCCCAG 0: 1
1: 0
2: 4
3: 95
4: 1046
Right 1147250405 17:39149783-39149805 GGTTCACACAATCCAGCCAAAGG 0: 1
1: 0
2: 0
3: 4
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147250391 Original CRISPR CTGGGGAAGGGGGAATTGGG AGG (reversed) Intronic
900013532 1:134735-134757 CTGGGGAAGGGGGCAAAGGCAGG - Intergenic
900043601 1:490718-490740 CTGGGGAAGGGGGCAAAGGCAGG - Intergenic
900065039 1:725721-725743 CTGGGGAAGGGGGCAAAGGCAGG - Intergenic
900105033 1:977774-977796 CCGGGGTTGGGGGGATTGGGAGG - Intronic
900105060 1:977832-977854 CCGGGGTTGGGGGGATTGGGAGG - Intronic
900105127 1:977981-978003 CTGGGGTTGGGGGGATTGGGAGG - Intronic
900318095 1:2069362-2069384 CTGGGCAAGGGGGCATGGAGTGG + Intronic
900366893 1:2315154-2315176 GGGGGGAAGGGGGAACGGGGGGG - Intergenic
900486092 1:2923540-2923562 CTGGGGAAGGGGGAAGGGAGTGG - Intergenic
900520030 1:3100970-3100992 CTGGAGGAGGGGGCATTGGAGGG + Intronic
900581833 1:3413276-3413298 CAGCGGCAGGGGGAATGGGGAGG + Intronic
900663040 1:3795661-3795683 CAGGAGAAGGGGGAGTTGGAAGG + Intronic
900685939 1:3947714-3947736 CTGGGGCAGGGGGAAGAAGGGGG - Intergenic
900822490 1:4900040-4900062 CTGGGGAATGGGGAAGGGGCTGG + Intergenic
900915467 1:5635279-5635301 CTGGAGAAGGAGGAAAAGGGGGG - Intergenic
901455560 1:9361003-9361025 CCCGGGACGGGGGACTTGGGTGG - Intronic
901648465 1:10729083-10729105 CTGGGGGAAGGGGAGTGGGGAGG + Intronic
901666778 1:10830634-10830656 CTGGGGCAGGGGGCGCTGGGGGG + Intergenic
902654784 1:17859723-17859745 CTGGGGAGTGGGGATTTGGAGGG - Intergenic
902696520 1:18144200-18144222 CTGGGGAAGGAGAAGATGGGAGG - Intronic
903033802 1:20481604-20481626 CTGGGGGAGGAGGGTTTGGGAGG - Intergenic
903224493 1:21887098-21887120 CTGGGGAGGGGGGAAAGCGGAGG + Intronic
903501203 1:23800921-23800943 CCGCGGAAGGCGGAAGTGGGCGG + Intergenic
903534872 1:24060283-24060305 ATTGGGAAGGGGCAATTGAGGGG - Intronic
903621778 1:24703377-24703399 ATGGGGAAGGGGGAATTTACTGG + Intergenic
904010683 1:27388488-27388510 TTGGGGAGGGAGGAATTGGCGGG - Intergenic
904357896 1:29953166-29953188 CTGGGGAATGGGCCACTGGGTGG - Intergenic
904486206 1:30825963-30825985 CTGGGGTAAGGGTAATGGGGAGG - Intergenic
904515499 1:31051734-31051756 CTGGGGGAAGGGAAATTTGGAGG - Intronic
904753997 1:32758165-32758187 CTGGGAAGGGGAGAGTTGGGTGG - Intronic
905191221 1:36236537-36236559 CTTTGGGAGGGGGAAGTGGGAGG - Intronic
905343567 1:37295797-37295819 CTGGGGAAGTAGTAAGTGGGAGG + Intergenic
905370474 1:37480123-37480145 CTGGGGAAAGGGGAAGGGGCTGG + Intronic
905603465 1:39274051-39274073 TAGGGGAAGGGTGAAGTGGGTGG + Intronic
905818222 1:40968530-40968552 TTGGGGAAGTGGTAATTGGAAGG + Intergenic
905882617 1:41474646-41474668 CTGGGGGACGGGGACTCGGGGGG - Intergenic
906445946 1:45898216-45898238 CTGAGGAAGAGGGGATGGGGAGG - Intronic
906527090 1:46500229-46500251 ATGGGGATGGGGCAATTGTGGGG + Intergenic
906950857 1:50333553-50333575 CTGGGGACGAGGGAATGGGGTGG + Intergenic
907045109 1:51295964-51295986 CTGGGGAGGGAGGAGTAGGGTGG - Intronic
907193212 1:52665739-52665761 CTGGGGTACAGGGAAGTGGGGGG - Intronic
907538205 1:55185064-55185086 CTGGGGAGCTGGGAAGTGGGAGG - Intronic
907863164 1:58373314-58373336 GTGGGGAGGGGGGAGTGGGGAGG - Intronic
908173137 1:61527679-61527701 CTGAGGAAGGGGGAAAGGGAAGG + Intergenic
909281917 1:73767737-73767759 GTGGGGAGGGGGGAAGGGGGAGG - Intergenic
909981458 1:82106720-82106742 CTGGGGCAGGGGGAATTTCAAGG - Intergenic
910155033 1:84207224-84207246 CAGGGGGAGGGAGAATGGGGTGG + Intronic
910245324 1:85132662-85132684 CTGGGAAAGGAGGGAGTGGGGGG - Intronic
910280433 1:85494679-85494701 CTAGGGAATGGTGAATGGGGAGG + Intronic
910408476 1:86914864-86914886 CTGGGGGAGGGGGACTGGAGAGG + Exonic
910815580 1:91288420-91288442 CTCGGGGAGGGGGATTTGGCAGG + Intronic
910887075 1:91975130-91975152 GTGGGGTAGGGGGAGTGGGGAGG + Intronic
910936334 1:92486327-92486349 CAGGGGATGGGGGAAATTGGAGG + Intronic
911102861 1:94107688-94107710 GAGGGGAAGGAGGAAATGGGAGG - Intronic
912501452 1:110125218-110125240 TTGGAGAAGGGGGCAGTGGGAGG + Intergenic
912563270 1:110565568-110565590 CTGGGGAAGGGGATGTGGGGTGG + Intergenic
912752430 1:112296541-112296563 CTGGGGTGGGGGGAGTGGGGAGG + Intergenic
912869312 1:113289414-113289436 CTGGGAGAGGGGGAATAGGAAGG + Intergenic
913318202 1:117570467-117570489 CTGGGGTGGAAGGAATTGGGAGG + Intergenic
913721071 1:121595984-121596006 CTGGGGGAAGGGTAAATGGGAGG - Intergenic
914218712 1:145658018-145658040 CTGAGGGAGTGGGAATTGGAGGG - Intronic
914255551 1:145959385-145959407 ATGGGGAATGAGGAATGGGGAGG - Intergenic
914256167 1:145962325-145962347 CGGGTGGAGGGAGAATTGGGGGG + Intronic
914471294 1:147980882-147980904 CTGAGGGAGTGGGAATTGGAGGG - Intronic
914681838 1:149944194-149944216 CTGGGGAAGGTGGCATATGGTGG + Exonic
914827264 1:151145352-151145374 CTGAGGAAGGTGGACTGGGGCGG - Intronic
914900595 1:151709192-151709214 GTGGGGAAGGGGGAAGTGGGTGG + Intronic
915018602 1:152759662-152759684 CTGGGCAAAGGGGGATTGAGAGG - Exonic
915189134 1:154133904-154133926 CTGTGGAAGGCCGAAGTGGGTGG + Intronic
915239473 1:154509895-154509917 CTGGGGAGGGGGGAAGAGAGAGG - Intronic
915270035 1:154747289-154747311 GTGTGGAAGGGGGATTTGAGGGG - Intronic
915331642 1:155116479-155116501 TTTGGGCAGGGGGAATAGGGAGG - Intergenic
915441213 1:155946538-155946560 CTGGGGATGGGGGCAATAGGTGG + Intergenic
915558601 1:156673948-156673970 CTGGGGAAGTGGGAATTCTCAGG + Intronic
916189059 1:162161140-162161162 CTGGGGAAGGAAGAATGAGGAGG - Intronic
916815403 1:168346888-168346910 CAGGGGAAGGGGAAATGAGGAGG + Intergenic
916904987 1:169273603-169273625 GTGGGGTAGGGGGAGTGGGGAGG - Intronic
917278966 1:173361100-173361122 CTTGTGAAGGAGGAAATGGGAGG + Intergenic
917342484 1:173994051-173994073 TTGGGGAAGGGGGTAGAGGGAGG + Intronic
917495991 1:175540691-175540713 CTGGGGAAGGGGAGAGTGGATGG - Intronic
917594595 1:176516354-176516376 CAGGGGATGGGGGAGTGGGGAGG - Intronic
917670665 1:177270534-177270556 ATGGGGGAGGGAGAAGTGGGGGG + Intronic
917993110 1:180403914-180403936 CAGGGGAAGGGAGGAATGGGGGG + Intronic
918199395 1:182253233-182253255 CTGGTGCAGGGGGAAGTGAGGGG - Intergenic
918817514 1:189208594-189208616 ATGGGGTAGGGGGAAGGGGGAGG - Intergenic
919911458 1:202113440-202113462 CTGGGGAAGGGAGATATGAGAGG + Intergenic
920192430 1:204202111-204202133 CTGGGGAAGATGGAATCGGGAGG + Intronic
920306260 1:205020105-205020127 CAGGGGCAGGGGCAATGGGGTGG - Exonic
920347038 1:205313061-205313083 CTGGGGGAGGGGAAATGGGGAGG + Intronic
920613620 1:207467197-207467219 TTGGGGATGTGGGAATGGGGTGG + Intronic
920787137 1:209052027-209052049 CTGGGGAGGGGGGAAAGCGGGGG - Intergenic
920947903 1:210546785-210546807 CTGTGAAAGTGGGAATGGGGAGG + Intronic
921405661 1:214776362-214776384 GTGGGGTAGGGGGAGTGGGGAGG + Intergenic
922099940 1:222471736-222471758 CTGGGGAAGGGGGCAAAGGCAGG - Intergenic
922261972 1:223951228-223951250 CTGGGGAAGGGGGCAAAGGCAGG - Intergenic
922735102 1:227974512-227974534 CTGGGGAAGGGGGCAAAGGCAGG + Intergenic
922791678 1:228314465-228314487 ATGGGGTAGGGGGACTTTGGAGG + Intronic
922952846 1:229573702-229573724 CTGGGGAAAAGGCATTTGGGTGG - Intergenic
923524342 1:234760505-234760527 GTGGGGGAGGGGGAGCTGGGAGG + Intergenic
923720864 1:236465469-236465491 CTGGGCAGTGGGGACTTGGGAGG - Intronic
923880895 1:238103164-238103186 CAGGGGGAAGGGGGATTGGGGGG - Intergenic
924343142 1:243053405-243053427 CTGGGGAAGGGGGCAAAGGCAGG - Intergenic
924927482 1:248696916-248696938 TTAGGGAAGGGTGAATGGGGTGG + Intergenic
1062932280 10:1361188-1361210 CTGGGGGAGGGGGGATGGGGGGG - Intronic
1063074917 10:2705448-2705470 CTGGGGTGAGGGGAAATGGGAGG - Intergenic
1063248400 10:4248083-4248105 CTGAGCAAGGGGGAATTGCCTGG + Intergenic
1063342696 10:5282899-5282921 CTGGGGAGGGAGGAAATGGGTGG + Intergenic
1063401620 10:5751981-5752003 ATGGGGGAGGGGGACTTGGGAGG - Intronic
1063768380 10:9169168-9169190 GTGGGGAAAGGGAAAGTGGGAGG + Intergenic
1063960349 10:11301374-11301396 GGGGGGAGGGGGGAAGTGGGGGG - Intronic
1064132653 10:12723901-12723923 GTGGGGTAGGGGGAGTGGGGAGG - Intronic
1064568969 10:16672708-16672730 CTGGGGATGGGGGAAATGAAGGG + Intronic
1064645496 10:17454844-17454866 CTGGGGACTGGGGAATTGCTGGG + Intergenic
1065117560 10:22497433-22497455 CCAGGGAAGGGGGAATGAGGGGG + Intergenic
1065515043 10:26516442-26516464 CTGAGGAAGGGAGAATTGCTTGG + Intronic
1065695580 10:28376681-28376703 CAGGAGAAGGGGGCAGTGGGTGG + Intergenic
1066248159 10:33604994-33605016 GTGGGGAAGGAGAAATCGGGAGG + Intergenic
1066252765 10:33650320-33650342 CTGGAGCAGGAGGAAGTGGGTGG + Intergenic
1066278066 10:33888065-33888087 CTGGGGAATGGGGAATGGAGAGG + Intergenic
1066388416 10:34959984-34960006 CTTGGGAAAGGGGAAGTGAGGGG + Intergenic
1066733346 10:38452169-38452191 CTGGGGAAGGGGGCAAAGGCAGG + Intergenic
1066813054 10:39367269-39367291 GTGGGGCTGGGGGAATGGGGAGG - Intergenic
1067157018 10:43790716-43790738 CTGGGGAAGGGGGAATGGTCAGG + Intergenic
1067219404 10:44333006-44333028 ATGGGGAGGGGGTAATTGGTGGG + Intergenic
1067472774 10:46548496-46548518 CTGAGGAAGGGGAGAATGGGTGG - Intergenic
1067480933 10:46597391-46597413 GGGGGGAAGGGGGGGTTGGGGGG - Intergenic
1068637100 10:59360107-59360129 AAGGGGAAAGGGAAATTGGGAGG - Intronic
1068934894 10:62625978-62626000 CTAGAGAAGGGGGCATTTGGTGG - Intronic
1068958289 10:62841150-62841172 CTGGAGAAGAAAGAATTGGGAGG - Intronic
1068958778 10:62845408-62845430 GTGAGGAGGGGGGAATGGGGAGG + Intronic
1068981559 10:63068338-63068360 CTGGGGGAGGAGGAAATGGGAGG + Intergenic
1069439808 10:68417993-68418015 CTGGGGAAGAAGAAAATGGGTGG + Intronic
1069711465 10:70491745-70491767 CTGGGGGAGGGGAAACTGGGAGG - Intronic
1070124031 10:73605828-73605850 TTGGGGAAGGAGGAATCGGGGGG + Intronic
1070220836 10:74442400-74442422 CTGTGGAAGGCCGAAGTGGGCGG + Intronic
1070349321 10:75576416-75576438 TGGGGGAAGGGGCAGTTGGGGGG + Intronic
1070828310 10:79403865-79403887 CTGGGGAGGGGGGCATGGAGTGG + Intronic
1070979499 10:80632960-80632982 CTGGGCAAGGAGGAAATAGGTGG + Intronic
1071164162 10:82785203-82785225 GTGGGGTAGGGGGAAGGGGGAGG + Intronic
1071681610 10:87711748-87711770 CAGAGGAAGGAGGATTTGGGTGG - Intronic
1071998952 10:91175525-91175547 CAGGGGTAGGGGGAAGAGGGAGG - Intronic
1072210447 10:93241519-93241541 CAGGAGAAGTTGGAATTGGGTGG - Intergenic
1072223795 10:93349395-93349417 CTGGGGAAGGGGCAGCTGTGGGG - Intronic
1072313221 10:94177309-94177331 CATGAGAAGGGGGAATGGGGAGG - Intronic
1072726301 10:97816200-97816222 GTGGGGGAGGGGGAATGGGCAGG + Intergenic
1072787588 10:98294763-98294785 CAGGGGCAGGGGGAATAGTGAGG - Intergenic
1073145997 10:101282397-101282419 CTGGGCAGAGGGGAATTGGTGGG - Intergenic
1073322163 10:102621996-102622018 CTGGGGCCTGGGGAATTGGGAGG + Intronic
1073412979 10:103357703-103357725 CTGGGGAAGGGATAATGGGAGGG + Intergenic
1073592116 10:104767599-104767621 AAGGGGAAGGGGGAAGGGGGAGG - Intronic
1074745231 10:116525328-116525350 CTGAGGAAGGGAGAATTGCTTGG - Intergenic
1074772184 10:116741808-116741830 CTGGGGAAGGGTGAAGCGGCGGG - Intronic
1074898897 10:117800272-117800294 CTGGGGGGGGGGGAGGTGGGGGG - Intergenic
1074922381 10:118029217-118029239 TTGGGTAGGGGGGTATTGGGGGG - Intronic
1075051289 10:119184096-119184118 ATGGGGAAGGGAGAGGTGGGCGG - Intergenic
1075358175 10:121802689-121802711 CTGGGGATGGGAGCAGTGGGTGG - Intronic
1076069569 10:127476748-127476770 CTGGAGGTGGGGGCATTGGGAGG - Intergenic
1076755699 10:132570468-132570490 CTGGGGAGGGGAGAAAGGGGTGG + Intronic
1076969873 11:126949-126971 CTGGGGAAGGGGGCAAAGGCAGG - Intergenic
1077078018 11:709948-709970 CTGGGGAAGGGCAGAGTGGGGGG - Intronic
1077225405 11:1437199-1437221 CTGGGGATGCGGGAAAGGGGAGG + Intronic
1077454051 11:2667362-2667384 CTGGGGCAGGGTGATTTGGATGG - Intronic
1077600681 11:3572469-3572491 CAGGGCCAGGGGGCATTGGGGGG - Intergenic
1077779263 11:5307649-5307671 AGGGGGAAGGGGGAAGGGGGAGG - Intronic
1077852367 11:6085450-6085472 CTGGGGAAGGGGTGAGTGAGGGG - Intergenic
1078195943 11:9137276-9137298 ATGGGGAAGGGGGAACATGGAGG + Intronic
1078255879 11:9658447-9658469 CTTGGGAAGGCTGAAGTGGGAGG + Intergenic
1078750358 11:14155642-14155664 GTGGGGTAGGGGGAGTGGGGAGG - Intronic
1079099508 11:17532164-17532186 CTGGGGGAGTAGGACTTGGGAGG - Intronic
1079370328 11:19846959-19846981 GTGGGGGAGAGGGAATGGGGTGG - Intronic
1079641902 11:22816171-22816193 ATGGGGGAGGGGGAGGTGGGCGG - Intronic
1079885988 11:25989543-25989565 TTGGGGTGGGGGGAAGTGGGAGG + Intergenic
1080175861 11:29362286-29362308 ATGGGGTTGGGGGAAGTGGGAGG - Intergenic
1080378046 11:31737317-31737339 GTGGGGTAGGGGGAGTGGGGAGG + Intronic
1080763368 11:35273752-35273774 CTGGGCAGGGGAGAATGGGGAGG + Intronic
1081361423 11:42184773-42184795 CAGGGGAAGAGAGAATTGGAGGG + Intergenic
1081444030 11:43112618-43112640 TTGGGGAAGGGGGAACTGGGAGG - Intergenic
1081502580 11:43680935-43680957 CTGGGGAGTGGGGAATGAGGCGG + Exonic
1081622414 11:44626354-44626376 CTGGGGAATGGAGAATGGAGTGG + Intergenic
1081652283 11:44832484-44832506 CTGAGGAAGGTGGAATTTGGGGG - Intronic
1081783079 11:45727065-45727087 TTGGGGATGGGGGAAATGGCTGG - Intergenic
1081814239 11:45929643-45929665 CTGGGGAAGGGGTAGGGGGGTGG + Intronic
1081877373 11:46418542-46418564 GTGGGGTAGGGGGAGTGGGGAGG - Intronic
1081937642 11:46916625-46916647 CTAGGGAAGGGGGAGCTGGAAGG - Intronic
1082056578 11:47822711-47822733 GTGGGGTAGGGGGAGTGGGGAGG - Intronic
1082082953 11:48026305-48026327 CTGGGAAAGGGGCAGTTGGCTGG + Intronic
1082244480 11:49905298-49905320 AGGGGGAAGGGGGAAGGGGGAGG + Intergenic
1082633412 11:55567381-55567403 GGGGGGAAGGGGGAGGTGGGAGG - Intergenic
1083096108 11:60253392-60253414 CTGGGGAAGGAGGCAGGGGGAGG - Intergenic
1083106366 11:60361914-60361936 CTGGGGAAGGAGGGAGGGGGAGG + Intronic
1083684386 11:64368016-64368038 CTGGACAAGGGGGCAGTGGGGGG - Intronic
1083692491 11:64418818-64418840 CTGGGGGAGGGGCAAATGGGGGG + Intergenic
1083761984 11:64823758-64823780 CTGGGGAGGGGTGCAGTGGGCGG - Exonic
1083815946 11:65132506-65132528 CTGGGGGAGGGGGAGTTGTTGGG + Intronic
1083887277 11:65579055-65579077 CTGGGGGAGGGGGAAGGGGAGGG - Intronic
1083964486 11:66035042-66035064 AGGGGGAAGGAGGCATTGGGAGG + Intergenic
1084233693 11:67771868-67771890 CTGGGGAAGGGGGGATGGGGAGG + Intergenic
1084256595 11:67947068-67947090 CAGGGCCAGGGGGCATTGGGGGG - Intergenic
1084273050 11:68039164-68039186 CCGGGGCAGGGGGAAGAGGGTGG - Intronic
1084557859 11:69885628-69885650 GTGGGGAAGGCAGAATGGGGAGG + Intergenic
1084557878 11:69885684-69885706 GTGGGGAAGGCAGAATGGGGAGG + Intergenic
1084589804 11:70084088-70084110 CTGGGGAAGGCAGTATGGGGAGG + Intronic
1084594233 11:70107518-70107540 CTGGGCCAGGGGGAACTGGAAGG + Intronic
1084601726 11:70149828-70149850 CTGGGGTAGGGGGAACGTGGGGG - Intronic
1084780998 11:71408013-71408035 CTGGAGAAGGGAGGATTAGGGGG + Intergenic
1085413412 11:76305340-76305362 CTGGAGAAGGCAGAGTTGGGAGG + Intergenic
1085461647 11:76697542-76697564 CTGGGGTGGGGGAAATTGGGTGG - Intergenic
1085554772 11:77410417-77410439 CTGGGGAAGATAGAATTTGGAGG + Intronic
1085609520 11:77933945-77933967 GTGGAGAAGGGGGAAATGTGGGG + Intronic
1086253096 11:84840839-84840861 CTGGGGTAGGGGGCAGGGGGAGG + Intronic
1086278698 11:85161084-85161106 CTGGGGAAGGGGTATGTGGATGG + Intronic
1086342305 11:85858552-85858574 GTGTGGCAGGGGGAATTGAGAGG + Intronic
1086683706 11:89705962-89705984 CTGGGGTAGGGGGAGTGGGGAGG + Intergenic
1087046912 11:93850363-93850385 CTGGGGGAGCGGGAATGGGTAGG - Intronic
1087158679 11:94928328-94928350 CTGGTGGAGGGTGATTTGGGTGG + Intergenic
1087783679 11:102329785-102329807 GTGGGGTAGGGGGATGTGGGAGG + Intronic
1088155750 11:106800737-106800759 GTGGGGTAGGGGGAAGGGGGAGG + Intronic
1088242343 11:107785340-107785362 CTGGGGAAGGGGGGCTGGCGAGG + Intergenic
1088904306 11:114142755-114142777 CTTGGGGAGGGGGAGCTGGGGGG + Intronic
1088913856 11:114212132-114212154 TTGGGAAAGGGGGGATGGGGAGG + Intronic
1089055306 11:115580225-115580247 GTGGGGGTGGGGGAAGTGGGGGG + Intergenic
1089195751 11:116693174-116693196 CTGGGGAAGTGGGAATGTGCTGG + Intergenic
1089245092 11:117113319-117113341 ATGGGGTAGGGGGAGTGGGGAGG + Intergenic
1089270186 11:117296663-117296685 ATGGGAAAGGGTGAATTGAGAGG - Intronic
1089312279 11:117566720-117566742 GTGGGGTAGGGGGAGTGGGGAGG - Intronic
1089520573 11:119059931-119059953 CTGGGGAAAGGGGGAGGGGGAGG + Intergenic
1089692982 11:120198125-120198147 GGGTGGGAGGGGGAATTGGGAGG + Intergenic
1090461840 11:126897937-126897959 CTTGGGAAGGGGGAGTGGGTGGG + Intronic
1090709480 11:129372950-129372972 GCGGGGAAGGGAGAAGTGGGAGG + Intergenic
1091015843 11:132050149-132050171 CTGGGGAAGGGAGAAGGGTGAGG + Intronic
1091272001 11:134321768-134321790 ATGGGGTGGGGGGAGTTGGGAGG + Intergenic
1091303530 11:134523138-134523160 CTGGGGAGGTGGGAAGGGGGAGG - Intergenic
1091441910 12:517589-517611 TTGGGGAAGGTGGAATTGCTGGG - Intronic
1091845767 12:3655314-3655336 CTGTGGATGGGGAAATGGGGAGG + Intronic
1092065935 12:5589688-5589710 GTGGGGCAGGGGGAAGGGGGAGG + Intronic
1092154311 12:6272574-6272596 CTGGGGAATATGGAGTTGGGTGG - Intergenic
1092154541 12:6273841-6273863 CTGGGGCATGGGGAGTGGGGTGG + Intergenic
1092173738 12:6389275-6389297 CTGAGGCAGGGGGCATGGGGAGG + Intronic
1092382915 12:8012530-8012552 CTGCAGTAGGGGGAGTTGGGTGG + Intergenic
1092426810 12:8381768-8381790 CAGGGCCAGGGGGCATTGGGGGG - Intergenic
1093009427 12:14090152-14090174 ATGGGGTAGGGGGAGTGGGGAGG - Intergenic
1093031776 12:14295303-14295325 CTGGGGAAGAGGTATGTGGGTGG - Intergenic
1093080240 12:14802686-14802708 CTGGGGATGGGGGGGTTAGGGGG + Intronic
1093085913 12:14866995-14867017 CAGGGGAAGCTGGAACTGGGTGG - Intronic
1093184271 12:16002126-16002148 GTGGGGAAGGGGGAGGGGGGAGG - Intronic
1093267511 12:17021050-17021072 CTGGGGATGGGGGAATAGAAAGG + Intergenic
1093272132 12:17076574-17076596 CTGGGGGTGGGGGAAATGTGTGG + Intergenic
1094063628 12:26340836-26340858 TTGAGGAAGAGGGAAGTGGGAGG + Intronic
1094118014 12:26938352-26938374 CTGGGAAGGGAGGAATAGGGAGG + Intergenic
1094221772 12:28001704-28001726 CTGGGGCATGAGGGATTGGGTGG - Intergenic
1094375702 12:29784826-29784848 GTGGGGATGGGGGGATGGGGAGG + Intergenic
1094411483 12:30171856-30171878 CTAGGGACAGTGGAATTGGGTGG + Intergenic
1094476491 12:30844617-30844639 GTGGGGGAGGTGGCATTGGGGGG - Intergenic
1094530940 12:31274170-31274192 GTGGGGTGGGGGGAATGGGGAGG + Intergenic
1094699664 12:32856602-32856624 ATGGGGAAGGGGGAAAGGGGAGG + Intronic
1096230688 12:49895315-49895337 GGGGGGATGGGGGGATTGGGAGG - Intronic
1096466426 12:51849325-51849347 CTGGGAAAGGGGGTCTGGGGCGG - Intergenic
1096503811 12:52080818-52080840 CTGGGGAATGGGGAGGTGTGTGG + Intergenic
1096789480 12:54035910-54035932 CTGGGGAAGAGGGAGCAGGGAGG + Intronic
1096863193 12:54545096-54545118 ATGGGGAAGGGGGTTGTGGGAGG - Exonic
1096967434 12:55639364-55639386 GTGGGGAAGGGGACATAGGGAGG + Intergenic
1097161945 12:57052768-57052790 CTTTGGAAGGCTGAATTGGGAGG + Intergenic
1098031381 12:66258218-66258240 CTGGTGTAGGGGGTATTAGGTGG - Intergenic
1098477396 12:70920864-70920886 GTGGGGAAGGGGGAAGTGCGGGG + Intergenic
1098534536 12:71579776-71579798 CTGGGAAGGGTGGACTTGGGGGG - Intronic
1098876767 12:75873652-75873674 CTGTGGCAAGGGGAGTTGGGTGG + Intergenic
1099888029 12:88555990-88556012 TTGGGGAGGGGGGCATTTGGGGG + Intronic
1100432949 12:94546780-94546802 CTGGGGAAGGGTGAAGTGTGAGG + Intergenic
1100636712 12:96441535-96441557 GTGGGGTAGGGGGAGTGGGGAGG + Intergenic
1101010428 12:100443900-100443922 GTGGAGAAAGAGGAATTGGGTGG - Intergenic
1101334755 12:103786479-103786501 CTGGGGAAGGGGAAATCCAGTGG + Intronic
1101909221 12:108850003-108850025 CTGGGGGAGGGGAGATGGGGAGG + Intronic
1101909258 12:108850099-108850121 CTGGGGGAGGGGAGATGGGGAGG + Intronic
1101909275 12:108850139-108850161 CTGGGGGAGGGGAGATGGGGAGG + Intronic
1101909324 12:108850259-108850281 CTGGGGGAGGGGAGATGGGGAGG + Intronic
1101993719 12:109509414-109509436 CAGGGGTAGGGGGAAAGGGGAGG - Intronic
1102655585 12:114480101-114480123 CTGGGGAAGAGGGAAGTAGTGGG + Intergenic
1102866206 12:116377051-116377073 ATGGGAAAGGGGGAATAGGTAGG - Intergenic
1102866897 12:116381880-116381902 CTGGGGAGAGGGGAGTTGGAGGG - Intergenic
1102976252 12:117209050-117209072 CCGGGGGAGGGGGCATGGGGAGG - Exonic
1103561332 12:121794601-121794623 CAGGGGATGGGAGAGTTGGGGGG - Intronic
1104070366 12:125339533-125339555 CTGAGGATGGGGGCATTGGAAGG - Intronic
1104472133 12:129037698-129037720 GTGGGGTAGGGGGAGTGGGGAGG - Intergenic
1104505992 12:129332854-129332876 CTGGGGAGGAGGGAAGAGGGAGG + Intronic
1104895392 12:132161325-132161347 CTGAGGAAGGAGGAACTGAGTGG - Intergenic
1105534575 13:21253087-21253109 CTGGGGGTGGGGGAATGGGGAGG + Intergenic
1106963370 13:35028771-35028793 ATGAGGAAGGGGGAAATGTGGGG - Intronic
1107388256 13:39936377-39936399 GTGGGGTAGGGGGAGTGGGGAGG + Intergenic
1108170884 13:47740733-47740755 ATGGGGTGGGGGGAGTTGGGAGG + Intergenic
1109964814 13:69678731-69678753 GTGGGGTGGGGGGAATGGGGAGG - Intergenic
1110775721 13:79406030-79406052 CTGGGGAAGAGGGAAGGGGGAGG - Exonic
1110788358 13:79560185-79560207 AGGGGGAAGGGGGAAGTGGAGGG - Intergenic
1111075213 13:83226614-83226636 CAGGAGAAGGCTGAATTGGGTGG - Intergenic
1111605184 13:90529187-90529209 GTGGGGTAGGGGGAAGGGGGAGG - Intergenic
1111696119 13:91626811-91626833 GTGGGGTTGGGGGAATGGGGAGG - Intronic
1112095243 13:96125922-96125944 GTGGGGTAGGGGGAGTGGGGAGG - Intronic
1112559231 13:100497128-100497150 CAGAGAAATGGGGAATTGGGGGG + Intronic
1112584328 13:100703961-100703983 GTGGGGAGGGGGGAGTGGGGAGG + Intergenic
1112986656 13:105458273-105458295 GTGAGGAAGGGGGAGCTGGGGGG - Intergenic
1113288445 13:108879504-108879526 CTGGGGTTGGGGGAGTGGGGAGG - Intronic
1113483938 13:110641154-110641176 CTGGGGATGGGTGAGGTGGGTGG - Intergenic
1113677235 13:112215260-112215282 CTGGAGAGGAGGGAAGTGGGGGG + Intergenic
1114219671 14:20684883-20684905 CTGGAGAGGGAGGAATGGGGAGG + Intronic
1114265188 14:21069622-21069644 CTGGGGAAGGCGGGAGTGTGCGG - Intronic
1114458168 14:22870599-22870621 GTGGGGTTGGGGGAATTGAGTGG - Intergenic
1114463686 14:22905013-22905035 CTGGGGAAGGAGGAAATGATGGG + Intronic
1114483008 14:23047123-23047145 CTGGGGAAGGGGAAAGAGGGAGG - Exonic
1114880279 14:26776407-26776429 TAGGGGAAGGGGGACTTGGCAGG + Intergenic
1114882672 14:26806153-26806175 GTGGTGGTGGGGGAATTGGGGGG + Intergenic
1115310061 14:31969893-31969915 CTGGGGGCGGGGGAAGAGGGAGG - Intergenic
1115324758 14:32127215-32127237 CTGGGAGAGGGGGATTTGGCAGG + Intronic
1115815856 14:37163671-37163693 CCAGGGAAGGGTGAGTTGGGAGG + Intronic
1116078530 14:40143836-40143858 GTGGGGCAGGGGGAAGGGGGAGG + Intergenic
1116242802 14:42367539-42367561 GTGGGGTAGGGGGAGTGGGGAGG + Intergenic
1116314559 14:43370748-43370770 CCGGGGAAGCTGGAACTGGGTGG + Intergenic
1116604325 14:46969783-46969805 GTGGGGTAGGGGGAAGGGGGAGG + Intronic
1116828012 14:49690900-49690922 ATGGGAAAAGGGGAATTGTGAGG - Intergenic
1116885228 14:50214203-50214225 TTGGGGAATGGGGAAGTGGAAGG + Intronic
1119326827 14:73764823-73764845 CTGGGGAGGGGGCAGGTGGGAGG - Intronic
1119628094 14:76200162-76200184 TAGGGGAAGAGGGAAATGGGGGG + Intronic
1119714356 14:76848128-76848150 CTGGGGTGGGGGGAGTGGGGAGG + Intronic
1120627105 14:86841600-86841622 GTGGGGTGGGGGGAATGGGGAGG + Intergenic
1120743274 14:88131137-88131159 ATGGGGTAGGGGGAGTGGGGAGG - Intergenic
1120820790 14:88910244-88910266 CTGTGGAAGGGGAAAGTGGCTGG - Intergenic
1121006689 14:90495372-90495394 CGGGGGAAGGGGGGATTGTGTGG - Intergenic
1121092563 14:91192976-91192998 GTGGGCAAGGAGAAATTGGGAGG + Intronic
1121273290 14:92651883-92651905 CTGGGGGAGGGGGTGGTGGGCGG - Exonic
1121308619 14:92923067-92923089 GTGGGGAAAGGGGAAGGGGGCGG + Exonic
1122081223 14:99269158-99269180 TTTGAGGAGGGGGAATTGGGGGG - Intronic
1122208744 14:100161239-100161261 CTGGGGCAGAGGGAACTGGCAGG - Intergenic
1122987000 14:105217109-105217131 CTGAGGAAGGAGGATGTGGGTGG - Intronic
1123968263 15:25480387-25480409 ATGGGGAATGGGGGATAGGGTGG + Intergenic
1125370390 15:38969814-38969836 CTAGGGAAGGTGGAATTTGAAGG - Intergenic
1125477757 15:40058891-40058913 CTGGGGCTGGGGAGATTGGGAGG + Intergenic
1125616473 15:41018502-41018524 GTGGGGAAGGGAGAAGTGGATGG + Intronic
1125616809 15:41021691-41021713 CTGGGGAAGGGGGAGTGCGGAGG + Intronic
1125697501 15:41651667-41651689 AGGGGAAAGGGGGAATGGGGAGG - Intronic
1125768117 15:42148517-42148539 CTGGGGAAAGGGGAGGTGGAGGG - Intronic
1126210607 15:46097478-46097500 TTGGAGAAGGGGGATTTGGCAGG + Intergenic
1126612114 15:50540206-50540228 CTGGGGATGTGGGCATGGGGTGG - Intronic
1126778434 15:52119026-52119048 CTGGGGGAAGGGGAATGGGGAGG + Exonic
1126778448 15:52119070-52119092 CTGGGGGAAGGGGAATGGGAAGG + Exonic
1126958742 15:53965708-53965730 GTGGGGTAGGGGGAGTGGGGAGG - Intergenic
1127023794 15:54781255-54781277 ATGGAAAAGGGGGAATTGTGGGG - Intergenic
1127256632 15:57298853-57298875 GTGGGGCCGGGGGAATGGGGAGG + Intronic
1127790954 15:62398329-62398351 CTGGGGCAGGGGGCAGTTGGGGG - Intronic
1127978394 15:64015998-64016020 CAGGGAAAGGGGGCATAGGGAGG + Intronic
1128145884 15:65332296-65332318 CTGGGGAGGAGGGAAGAGGGAGG - Intronic
1128770555 15:70278552-70278574 ATGGGGATGGGGGAGTGGGGAGG + Intergenic
1129326038 15:74800725-74800747 ATCGGGAAGGGGGAGTTCGGAGG + Exonic
1129357945 15:75004931-75004953 CTTTGGAAGGCGGAGTTGGGCGG + Intronic
1129940801 15:79495252-79495274 CTGGGGAAGTGGGAAGCAGGGGG + Intergenic
1129942215 15:79508215-79508237 CTGAGGAGTGGGGAATTGTGCGG - Intergenic
1130026720 15:80276801-80276823 CTCAGGAAGGGGGGATTTGGGGG + Intergenic
1130221799 15:82025684-82025706 CTGGGGAAGGGGGAATGCCCAGG + Intergenic
1130661368 15:85833756-85833778 ATGGGGAAGGGGCAGGTGGGCGG + Intergenic
1130684370 15:86023969-86023991 CTGGGGAAGGGAGAAATTGAGGG + Intergenic
1130703656 15:86211490-86211512 CTGGGGAAGCTTGAACTGGGTGG - Intronic
1131342221 15:91613109-91613131 GTGGGGTAGGGGGAAGGGGGAGG - Intergenic
1131947891 15:97647970-97647992 CTGAGGGAGGGGGGATGGGGAGG + Intergenic
1131971290 15:97895638-97895660 GAGGGGAGGGGGGAATTGAGAGG + Intergenic
1132139165 15:99376686-99376708 GTGGGGTGGGGGGAAGTGGGAGG - Intronic
1132578833 16:676012-676034 CTGGAGAAGGGAGAGTCGGGGGG + Intronic
1132580837 16:683986-684008 CAGGGGAAGGCGGCCTTGGGCGG + Intronic
1133039434 16:3052541-3052563 CTGGGGAAGGGGGCAGTGGACGG + Intronic
1133043277 16:3072174-3072196 CTGGGGAAGGGGGCAGTGGACGG + Intronic
1133171973 16:3987262-3987284 CTGGGGAAGGGGGAAAGACGTGG - Intronic
1133489114 16:6249917-6249939 GTGGGGTAGGGGGAGTGGGGAGG - Intronic
1133668686 16:7996129-7996151 CTGGGGGAGGAGGTATTGGAGGG + Intergenic
1133687756 16:8182458-8182480 CTTTGGAAGGCCGAATTGGGTGG - Intergenic
1133874841 16:9724073-9724095 GTGGGGTAGGGGGAGTGGGGAGG - Intergenic
1133966471 16:10535699-10535721 TTGGGGTGGGGGGACTTGGGTGG - Intronic
1134006401 16:10821281-10821303 CCTGGGAAGGGGATATTGGGAGG + Intergenic
1134250864 16:12572775-12572797 CTGGGGAAGGAGGAGTGAGGTGG - Exonic
1134327407 16:13219647-13219669 CTGGGGCATGGGGAAGTGGAGGG + Intronic
1135121879 16:19773235-19773257 CTGGGGAAAGGGGAGATGGCAGG + Intronic
1135495891 16:22950822-22950844 TTGGGGAAGGGGGAACAAGGTGG + Intergenic
1135691155 16:24539238-24539260 GTGGGGAAGGGGGAGTTAGCCGG + Intronic
1135729431 16:24882041-24882063 CTGGGGCAGGGGAAAAGGGGAGG + Intronic
1135959643 16:26985013-26985035 TAGGGGAAGGGGGAAGAGGGAGG - Intergenic
1136080680 16:27850688-27850710 CTGGGGAAGTGGGAAAATGGGGG + Intronic
1136222438 16:28836866-28836888 CTGGGGAACGGGGGGATGGGGGG - Exonic
1136375851 16:29864559-29864581 CTGGGGGAGGGGGGTTTGGTGGG - Intergenic
1136463998 16:30429679-30429701 CTGAGGCAAGGGAAATTGGGTGG - Intronic
1137255153 16:46769045-46769067 CTGGGGATGGGGGAAGGTGGGGG - Intronic
1137460913 16:48662490-48662512 ATGGGGTAGGGGGAAGGGGGAGG - Intergenic
1137588028 16:49676003-49676025 CTGGAGAAGGGGGCACTGTGGGG - Intronic
1137917863 16:52452528-52452550 GTGGGGTGGGGGGAATGGGGAGG + Intronic
1138190088 16:55007635-55007657 CTGGCGAAGGGGGTATTGATGGG + Intergenic
1138398997 16:56730460-56730482 GTGGGGAAGGGGGAGTCGGGAGG - Intronic
1138415778 16:56870569-56870591 CTGGGGGATGGGGAATTCAGAGG + Intronic
1138891914 16:61154039-61154061 ATGGGGTAGGGGGAAGGGGGAGG - Intergenic
1139363613 16:66419271-66419293 AAGGGGAAGGAGGAATGGGGAGG + Intergenic
1139521787 16:67486931-67486953 CTGGGGCAGGGGCAATGGGCTGG - Intergenic
1139582888 16:67883765-67883787 CTGGGGAGTGGGGCAGTGGGAGG + Intronic
1140479941 16:75257010-75257032 CTGGGGGAGGGGGAAGAGAGGGG + Intronic
1140980659 16:80105708-80105730 ATGAGGGAGGGGGAAATGGGTGG + Intergenic
1141402701 16:83764524-83764546 CTGGGGAAGGGGGACTCCAGTGG - Intronic
1141437375 16:84007877-84007899 CTGAGGGAGGGAGAAATGGGGGG + Intergenic
1141890301 16:86922072-86922094 CTGGGGAAGGAGGAAGGGGAAGG + Intergenic
1142161903 16:88562044-88562066 GGGGGGAAGGGGGGATGGGGGGG - Intergenic
1142312585 16:89322682-89322704 GTGGGGAAGGGGGAGTGAGGAGG + Intronic
1142450806 16:90172183-90172205 CTGGGGAAGGGGGCAAAGGCAGG + Intergenic
1142456759 17:61508-61530 CTGGGGAAGGGGGCAAAGGCAGG - Intergenic
1142587659 17:983878-983900 CCGGTGAAGAGGGAATTTGGGGG + Intergenic
1142645004 17:1305928-1305950 CTTGGGAAGGGGAGATTGGTGGG + Intergenic
1142750181 17:1982808-1982830 CAGAGGAAGGAGGAATGGGGTGG + Intronic
1143204112 17:5131151-5131173 ATGGGGAAGGGGGAAAGGTGTGG + Intronic
1143328769 17:6119128-6119150 TTAGGGATGGGGGATTTGGGAGG - Intronic
1143463346 17:7118309-7118331 CTTGGGAAGCTGGAGTTGGGAGG + Intergenic
1143572291 17:7767080-7767102 CGGGGGACGGGGGACTGGGGCGG - Intronic
1143775592 17:9196669-9196691 CTCTGGAGGGGGGAATGGGGAGG - Intronic
1144356200 17:14448774-14448796 ATGGGGAGTGGGGAACTGGGTGG + Intergenic
1144834570 17:18150210-18150232 CTGGGGAAGAGGGGATGGGTTGG + Intronic
1144844239 17:18207840-18207862 GTGGAGAAGGGGGTGTTGGGAGG + Intronic
1144844649 17:18210284-18210306 CTGGTGAAGGGGGAGATGGCAGG + Intergenic
1144875293 17:18394260-18394282 ATGGGGAAGGGGGAAAGGTGTGG + Intergenic
1145156931 17:20550161-20550183 ATGGGGAAGGGGGAAAGGTGTGG - Intergenic
1145988877 17:29066085-29066107 CTGGGGAGGGGAGAGTTGGAGGG + Intergenic
1146124902 17:30223849-30223871 CGAAGGAAGGGGGAAGTGGGGGG - Intronic
1146128383 17:30248284-30248306 CTGTGGAACTGGGGATTGGGTGG - Exonic
1146283503 17:31559736-31559758 CTGGGGGAGGGGGAGGTGCGGGG - Intergenic
1146547119 17:33749235-33749257 CTGGGGTAGGGGGAAAGGGAGGG - Intronic
1146846520 17:36184581-36184603 CCGGGGGAGGAGGAATGGGGAGG - Intronic
1147027300 17:37598218-37598240 CAGGGCAAGGGGGAATGGAGTGG + Intronic
1147152308 17:38524733-38524755 CTTTGGAAGGTGGAAGTGGGAGG + Intergenic
1147250391 17:39149750-39149772 CTGGGGAAGGGGGAATTGGGAGG - Intronic
1147382845 17:40065758-40065780 CTGGGAATGGGGGAAGGGGGGGG + Intronic
1147624699 17:41892495-41892517 CTGGGGAAGGGGAAGCTGAGGGG + Intronic
1147680178 17:42238391-42238413 CTGGGGGAGGCTGACTTGGGAGG - Intronic
1147694331 17:42339919-42339941 CTTGGGAAGGCTGAAGTGGGAGG + Intronic
1148191897 17:45685062-45685084 GTGGGGTAGGGGGAGTGGGGAGG - Intergenic
1148423884 17:47573249-47573271 CTGGGGTAGGGGGCAATAGGAGG + Intronic
1148479380 17:47950039-47950061 CTGCAGAAGGGGAAGTTGGGAGG - Intergenic
1148853790 17:50567621-50567643 CTGGGGAATGGGGATGGGGGAGG - Intronic
1148863864 17:50618632-50618654 CTGGGGAGGGTGGAATAGAGGGG - Intronic
1149149409 17:53542364-53542386 CTGGGGTAGGGGGAAATTGTGGG - Intergenic
1149307823 17:55366015-55366037 CTGGGGAAGGGTGAATTCTCTGG + Intergenic
1149733370 17:58969192-58969214 TTGGGGGAGGGGGGATAGGGAGG - Intronic
1149932885 17:60773398-60773420 CTTGGGAAGGCTGAGTTGGGAGG - Intronic
1149950640 17:60981077-60981099 CTTTGGGAGGGGGAAGTGGGAGG - Intronic
1150236712 17:63599157-63599179 CTAGGGCTGTGGGAATTGGGGGG + Intergenic
1150491923 17:65580247-65580269 AGGCGGAAGGGGGAAGTGGGTGG - Intronic
1150503228 17:65671267-65671289 CTCCCGAAGGGGAAATTGGGAGG + Intronic
1150889018 17:69123012-69123034 CTGGGGTAGGGGGAGGGGGGAGG + Intronic
1151165718 17:72202009-72202031 GTGGGGTGGGGGGAGTTGGGAGG - Intergenic
1151212051 17:72551876-72551898 GTGGGGTGGGGGGAGTTGGGAGG - Intergenic
1151343476 17:73486807-73486829 CTGGGGAAGGGGGCAGTGAAGGG + Intronic
1151422364 17:74006766-74006788 CTGGGGCAGGGGGCATTGTAAGG + Intergenic
1151676030 17:75597998-75598020 GTGGGGCAGGGAGAGTTGGGGGG + Intergenic
1151833504 17:76569302-76569324 CTGTAGAAGGAGGACTTGGGGGG + Intronic
1151947795 17:77329025-77329047 CTGGGGAAGGTGGGAGTGGCTGG + Intronic
1152044799 17:77928953-77928975 CTGGGGGAGGGGGGATCGGTGGG - Intergenic
1152358902 17:79821045-79821067 CTGGGGAAGGGTAGATTGGAAGG - Intergenic
1152426942 17:80223157-80223179 CTGGGGAAGGTGGCAATGGGTGG - Intronic
1152621497 17:81367171-81367193 TTGGGGAAAGGGGCATTGTGGGG - Intergenic
1152623439 17:81377641-81377663 GTGGGGCTGGGGGAGTTGGGGGG + Intergenic
1152892800 17:82892024-82892046 CTGTGCAGGGGGGAAGTGGGGGG - Intronic
1153220905 18:2860379-2860401 GTGGGGTTGGGGGAAGTGGGAGG - Intronic
1153571003 18:6473656-6473678 GTGGGGAAAGGGGAATGGAGTGG - Intergenic
1153680571 18:7496944-7496966 CTCGAGGAGGGGGAACTGGGTGG - Intergenic
1153914528 18:9733896-9733918 CTGGGGAGGGGGGGCTTGGTTGG + Intronic
1153984937 18:10343484-10343506 CTGGGGAGGCGGGAATGGGGTGG + Intergenic
1154318684 18:13326696-13326718 CTGGGGAAGAGGGCATTGCCTGG + Intronic
1154529521 18:15330340-15330362 CTGGGGAAGGGCGAGTGGCGGGG - Intergenic
1155417156 18:25611422-25611444 CTGGGGAAGGGGAAATGAGGAGG + Intergenic
1155927777 18:31675640-31675662 CTGGGGAAAGTGGAATCAGGAGG + Intronic
1156292405 18:35759456-35759478 CTGGGGAGGGGGGAGGGGGGAGG + Intergenic
1156922603 18:42541196-42541218 GTGGGGTAGGGGGAGTGGGGAGG - Intergenic
1157066105 18:44352439-44352461 GTGGGGTGGGGGGAGTTGGGAGG + Intergenic
1157087137 18:44592664-44592686 CTGGAGAAGGGGGGATGTGGGGG - Intergenic
1157358394 18:46955794-46955816 CTGTGGAAGGCTGAAGTGGGAGG - Intronic
1157487767 18:48100766-48100788 CTGGGGAATGGGGGAGGGGGAGG + Intronic
1157554746 18:48606197-48606219 CTGAGGAAGGGGGAAAGGGACGG - Intronic
1157621587 18:49020343-49020365 CTAGGGACAGGGGACTTGGGTGG + Intergenic
1157923787 18:51741111-51741133 CTGGGGAAGCTCGAACTGGGTGG + Intergenic
1158810890 18:61032850-61032872 CTTGGGAAGGGTGAATTTTGTGG - Intergenic
1159794246 18:72822353-72822375 CTGGGAAAGCGGGCACTGGGCGG + Intronic
1159902334 18:74059216-74059238 GTGGGGTAGGGGGAGTGGGGAGG + Intergenic
1160453140 18:78979155-78979177 GTGGTGAAGGGGGACTAGGGTGG + Intergenic
1160480613 18:79236884-79236906 GTGGGGAAGGGGGAAGGGGCAGG - Intronic
1160480645 18:79237044-79237066 GTGGGGAAGGGGGAAGGGGCAGG - Intronic
1160480668 18:79237153-79237175 GTGGGGAAGGGGGAAGGGGCAGG - Intronic
1160480681 18:79237211-79237233 GTGGGGAAGGGGGAAGGGGCAGG - Intronic
1160608141 18:80067413-80067435 CTGGAGAAAGGGGAGATGGGAGG + Intronic
1160646676 19:196867-196889 CTGGGGAAGGGGGCAAAGGCAGG - Intergenic
1161370957 19:3910734-3910756 CTGGGGAGGGAGGAGCTGGGTGG - Intronic
1161643171 19:5436684-5436706 CTGTGGAAGGGGGGAAGGGGAGG - Intergenic
1161680275 19:5676680-5676702 CTGGGGTCAGGGGAGTTGGGGGG - Intronic
1161756584 19:6138478-6138500 GAGGGGAAGGGGGAAGGGGGAGG + Intronic
1161845452 19:6709613-6709635 CTGGGGCTGGGGGAGGTGGGTGG - Intronic
1161927145 19:7309445-7309467 CTTGGGCAGGGAAAATTGGGGGG + Intergenic
1161964283 19:7539831-7539853 CTGGGGAAAGGGGTATGCGGGGG + Intronic
1161989717 19:7677761-7677783 CTTGGGAAGGGGCAGGTGGGCGG + Intronic
1162158533 19:8696032-8696054 CTGTGGAGGAGGGAGTTGGGAGG + Intergenic
1162291489 19:9784259-9784281 CTGGGCAAGGGGGATGTGGCAGG + Intronic
1162320204 19:9967148-9967170 CCTGGGAGGGGGGACTTGGGGGG - Intronic
1162340644 19:10089714-10089736 CTTGGGATGGGGGAGTTGGGAGG + Intronic
1162729672 19:12710774-12710796 CTGGGGAAGGGGGAACAATGGGG + Intronic
1163035770 19:14567974-14567996 CTGGGGAGGAGGGATGTGGGAGG - Intronic
1163115220 19:15185080-15185102 CTGGGGTTGGGGGAGGTGGGGGG - Intronic
1163119243 19:15206734-15206756 CTGGAGGAGGGAGAATGGGGAGG - Intergenic
1163137647 19:15324202-15324224 CTGGGGAGGGGGGAAGGGGAAGG + Intronic
1163197058 19:15729622-15729644 GTGGGGTAGGGGGAGTGGGGAGG - Intergenic
1163327078 19:16611580-16611602 TTGGGGCAGGGGGAATGGGTTGG - Intronic
1163496247 19:17648014-17648036 CTGTGGAGGGGGGGATTGGAAGG - Intronic
1163530745 19:17847637-17847659 ATTGGGAAGGAGGGATTGGGGGG - Intronic
1163533915 19:17866313-17866335 CAGGGGGTGGGGGAATTCGGTGG - Intergenic
1163765149 19:19159639-19159661 GGGGGTGAGGGGGAATTGGGAGG + Intronic
1164208186 19:23075089-23075111 CTGGGGTGGGTGGGATTGGGAGG + Intergenic
1164217131 19:23160656-23160678 ATGGAGAAGGGGGAAGTGTGGGG - Intergenic
1164245149 19:23421958-23421980 CTGGGGTATGGGGAGTAGGGAGG - Intergenic
1164808350 19:31136484-31136506 CTGGGGATGAGGGATTGGGGAGG + Intergenic
1164869211 19:31629203-31629225 CTTGGGGATGGGGACTTGGGAGG - Intergenic
1165140428 19:33696644-33696666 CTGGGGAAGGGAGATGGGGGTGG - Intronic
1165255880 19:34577032-34577054 CTGGGGAAGGAGGGATAGGATGG + Intergenic
1165313630 19:35042133-35042155 TTGGGAAAGGAGGAATTTGGGGG - Exonic
1165394675 19:35557873-35557895 CTGTGGACGGGGGAACGGGGCGG + Intronic
1165680127 19:37767184-37767206 TTGGCGAAGGGGGAACTAGGAGG - Intronic
1165808395 19:38596033-38596055 GTGGGGAAAGGGGAATGGGGTGG - Intronic
1165816419 19:38645125-38645147 GTGGGGCAGGGGGAAGTGGGTGG + Intergenic
1165935619 19:39386852-39386874 CTGGGGGGCGGGGAAGTGGGAGG - Intronic
1165945035 19:39436745-39436767 CTGGGAAAGGGGGATTTGCCGGG - Intronic
1166102396 19:40578393-40578415 ATGGGGAGGGGGAAATGGGGTGG + Intronic
1166370131 19:42295694-42295716 CTGGGGAAGGGGGCAAGGGCAGG - Exonic
1166932914 19:46312331-46312353 CTGGGGTATGGGGAGCTGGGGGG - Intronic
1167045525 19:47046732-47046754 CTGGGTAAGGGGGATTGAGGAGG - Intronic
1167490088 19:49787777-49787799 GGGGGGAAGAGGGAATGGGGAGG - Intronic
1167577349 19:50324155-50324177 CTGGGGAAGGGGGCACTGGAAGG - Intronic
1167651884 19:50735909-50735931 GTGGGTCAGGGGGAATTGGTGGG - Intergenic
1167685772 19:50955028-50955050 CTTGGGAAATGGGCATTGGGTGG + Intergenic
1167780495 19:51595709-51595731 CTGGGGGGGGGGGAACAGGGAGG - Intergenic
1168296655 19:55380323-55380345 AGGGGGAAGGGGGAAGGGGGAGG - Intronic
1168539242 19:57196773-57196795 CTGGGGAAGAGGGATGTGGATGG - Intronic
1168689852 19:58369641-58369663 TTGGGGAAGGGGGACCAGGGAGG - Intronic
1168695178 19:58400174-58400196 GTGGGGCTGGGGGTATTGGGTGG + Intergenic
925301320 2:2815017-2815039 ATGGGGTAGGGGGAAGGGGGAGG - Intergenic
925987273 2:9226554-9226576 GTGGTAAAGGGGGAGTTGGGAGG + Intronic
926004171 2:9359295-9359317 CTGGGGTAGGGAGAAGTCGGAGG - Intronic
926184702 2:10680029-10680051 CTTTGGAAGGGCGAGTTGGGCGG + Intronic
926205859 2:10834012-10834034 CTGGGGATGGGGGAAGGGAGAGG - Intronic
926442686 2:12906934-12906956 GTGGGGAATGGGGAAGTGGTGGG - Intergenic
926739219 2:16097247-16097269 CTGGGGAGAGGGGAATTGGCTGG + Intergenic
926828555 2:16934609-16934631 CTTGGGAGGGGGGAATGGGAAGG + Intergenic
927018373 2:18991969-18991991 CTGGGGAAGAGGGAATTATTTGG - Intergenic
927616096 2:24597920-24597942 GTGGGGAGGGGGGAAATGGGAGG - Intronic
927640007 2:24840253-24840275 CTCGGGAAGTGGGGATAGGGAGG - Intronic
927928120 2:27026989-27027011 CTGGGGCAGGGGGCCTTGGGTGG - Exonic
928162213 2:28938972-28938994 CTGGTGAGGGGGGTTTTGGGAGG + Intronic
928162226 2:28939008-28939030 CTGGTGAGGGGGGTTTTGGGAGG + Intronic
928337171 2:30407932-30407954 CAGGGGATGGGGGTATTGGATGG + Intergenic
928384512 2:30854070-30854092 GTGGGGTGGGGGGAATGGGGAGG + Intergenic
928987668 2:37196813-37196835 CGGGGGAAGCGGGAGCTGGGTGG + Intronic
929175001 2:38967300-38967322 CTGGAGAAGGGGGAAGAGGAAGG + Intronic
929276241 2:40027792-40027814 CTGGGGTGGGGGGAAGGGGGAGG + Intergenic
929511361 2:42568458-42568480 CGGGGCCAGCGGGAATTGGGGGG - Intronic
929694629 2:44103803-44103825 CTGTGGAACGGGGAATCGTGTGG + Intergenic
929857672 2:45650602-45650624 GTGGGGGAGGGGGAAGGGGGAGG - Intergenic
929902528 2:46017974-46017996 TTGGGGAAGAGGGGATTTGGAGG - Intronic
929908208 2:46064886-46064908 CTGGGGCAGTGGGAAAGGGGAGG + Intronic
929911498 2:46093426-46093448 CTTTGGAAGGGGAAATTGAGGGG - Intronic
930049843 2:47206480-47206502 CTGGGCAAGAGGGAGGTGGGTGG + Intergenic
930198548 2:48531276-48531298 GTGGGGGTGGGGGAGTTGGGAGG - Intronic
930591812 2:53336500-53336522 CCGGGGCAGTGGGAATTTGGTGG - Intergenic
930904236 2:56546818-56546840 GTGGGGTAGGGGGAGGTGGGGGG + Intergenic
930954024 2:57182359-57182381 TTGGGGAAGGGGTAATGGGGGGG - Intergenic
931143081 2:59485135-59485157 CTGGGGTAGGGGGCTTTGGGTGG - Intergenic
931159395 2:59672177-59672199 ATGGGGAAGTGGGAATGGAGAGG + Intergenic
931952122 2:67376379-67376401 CAGGAGAAGGGAGAAATGGGGGG - Intergenic
932585091 2:73022624-73022646 AGGGGGAAGGGGGAAGGGGGAGG + Intronic
932751320 2:74373492-74373514 CTGGGGAAGGGGGTTGGGGGAGG - Intronic
932805323 2:74778195-74778217 GTGGGGCAGGGGGATTTGGAAGG + Intergenic
933132922 2:78695981-78696003 GTGGGGTAGGGGGAGTGGGGAGG - Intergenic
933365713 2:81351137-81351159 GTGGGGAAGGGGGAGGGGGGAGG - Intergenic
933761096 2:85672656-85672678 CTGGGGAAGAGGGAACGCGGAGG + Intergenic
933969166 2:87456251-87456273 CTGGGGGTGGGGGACTGGGGAGG + Intergenic
934646742 2:96063370-96063392 CTGGGGAGGGGTGCATGGGGAGG + Intergenic
934705120 2:96471731-96471753 CTTTGGAAGGTGGAAGTGGGAGG - Intergenic
934840145 2:97619452-97619474 CTGGGGAGGGGCGCATGGGGAGG + Intergenic
934919667 2:98332610-98332632 CTGAGGAACGGGGAATGGAGAGG + Intronic
935045613 2:99479382-99479404 TTGGGGTAAGGGGAAGTGGGGGG - Intronic
935214829 2:100967762-100967784 CTGGGGAAGGGGGAAGCCTGGGG + Intronic
935269309 2:101419897-101419919 TTGGGGAAGGGGGGTCTGGGTGG + Intronic
935604713 2:104959267-104959289 CTGGGGAAGCTCGAACTGGGTGG - Intergenic
935679296 2:105622029-105622051 ATGGGAAAGGGAGAAATGGGAGG + Intergenic
936324625 2:111494257-111494279 CTGGGGGTGGGGGACTGGGGAGG - Intergenic
936776953 2:115985515-115985537 GTGGGGTAGGGGGAGTCGGGAGG - Intergenic
936860471 2:117012236-117012258 GTGGGGAGGGGGGAAGGGGGAGG - Intergenic
936880339 2:117242978-117243000 GTGGGGTAGGGGGAGTGGGGAGG - Intergenic
937248979 2:120511479-120511501 CTGGGGCAAGGGGAAATGGGGGG - Intergenic
937436140 2:121883057-121883079 GTGGGGTAGGGGGAGTGGGGAGG + Intergenic
937614440 2:123905023-123905045 GTGGGGTAGGGGGAAGGGGGAGG - Intergenic
937876392 2:126828645-126828667 TGGGGCAAGGGGGAAATGGGGGG + Intergenic
937928176 2:127183656-127183678 CTTGGGGAGGTGGAAGTGGGAGG - Intergenic
938379726 2:130829722-130829744 CTGGGGAAGGTGCTCTTGGGTGG - Intergenic
938428355 2:131210318-131210340 CTGTGGAAGGGGTGGTTGGGGGG + Intronic
938586860 2:132699471-132699493 GTGGGGAGGGGGGAGTGGGGAGG - Intronic
938693093 2:133810287-133810309 GTGGGGAGGGGGGAGTGGGGAGG + Intergenic
939845079 2:147233203-147233225 GTGGGGTGGGGGGAAGTGGGAGG + Intergenic
940057806 2:149531493-149531515 ATGGGGAAAATGGAATTGGGGGG + Intergenic
942103147 2:172605895-172605917 TTGGGGGAGGGGGAGTTGTGGGG - Intronic
942301888 2:174570999-174571021 CTGTGGATGGGGGCATTGGAAGG + Intronic
942321755 2:174742149-174742171 CTGGGGAAGGAGGCAGAGGGAGG - Intergenic
942467701 2:176225882-176225904 CTTTGGAAGGCGGAAATGGGAGG - Intergenic
942952060 2:181732116-181732138 CTGGGGAAGCTCGAACTGGGTGG + Intergenic
943100482 2:183479953-183479975 CTCGGGGAGGGGGATTTGGCAGG - Intergenic
943390116 2:187256022-187256044 CTGGGGACATGGGATTTGGGTGG - Intergenic
943454830 2:188092688-188092710 CTGGAGAAAGGGGATTTGGTTGG - Intergenic
943710812 2:191093038-191093060 CTGGGGAAGTTTGAACTGGGCGG + Intronic
943820973 2:192320428-192320450 GTGGGGTAGGGGGAAGGGGGAGG + Intergenic
943920727 2:193705044-193705066 GTGGGGTAGGGGGAAGGGGGAGG - Intergenic
944060103 2:195563215-195563237 CGGGGGATGGGGGGATGGGGAGG - Intergenic
944077631 2:195749831-195749853 GTGGGGAAGGGGGAGGGGGGAGG + Intronic
944412364 2:199457462-199457484 CTGGGGAAGAGGGAAGGGGAAGG - Exonic
944498190 2:200329696-200329718 GTGGGGAAGGGGGATGTGGGTGG - Intronic
944633761 2:201654469-201654491 GTGGGGTAGGGGGAGTGGGGAGG + Intronic
945094062 2:206202685-206202707 GTGGGGATGGGGGAGGTGGGTGG + Intronic
945107221 2:206327530-206327552 CTGGAGTAGGGGCAAGTGGGTGG - Intergenic
945642264 2:212444466-212444488 CTGGGGAAGAGGTATGTGGGTGG + Intronic
945716760 2:213366929-213366951 ATGGGGTAGGGGGAATGGGGAGG - Intronic
946089237 2:217206181-217206203 CAGGGGCAGGGGGAAATGGATGG + Intergenic
946194288 2:218023888-218023910 CTGGGGAAGGGTGTAGGGGGAGG - Intergenic
946301580 2:218827519-218827541 CTGGGGAAGGGGACTGTGGGAGG + Intronic
946584553 2:221170240-221170262 CTGGGGAAGGGAGCATGGTGTGG - Intergenic
947155652 2:227160548-227160570 ATGGGGAGGTGGGAATGGGGTGG - Intronic
947523968 2:230867371-230867393 CTGGGTAAGGAGGAAATGTGCGG - Intronic
947592336 2:231392938-231392960 CTGGGGAAGGGGGCATTTCTTGG + Intergenic
947743208 2:232494379-232494401 CTGGGGAGGGGGATATTGGCAGG + Intergenic
947757189 2:232575178-232575200 CTAGGGAAGGGGGAATTTTGAGG - Intronic
947782611 2:232782855-232782877 CTTGGGAAGGGCTGATTGGGAGG + Intronic
947813422 2:233019958-233019980 GTGGGGTAGGGGGAGTGGGGAGG + Intergenic
947953183 2:234165374-234165396 ATGGGGAGGGGGGGCTTGGGGGG - Intergenic
947977266 2:234377662-234377684 CAGGGGTATGGGGAAATGGGCGG + Intergenic
948136340 2:235639141-235639163 GTGGGGCATGGGGAATTGGACGG + Intronic
948142437 2:235683840-235683862 CGGGGGACGGGGGGCTTGGGAGG - Intronic
948644849 2:239398059-239398081 CTGGGGATGGGGGAACTGAAGGG - Intronic
948780448 2:240318561-240318583 CTGGGGAGTGGGGAACTTGGTGG + Intergenic
949000566 2:241610582-241610604 CTGGGGAAGCAGGAGTGGGGAGG - Intronic
949034428 2:241810095-241810117 CTGGGGCAGGGGCAGGTGGGTGG - Intronic
1168732938 20:103293-103315 CTGGGGAAGGGGTAAGTAAGGGG + Intergenic
1169349858 20:4859445-4859467 CTTGGGAAGGGGCAATGGTGTGG + Intronic
1169469516 20:5871808-5871830 AGGGGGAAGGGGGAAGGGGGAGG + Intergenic
1169494539 20:6102265-6102287 CTCGGGGTGGGGGTATTGGGGGG - Intronic
1169596376 20:7204266-7204288 CTGGGGAAGGGAGAAGTGGAAGG - Intergenic
1169641605 20:7758426-7758448 CAGGGGTAGGGAGAATGGGGAGG - Intergenic
1170518283 20:17154398-17154420 GTGGGGTAGGGGGAGTGGGGAGG + Intergenic
1170630087 20:18058099-18058121 CAGGTGATGGGGGAATGGGGCGG - Intronic
1170740377 20:19050850-19050872 TTGGGGACCGGGGAATGGGGTGG - Intergenic
1170909388 20:20549520-20549542 CTGGGGGAGGGTAAATGGGGGGG + Intronic
1171011956 20:21513748-21513770 CGGGGGAGGGGGGAGTTGGGGGG + Exonic
1171171403 20:23018423-23018445 CAGGGGAAGGGAGAAGTTGGAGG + Intergenic
1171474522 20:25397836-25397858 AAGGGGAAGGGGGAAGGGGGAGG + Intergenic
1171480436 20:25451707-25451729 CTGGGGTAGGGGGAGGGGGGAGG - Intronic
1171768983 20:29307010-29307032 CTGGGGAGGGGGGATCCGGGGGG + Intergenic
1172012370 20:31852981-31853003 TTGGGGATGGGGGCCTTGGGGGG + Intronic
1172015196 20:31869310-31869332 CTGGGGAAGGCTGAATGGCGGGG + Intronic
1172240827 20:33411483-33411505 CTGGGGGAGGTGGAGGTGGGTGG - Intronic
1172319990 20:33988885-33988907 CTGGTGAGGGAGGTATTGGGAGG + Intergenic
1172608213 20:36230061-36230083 TGGGGGAAGGGGGAAGGGGGAGG - Exonic
1172633262 20:36393048-36393070 CTGGGGGCGGGGGAATGGGTGGG + Intronic
1172881720 20:38204433-38204455 CTGGGGATAGGGGAGGTGGGAGG - Intergenic
1172974027 20:38893561-38893583 CTGGGAAGGGAGGAAGTGGGAGG + Intronic
1173750133 20:45469949-45469971 CTGGGGAAGTGGGAATTCCGGGG + Intronic
1174205962 20:48839314-48839336 GTGGGGGAGAGGGAAATGGGAGG - Intergenic
1174595168 20:51678135-51678157 GGGGGGAAGGGGGCAGTGGGGGG + Intronic
1175303972 20:57963352-57963374 TTGGGGGAGGGGGAACGGGGAGG + Intergenic
1175439289 20:58979615-58979637 CTGGGGGCGGGGGAAGGGGGGGG + Intergenic
1175998636 20:62822225-62822247 CCTGGGGAGGGGGAATGGGGAGG - Intronic
1176201926 20:63864992-63865014 CTGGGAAGGTGGGAAGTGGGAGG - Intergenic
1176255111 20:64147658-64147680 CTGGGGAAGGAGATAGTGGGTGG + Intergenic
1176278830 20:64289355-64289377 CTGGGGAAGGGGGCAAAGGCAGG + Intergenic
1177322097 21:19535993-19536015 GTGGGGTAGGGGGAAGGGGGAGG - Intergenic
1177634074 21:23764309-23764331 GTGGGGTGGGGGGAATGGGGAGG + Intergenic
1177899436 21:26896416-26896438 GTGGGGTGGGGGGAATGGGGAGG - Intergenic
1178335107 21:31735491-31735513 GTTGGAAAGGGGGACTTGGGAGG + Intergenic
1178495342 21:33081328-33081350 CTGGTGAGGGGGGAATGGGGGGG - Intergenic
1178570207 21:33728876-33728898 ATGGGGCAGGGGGGAGTGGGGGG - Intronic
1179058291 21:37955900-37955922 CTGGGGAAGAGGGGTTGGGGAGG + Intronic
1179150226 21:38803574-38803596 CTTTGGAAGGGGAAATAGGGAGG + Intergenic
1179264095 21:39786957-39786979 GTGGGGTAGGGGGAAGGGGGAGG + Intronic
1179720321 21:43312896-43312918 CTGGGGGTGGGGGAGTTGAGTGG - Intergenic
1179731886 21:43372685-43372707 CTGGGGAACGGGGTCTGGGGAGG + Intergenic
1180123112 21:45767208-45767230 TGGGGAAAGGGGGGATTGGGAGG - Intronic
1181400291 22:22646897-22646919 CTGGGGATGGGGGACTGGGGTGG + Intronic
1181570145 22:23763994-23764016 CTGGGAAAGGGAGAGATGGGAGG + Intronic
1182056370 22:27358478-27358500 CTGGGTCAGTGGGAATTGAGTGG - Intergenic
1182551997 22:31105622-31105644 CTGGGGGAGGGGAAATGGGATGG - Intronic
1182554532 22:31122173-31122195 CTGGGGGAAGGGAACTTGGGTGG - Intergenic
1182954094 22:34404609-34404631 ATGGGGTAGGGGGAGTGGGGAGG + Intergenic
1183158299 22:36092653-36092675 GAGGAGAAGGGGGAATGGGGAGG - Intergenic
1183317665 22:37145839-37145861 CTGGAGAAGGGGGAACAGCGGGG - Intronic
1183364162 22:37398471-37398493 CTGGGGTAGGGGGAAGGGGCCGG - Intronic
1183387330 22:37522434-37522456 GTGGGGCAGTGGGAAGTGGGAGG - Intergenic
1183493355 22:38128236-38128258 CTGGAGAAGAGGGAGTCGGGAGG + Intronic
1183602266 22:38846797-38846819 AGTAGGAAGGGGGAATTGGGAGG + Intergenic
1183966885 22:41447377-41447399 CTGCGGGAGGGGGAACTGAGGGG + Intergenic
1184150643 22:42636363-42636385 CTGGGGGAGGGGGAGGAGGGAGG + Intronic
1184158876 22:42686422-42686444 CTGGGGGAGGGGGCACTGGCAGG - Intergenic
1184475329 22:44717534-44717556 CTGGGGAAAGGGTAATGAGGAGG - Intronic
1184783521 22:46660779-46660801 CTTGGGAAGCGGGAGTGGGGAGG - Intronic
1185345263 22:50307958-50307980 CTGGGCAGGGGAGAAGTGGGGGG - Intergenic
949606978 3:5664098-5664120 CTGGGGGAGGGGGATTGAGGAGG - Intergenic
949698655 3:6729732-6729754 CTGGGGACGGGAGAAATGGGAGG + Intergenic
949977800 3:9476809-9476831 CTTGGGAAGGGGGAGTAGGATGG - Exonic
950269292 3:11600853-11600875 CTTGGGAAGGGGGAAGGAGGAGG + Intronic
950526718 3:13528741-13528763 GTGGGGAGGGGGGAAAGGGGTGG - Intergenic
950690365 3:14651406-14651428 CTCGGGAAAGGTGGATTGGGAGG - Intergenic
950757948 3:15192538-15192560 GTGGGGTAGGGGGAGTGGGGAGG + Intergenic
951787154 3:26434831-26434853 CAGTTGAAGGTGGAATTGGGAGG - Intergenic
951997231 3:28744618-28744640 CTGGGGAAGGAGGCCTTAGGAGG - Intergenic
952204073 3:31162215-31162237 ATGGGGAAGGGGCAATGAGGAGG - Intergenic
952291098 3:32016445-32016467 GTGGGGTTGGGGGAATGGGGAGG + Intronic
952477799 3:33729148-33729170 CTTTGGAAGGGTGAAGTGGGAGG + Intergenic
952908426 3:38160161-38160183 CTGGGGAAGGGGAAATAAGGAGG + Intergenic
952960439 3:38586042-38586064 CTGGGGAAGGAGGAAGAGGAGGG + Intronic
953293550 3:41690290-41690312 GTGGGGTAGGGGGAGTGGGGAGG + Intronic
953303485 3:41803627-41803649 GTGGGGTAGGGGGAGTGGGGAGG - Intronic
953306017 3:41830145-41830167 GTGGGGTAGGGGGAGTGGGGAGG + Intronic
953503269 3:43458800-43458822 CAGGGGTAGGGGGAAAGGGGAGG - Intronic
954415837 3:50392854-50392876 CTGGGGAAGGGGGACTGGTTTGG + Intronic
954415873 3:50393026-50393048 CTGGGGGATGGGGACTGGGGAGG + Intronic
954677865 3:52325561-52325583 CTGGGGGAAGGGGAGTTGGTGGG - Intronic
954699995 3:52446039-52446061 CTGGGGCAGGGAGCATGGGGAGG - Intergenic
954917473 3:54161250-54161272 CTGGTGAAGGGGGAGTTCAGTGG - Intronic
954990890 3:54839823-54839845 CTGGGGAACGAGGGATTGGAGGG - Intronic
955402619 3:58604020-58604042 GTGGGGCAGGGGCTATTGGGAGG - Intronic
955483674 3:59414503-59414525 CTGGGGAAGGGTGAAGAAGGGGG - Intergenic
956250839 3:67232055-67232077 CTGGGAAAGGGGGAAATATGAGG - Intergenic
957050987 3:75411783-75411805 CTGGGGAAGGGGGCGTGGGGAGG + Intergenic
957071496 3:75571084-75571106 CAGGGCCAGGGGGCATTGGGGGG - Intergenic
958204230 3:90369521-90369543 CTGGGGTGGGGGAAAGTGGGAGG - Intergenic
958568508 3:95848087-95848109 GTGGGGTAGGGGGAGTGGGGAGG - Intergenic
958592754 3:96180039-96180061 GTGGGGTAGGGGGAGGTGGGAGG - Intergenic
958662977 3:97095301-97095323 ATGGGGTAGGGGGAAAAGGGAGG + Intronic
959117118 3:102191582-102191604 CTGGGAAAGGGGGCATTGTGAGG - Intronic
960010645 3:112830995-112831017 TTGGGGAAGGAGGAATAGGGGGG + Intronic
960494657 3:118360124-118360146 TTGGGGAAGAGGTAAGTGGGTGG - Intergenic
960665106 3:120101183-120101205 CGGGGGAAGGGGGCAGTGGCAGG - Intergenic
960689092 3:120324693-120324715 CTGGGGGAGGGGGAAGAAGGTGG + Exonic
961282631 3:125775657-125775679 CAGGGCCAGGGGGCATTGGGGGG + Intergenic
961366772 3:126405133-126405155 CTAGGGGAGGGGGAATGGGGAGG - Intronic
961390666 3:126550702-126550724 CTGGGGGAGTGGGCATTGGTGGG - Intronic
961446884 3:126985098-126985120 CTGGCGCAGGAGGACTTGGGGGG + Intergenic
961678807 3:128584726-128584748 CTGGGGATGGGGGACTTAGGAGG + Intergenic
961774168 3:129272116-129272138 CTGGGGCAGGGGGACTGGGATGG + Intronic
961788101 3:129359434-129359456 CTGGGGCAGGGGGCAGAGGGGGG + Intergenic
961821517 3:129577867-129577889 CTGGACAATGGGGAATGGGGTGG + Intronic
962081430 3:132143060-132143082 GTGGGGTAGGGGGAAGGGGGAGG + Intronic
962326876 3:134441758-134441780 CTGGGGAAGGGGAGGTGGGGAGG - Intergenic
962368968 3:134805109-134805131 CTGGGGATGGGGGATTGGGAAGG + Intronic
963239513 3:142989238-142989260 GTGGGGTAGGGGGAAGGGGGAGG + Intronic
963293122 3:143513987-143514009 CTGGGGTAGGGGGACGGGGGAGG - Intronic
963435197 3:145258133-145258155 GTGGGGAAGCTGGAACTGGGTGG - Intergenic
963679837 3:148360670-148360692 ATGGGGTGGGGGGAATGGGGAGG - Intergenic
963742924 3:149097864-149097886 CTGGGGAAGGGGGAGAGGTGGGG + Intergenic
963856488 3:150258943-150258965 CTGGGGAAGGCTGAGGTGGGAGG - Intergenic
963870151 3:150408157-150408179 CTGGGGTGGGGGGCAATGGGCGG - Intergenic
964371929 3:156009019-156009041 CAGAGGAAGGGAGAATTGGACGG + Intergenic
964394237 3:156228800-156228822 CTGTGGAAGGAGAAATAGGGTGG - Intronic
965978174 3:174652002-174652024 CTAGGGAAGGAAGAATTGGGTGG + Intronic
966582192 3:181580291-181580313 GTGGGGTAGGGGGAGTGGGGAGG + Intergenic
966715736 3:183011392-183011414 CTGGGGAAGGGAGGGTAGGGAGG + Intergenic
966897655 3:184457729-184457751 AAGGGGAAGGGGAAATTGGAGGG + Intronic
968092247 3:195906627-195906649 CTGGGGACAGGGGAATAAGGGGG + Intronic
968348007 3:198027507-198027529 CTGGGGGAGGAGGAAGAGGGAGG - Intronic
968371005 3:198222655-198222677 CTGGGGAAGGGGGCAAAGGCAGG + Intergenic
968534205 4:1113271-1113293 CGGGGGATGGGGGACTTGGGTGG - Intronic
968647983 4:1749410-1749432 GTGGGGAAGGGGGAGGTGGGGGG - Intergenic
968737086 4:2303289-2303311 CTGGGGAAGGGGGTTCTTGGTGG - Intronic
968739059 4:2318192-2318214 CTGGGGAAGGGAGCCTTTGGAGG - Intronic
968751477 4:2391638-2391660 CTGGGGGAGGTGGAATGGGGAGG - Intronic
968862658 4:3184894-3184916 CTGGGGCAGGGGGAGTAGGCAGG + Intronic
969015105 4:4098775-4098797 CAGGGCCAGGGGGCATTGGGGGG - Intergenic
969263267 4:6046895-6046917 CTGGGGCAGGGGGTGTTGGAGGG - Intronic
969439631 4:7209401-7209423 CTGGGGTGGGAGGACTTGGGAGG + Intronic
969537820 4:7767570-7767592 CTGGGGAAGGGAGGAATGGCTGG - Intronic
969562664 4:7959502-7959524 CTCTGGAAGGTGGAGTTGGGAGG + Intergenic
969686484 4:8677521-8677543 CTGGGGATGGGTAAATGGGGAGG + Intergenic
969821459 4:9723890-9723912 CTGGGGAAGAGGGGGTGGGGAGG - Intergenic
970713064 4:18887266-18887288 CTGGGGAAAGAATAATTGGGTGG - Intergenic
970791477 4:19862944-19862966 CTGGGGCAGGGGGAGGGGGGAGG - Intergenic
971038652 4:22725064-22725086 CTGGGGCAGGGGATATGGGGGGG - Intergenic
971350570 4:25852296-25852318 GTGGGGAAGGTGGGAGTGGGTGG - Intronic
971586714 4:28413256-28413278 ATGGGGTAGGGGGAGTGGGGAGG + Intergenic
972093930 4:35324827-35324849 GTGGGGTAGGGGGAAAGGGGAGG - Intergenic
972291461 4:37693835-37693857 TTGCGGTAGGGGGAATTGGGGGG - Intergenic
972346453 4:38196515-38196537 CAGGAGAAGGGGGAGTTGGAGGG + Intergenic
972507068 4:39729620-39729642 CTGGAGTAGGGGGAAATGGCTGG - Intronic
973712203 4:53641192-53641214 CTGGGGAAGGGCGGGGTGGGGGG + Intronic
974119270 4:57619476-57619498 GTGGGGTCGGGGGAAGTGGGGGG - Intergenic
974524070 4:63025643-63025665 ATGGGGTAGGGGGAGTGGGGAGG - Intergenic
974934699 4:68398388-68398410 CTGGGGAACAGGGAGTTGGGAGG + Intergenic
974996398 4:69164951-69164973 CTGGGAAAGAGGGAATGAGGAGG + Intronic
975009380 4:69329881-69329903 CTGGGAAAGAGGGAATGAGGAGG + Intronic
975354985 4:73391707-73391729 CATGGAAAGGGGGAAATGGGAGG - Intergenic
976264809 4:83180528-83180550 CAGGGTAAGGGGAAGTTGGGGGG - Intergenic
976487733 4:85627714-85627736 CCGGGGAAGCTGGAACTGGGTGG - Intronic
977291655 4:95171382-95171404 GTGGGGTAGGGGGAGGTGGGAGG - Intronic
978175699 4:105729885-105729907 GTGGGGTAGGGGGAGTGGGGAGG - Intronic
978225054 4:106322237-106322259 CTTGGAGAGGGGGATTTGGGAGG - Intronic
978417375 4:108490773-108490795 CTGGGGAGGGTGGAGGTGGGTGG + Intergenic
978695420 4:111571086-111571108 GTGGGGTAGGGGGAAGGGGGAGG + Intergenic
979086944 4:116425253-116425275 GTGGGGTGGGGGGAGTTGGGAGG - Intergenic
979259691 4:118635139-118635161 CTGGGGAAGGGGGCAAAGGCAGG + Intergenic
979328683 4:119405482-119405504 CTGGGGAAGGGGGCAAAGGCAGG - Intergenic
979990338 4:127367634-127367656 CTGGGGAGGAGGGAGTGGGGAGG - Intergenic
980562337 4:134493566-134493588 GTGGGGTAGGGGGAGTGGGGAGG + Intergenic
980580961 4:134749671-134749693 GTGGGGTAGGGGGAGGTGGGAGG - Intergenic
981426661 4:144611332-144611354 CTGGAGCAGGAGGAAGTGGGGGG - Intergenic
981910003 4:149968010-149968032 GTGGGGGATGGGGAATTGAGAGG - Intergenic
982653743 4:158120019-158120041 GTGGGGCAGGGGGAGTGGGGAGG + Intergenic
982734159 4:158987628-158987650 GTGGGGTAGGGGGAGTGGGGAGG + Intronic
983409542 4:167379390-167379412 CTGGGCAAGGTGGAGTGGGGTGG + Intergenic
983474629 4:168198628-168198650 CTGGGGAAGCTCGAACTGGGTGG - Intergenic
983828211 4:172291722-172291744 CTGGGGCAGGGGGAGGGGGGTGG - Intronic
983923728 4:173373143-173373165 CTGGGGAAGGGGGTAAGGGAGGG - Intronic
984370472 4:178858681-178858703 GTGGGGTAGGGGGAGTGGGGAGG - Intergenic
986004011 5:3652528-3652550 CAGGGAAAGTGGGAAATGGGAGG + Intergenic
987061382 5:14247063-14247085 GTGGGGAAGGGGGAGGTGGGGGG - Intronic
987447648 5:18040688-18040710 GTGGGGTAGGGGGAAGGGGGAGG - Intergenic
987561578 5:19530575-19530597 GTGGGGTAGGGGGAAGGGGGAGG - Intronic
988459429 5:31419561-31419583 CTGGGGGTGGGGGAGTGGGGTGG + Intronic
988789288 5:34592489-34592511 GTGGGGAAGGGGGAAGGAGGTGG - Intergenic
988854523 5:35215014-35215036 TAGGGGAAGGGGGAATAGGTAGG - Intronic
989272911 5:39553642-39553664 GTGGGGTAGGGGGAAGGGGGAGG + Intergenic
989624920 5:43420134-43420156 CTGAGGAAGGAGGAGTGGGGCGG - Intergenic
989823044 5:45818605-45818627 ATGGGGTAGGGGGAAGGGGGAGG + Intergenic
990031117 5:51260998-51261020 CTGGTGAAAGGGAAAATGGGGGG - Intergenic
990829085 5:59936210-59936232 GTGGGGTAGGGGGAAGGGGGAGG + Intronic
990888502 5:60621533-60621555 CTGGGGTAGGGGGAGTGGGGAGG + Intronic
991317446 5:65325128-65325150 CTGGGGATGGAGGAGTGGGGAGG + Intronic
991461681 5:66865134-66865156 CTGGGGAAGGTGGATTTGGTGGG + Intronic
991657099 5:68914891-68914913 GTGGGGAAGGGGGAAGGGTGCGG - Intergenic
991855067 5:70959255-70959277 GTGGGGTGGGGGGAATGGGGAGG + Intergenic
991965475 5:72086203-72086225 CTGGGGAAGGGTGGGTTGGGGGG + Intergenic
992073996 5:73174306-73174328 GGGGGGAAAGGGGAAGTGGGAGG + Exonic
992298931 5:75357493-75357515 TTGGGGAAGGGGAAAATGGGTGG + Intronic
992829453 5:80580306-80580328 GTGGGGTGGGGGGAATGGGGAGG - Intergenic
992890159 5:81196613-81196635 CGGGGGAGGGGGGAGTGGGGTGG - Intronic
993022165 5:82605194-82605216 CAGGGGGCGGGGGAAGTGGGGGG - Intergenic
993343340 5:86752432-86752454 GTGGGGTAGGGGGAGGTGGGAGG - Intergenic
994616218 5:102107688-102107710 GTGGGGAAGGAAGAATGGGGAGG - Intergenic
994729638 5:103476723-103476745 CTGGGGAAGGGGGTGGTGGGGGG - Intergenic
994982834 5:106899130-106899152 GTGGGGTAGGGGGAGATGGGAGG - Intergenic
995109631 5:108414482-108414504 TTGGGGAAAGGGGAAAAGGGAGG - Intergenic
995239300 5:109867881-109867903 TTGGGGAAGGGGGAATGTTGTGG + Intronic
995410192 5:111848643-111848665 CAGGGGATGGGGGGGTTGGGGGG - Intronic
995912536 5:117204626-117204648 CTGGCGAAGGGGGAGGGGGGGGG + Intergenic
996016005 5:118534660-118534682 CTGGGGAAACGGGAAGTGGAGGG - Intergenic
996057773 5:118999649-118999671 CTGGGAGAGGGGGATTTGGCAGG - Intergenic
996420697 5:123258887-123258909 CTGGGGAAGTCTGAACTGGGTGG - Intergenic
996542866 5:124648157-124648179 CTGGGGCAGGGGCAATGGGCCGG + Exonic
996609175 5:125359143-125359165 GTGGGGAGGGGGGAAGGGGGAGG - Intergenic
996782003 5:127197609-127197631 CTGGGGAAGCTTGAACTGGGTGG + Intergenic
996807858 5:127477790-127477812 GTGGGGAGGGGGGAGTGGGGAGG + Intergenic
996963871 5:129285378-129285400 GTGGGGTAGGGGGAGTGGGGAGG - Intergenic
997249957 5:132380920-132380942 CTGGGGAGAGGGGAGTGGGGAGG + Intronic
997441363 5:133910977-133910999 CTGGGGAAGGGGGGTCTTGGAGG - Intergenic
997530359 5:134577987-134578009 TTGGGGAAGGAGGAATCTGGAGG - Intronic
997693242 5:135842288-135842310 CTGGGGTAGGGGGAGTGGGTGGG - Intronic
997723925 5:136104654-136104676 CCGGGGAAGGGGGAAGTGACAGG - Intergenic
997790110 5:136751488-136751510 CTGGGGTAGGGGGCAGAGGGAGG - Intergenic
997882078 5:137600298-137600320 CTGGGGCAGGGGGAAGGAGGTGG + Intergenic
998108203 5:139481784-139481806 CCAGGGAAAGGGGAACTGGGAGG - Intronic
998384686 5:141749955-141749977 GTGGGGAATGGGGAATAGGGTGG + Intergenic
999064205 5:148668345-148668367 GTGGGGTAGGGGGAGTGGGGAGG - Intronic
999369872 5:151048179-151048201 CCGGGGAAGGAGGAAGAGGGTGG + Intronic
999842732 5:155446986-155447008 GTGGGGTAGGGGGAGTGGGGAGG - Intergenic
1000372004 5:160545794-160545816 CTGGGGGTGGGGGAACTGGGAGG + Intergenic
1000635466 5:163638931-163638953 ATGGGGTAGGGGGAGTCGGGTGG + Intergenic
1001818421 5:174690737-174690759 GTGGGCAAGGAGGAGTTGGGAGG - Intergenic
1001936174 5:175707657-175707679 CTGGGGAGGGTGGGATGGGGTGG - Intergenic
1002177298 5:177408408-177408430 TTGAGGAAGGGGGAAATGGCAGG + Intronic
1002461432 5:179375848-179375870 CAGGGGAGGGGGGAAGGGGGAGG + Intergenic
1002461468 5:179375938-179375960 CTGGGGGAGGGGGAAGAGGGAGG + Intergenic
1002461526 5:179376080-179376102 CTGGGGGAGGGGAAAGGGGGAGG + Intergenic
1002485805 5:179535415-179535437 CTGGGCATGGGTGAGTTGGGGGG - Intergenic
1002730242 5:181328211-181328233 CTGGGGAAGGGGGCAAAGGCAGG + Intergenic
1002754288 6:145893-145915 CTGGGGAAGGGGGCAAAGGCAGG - Intergenic
1002899889 6:1401636-1401658 ATGGGGAAAGGGGAAAGGGGAGG + Intergenic
1002927719 6:1614583-1614605 CTGGGGAGGGGGGTGTGGGGAGG - Intergenic
1003376709 6:5585465-5585487 ATGGGGGTGGGGGAATGGGGAGG - Intronic
1003700059 6:8453846-8453868 CTTGGCAAAGGGGAATGGGGAGG - Intergenic
1004005741 6:11635968-11635990 CTGGGAGAGGGGGATTTGGCAGG - Intergenic
1004288237 6:14342673-14342695 CTGGGGAGAGTGGAATGGGGTGG - Intergenic
1004938861 6:20534709-20534731 GCTGGGATGGGGGAATTGGGAGG + Intronic
1005175000 6:23034409-23034431 TTGGGAGAGGGGGTATTGGGAGG + Intergenic
1005495385 6:26383487-26383509 CTCGGGGAGGGGGAAGTGGAGGG + Intronic
1006302152 6:33199373-33199395 CTGGGGAAGGGGATTTGGGGAGG + Exonic
1006321609 6:33322696-33322718 CTGGGGGAGGGGGATTTGGCGGG - Intronic
1006324774 6:33345505-33345527 GTGGGGCCGGGGGAATGGGGGGG - Intergenic
1006360405 6:33584197-33584219 CTGGGGAGGGAGGCCTTGGGTGG + Intergenic
1006926445 6:37658146-37658168 GTGGGGAAGTGGGCATGGGGTGG - Intronic
1007364754 6:41383549-41383571 CTTAGGAAGGGAGATTTGGGTGG + Intergenic
1007541371 6:42648529-42648551 CTGGAGAAGGTGGCATTGAGAGG - Intronic
1007581520 6:42962990-42963012 CTGGGGAGGGGAGAGATGGGAGG + Intronic
1007644524 6:43369765-43369787 CCGCGGGAGGGGGAAGTGGGCGG - Intergenic
1007655310 6:43447940-43447962 CTGGGGGAGATGGACTTGGGAGG + Intronic
1007746155 6:44044078-44044100 CTGGGGGAGGGGGGGTTGTGGGG - Intergenic
1007784038 6:44270364-44270386 CTTGGGAAGGCGGAGTTTGGGGG + Intergenic
1007864135 6:44949239-44949261 GTGGGGTGGGGGGAATGGGGAGG + Intronic
1007947392 6:45838561-45838583 CTGGAGGAGGGGGCATTTGGAGG - Intergenic
1008117266 6:47566596-47566618 CGGGGGAAGGGAGAATTGAGAGG - Intronic
1009960088 6:70509188-70509210 CTGTGGAAGGTGGAGGTGGGAGG + Intronic
1010385087 6:75270408-75270430 CTGGAGAAGGGGCCTTTGGGAGG + Intronic
1010938156 6:81885792-81885814 TTGGGGAAGGGGGATGTGGATGG - Intergenic
1011336113 6:86261425-86261447 TTGGGGAGTGGGGAATTGGAGGG - Intergenic
1012206841 6:96472220-96472242 CAGGGGAAGGGGGATTGGGGAGG - Intergenic
1012638385 6:101577889-101577911 CTGGGGAATGGGGAATGGATGGG + Intronic
1012984315 6:105858654-105858676 ATGGGGTAGGGGGAGTGGGGAGG - Intergenic
1013246585 6:108293561-108293583 GAGGGGAAGGGGGAAGGGGGAGG - Intergenic
1013414564 6:109913264-109913286 CTGGGGAACTGGGAATGGGGAGG - Intergenic
1013575774 6:111482802-111482824 CTGGGTGAGGGGGGATTGGCAGG + Exonic
1014001965 6:116374279-116374301 TTGGGGAAGGGGCAGTGGGGTGG - Intronic
1015225610 6:130853625-130853647 CTGAGAAAGGTGGACTTGGGAGG + Intronic
1015277145 6:131395077-131395099 CTGGGGATGGGGCTTTTGGGGGG + Intergenic
1015659500 6:135559326-135559348 CAGGGGAAGGGGGAATAGGAAGG + Intergenic
1015935132 6:138401592-138401614 ATAGGGAATGGGGAATTGGGAGG + Intergenic
1016283962 6:142451795-142451817 CTGAGGAAGGGGTAGTGGGGAGG - Intergenic
1016398751 6:143655301-143655323 CTAGGGTTGGGGGAATTGTGGGG + Intronic
1016576890 6:145579000-145579022 GTGGGGTGGGGGGAATGGGGAGG + Intronic
1018279813 6:162173035-162173057 ATGGGGAAGGAGAAACTGGGGGG + Intronic
1018459393 6:163983414-163983436 CTGGAGAAGTGGGAAAGGGGAGG + Intergenic
1018699811 6:166417462-166417484 CTGAGGAAGAGGGAATTCTGTGG + Intronic
1018902600 6:168058933-168058955 CTGGGGCAGGTGGACGTGGGTGG - Intronic
1018965520 6:168484937-168484959 CTGGGGAAGGGGAAATGGGGAGG + Intronic
1019572469 7:1719446-1719468 CTGCGGAAGCGGGAATTAGACGG - Intronic
1020023260 7:4881938-4881960 CAGGGGTGGGGGGAAGTGGGGGG - Intronic
1020035159 7:4959663-4959685 TGGGGGAAGTGGGAAGTGGGGGG + Intergenic
1020035273 7:4959927-4959949 CTGGGGGTGGAGGAAGTGGGGGG + Intergenic
1020077345 7:5266957-5266979 CTTTGGAAGGGCGAAGTGGGAGG + Intergenic
1020115333 7:5473055-5473077 CTGGGGAATTGGGCAGTGGGTGG - Intronic
1020117218 7:5482498-5482520 CTGGGGGTGGGGGCATTGGGGGG - Intronic
1020317303 7:6914947-6914969 CTGGGGAAGGGGGGGTGGGGAGG + Intergenic
1020754199 7:12181473-12181495 CTGGGGTGGGGGGAAGGGGGAGG - Intergenic
1021244646 7:18246508-18246530 CTGAGGAAGGTGGGAATGGGGGG - Intronic
1021845176 7:24757022-24757044 ATGGGGAGGGGGGGTTTGGGGGG + Intronic
1021904856 7:25323045-25323067 CTGGGGAAGGGGATAATGGAGGG + Intergenic
1022094379 7:27130013-27130035 CAGGGGAAGGGGGCCTCGGGAGG - Intronic
1022258728 7:28683989-28684011 GTGGGGAGGGGAGATTTGGGGGG + Intronic
1023314236 7:38918736-38918758 CTTGGGAAGGCAGAAGTGGGTGG + Intronic
1023401417 7:39794761-39794783 CTGGGGAAGGGGGCAAAGGCAGG + Intergenic
1023604308 7:41914717-41914739 CTGGGGAAGAGGGAAGAAGGAGG + Intergenic
1023835811 7:44066528-44066550 CTGGGGTGGGAGGAAATGGGAGG - Intronic
1024075398 7:45815405-45815427 CTGGGGAAGGGGGCAAAGGCAGG + Intergenic
1024324277 7:48096515-48096537 CTGGGGAAGGGGAAGTGGGAGGG - Intronic
1024519292 7:50290030-50290052 CAGGGGATGGGGGGATTGTGGGG - Intergenic
1024527284 7:50359718-50359740 CTGAGGAGCGTGGAATTGGGTGG - Intronic
1024657833 7:51466913-51466935 CTGGTGTTGGGGGAATGGGGTGG + Intergenic
1024988322 7:55214463-55214485 ATGGGGAAGGGGGGCTGGGGAGG + Intronic
1025016272 7:55441230-55441252 CTGGGGAGGAGGGAAGGGGGAGG + Intronic
1025052059 7:55740402-55740424 CTGGGGAAGGGGGCAAAGGCAGG - Intergenic
1025177396 7:56808958-56808980 CTGGGGAAGGGGGCAAAGGCAGG - Intergenic
1025201775 7:56966717-56966739 CTTTGGAAGGGCGAAGTGGGAGG - Intergenic
1025670171 7:63610211-63610233 CTTTGGAAGGGCGAAGTGGGAGG + Intergenic
1025694396 7:63767430-63767452 CTGGGGAAGGGGGCAAAGGCAGG + Intergenic
1026047551 7:66917662-66917684 GTGGGTAAGAGGCAATTGGGAGG - Intergenic
1027222687 7:76223990-76224012 GCAGGGGAGGGGGAATTGGGGGG - Intronic
1027229992 7:76267170-76267192 CTGGGGAAGGGGGAAAGAGGAGG + Intronic
1027871281 7:83711562-83711584 ATGGGGTAGGGGGAATGGGGAGG - Intergenic
1028306245 7:89269205-89269227 GTGGGGTAGGGGGAAGGGGGAGG - Intronic
1028669412 7:93384062-93384084 CTGGGGCAGGGCTGATTGGGAGG - Intergenic
1028836973 7:95385202-95385224 GTGGGGTAGGGGGAAGAGGGAGG + Intronic
1028983437 7:96992264-96992286 AGGGGGAAGGGGGAGTTTGGGGG + Intergenic
1029225623 7:99026212-99026234 CTGTGGAAGGTGGAGGTGGGTGG + Intergenic
1029272445 7:99385285-99385307 ATGGGGCAGGGGAAGTTGGGTGG + Intronic
1029585538 7:101468482-101468504 CTGGGGAAGGGGCACCTTGGAGG + Intronic
1030242725 7:107346844-107346866 GTGGGGTAGGGGGAGTGGGGAGG - Intronic
1030537001 7:110780585-110780607 GTGGGGAAGGGGTAATAGCGAGG - Intronic
1030860171 7:114615779-114615801 CTGGTAAAAGGGGAATTAGGTGG - Intronic
1032051915 7:128655130-128655152 CTGGGGAAGGGGGCAAAGGCAGG + Intergenic
1032181030 7:129677987-129678009 CGGGGGAAGGGGGGAGGGGGCGG + Intronic
1032457429 7:132083997-132084019 CTGGGGAAGAGGGAAATGTGTGG - Intergenic
1032755732 7:134889064-134889086 CTGGGGAGGAGGGAATCAGGAGG + Intronic
1032873717 7:136013982-136014004 CTGGGGATAGGGTTATTGGGGGG + Intergenic
1033309118 7:140247150-140247172 CTGTGGAGGGGGGAATTAGCAGG - Intergenic
1033653470 7:143359084-143359106 CTGGGGTGGGAGGAACTGGGAGG - Intronic
1033973893 7:147075773-147075795 GTGGGGTAGGGGGAAGGGGGAGG - Intronic
1034340018 7:150346863-150346885 GTGGGGAAGGGGATGTTGGGAGG + Intergenic
1034368179 7:150570010-150570032 GTGGGGGTGGGGGATTTGGGGGG + Intronic
1034572732 7:151970132-151970154 GTGGGGAGGGGGTAGTTGGGGGG + Intronic
1034962783 7:155372909-155372931 CTGGGGGAGGCGGATGTGGGCGG - Intergenic
1035046845 7:155973471-155973493 CTGTGGAAGGTGGAGCTGGGAGG + Intergenic
1035688389 8:1542811-1542833 CTGGGGAAGGGAGAACAGGCTGG - Intronic
1035885669 8:3288968-3288990 GTGGGGTAGGGGGAGTGGGGAGG - Intronic
1036080338 8:5548419-5548441 CTGGGGAAGATGAAATTGGGTGG + Intergenic
1036163425 8:6409127-6409149 CTGTGGGAGGCGGAAGTGGGTGG - Intronic
1036705936 8:11046988-11047010 CTGGGGAGAAGGGAAATGGGGGG + Intronic
1036775789 8:11612478-11612500 CTGGGGAGGGGGGTGGTGGGCGG - Intergenic
1036890357 8:12592644-12592666 CAGGGCCAGGGGGCATTGGGGGG - Intergenic
1036897925 8:12650561-12650583 CAGGGCCAGGGGGCATTGGGGGG - Intergenic
1037316996 8:17608497-17608519 CTGGGGAAGGAGGCAGAGGGAGG + Intronic
1037609805 8:20466516-20466538 CTGAGGAAGAAGGAATTGTGGGG + Intergenic
1037634950 8:20693248-20693270 CTGGGGAGGGGAGCAGTGGGAGG + Intergenic
1037881312 8:22574803-22574825 CTGGGGAAGGAGGATGTGGGCGG - Exonic
1038702486 8:29861730-29861752 ATGCGGAAGGGGAAGTTGGGAGG + Intergenic
1038852221 8:31290752-31290774 TGGGGGAAAGGGGAGTTGGGGGG - Intergenic
1038970305 8:32626185-32626207 CTTGGGAAGTGGGAGGTGGGAGG + Intronic
1039127626 8:34220914-34220936 TTGGGGTAGGGGGAAGGGGGAGG + Intergenic
1039567787 8:38563861-38563883 CTGGAGAAAGGGGAATGGGGAGG - Intergenic
1039622661 8:39012795-39012817 GTGGGGTAGGGGGAGTGGGGAGG + Intronic
1040070545 8:43183777-43183799 GTGGGGCAGGGGGAAAGGGGAGG - Intronic
1040923900 8:52655131-52655153 CTGGGGGAGGGGGCATTAGAGGG - Intronic
1041118874 8:54566503-54566525 CTGGGGGAGAAGGAAATGGGAGG - Intergenic
1041758533 8:61339260-61339282 CTGGGGAATGGGGGATGGGACGG - Intronic
1042175911 8:66036881-66036903 CTGGGGCAGGGGGACCTGTGGGG + Intronic
1042269693 8:66942477-66942499 TTGAGGAAGGGGGAAAGGGGAGG - Intergenic
1043358342 8:79440278-79440300 CTGGGGAAGTAGGAAGGGGGTGG + Intergenic
1043459141 8:80441805-80441827 CGGGGGAAGGGGTGATTGAGAGG + Intergenic
1043800928 8:84608540-84608562 CTGGGGAAGGGCAAAGTGGGAGG - Intronic
1044105336 8:88198038-88198060 CTGGTGAAGGGGGCTCTGGGAGG + Intronic
1044131734 8:88532205-88532227 GTGGGGTAGGGGGAAGAGGGAGG - Intergenic
1044531003 8:93307362-93307384 CTGGGGAAGGAGGTACTGAGTGG - Intergenic
1044637215 8:94338054-94338076 GTGGGGTAGGGGGAGTGGGGAGG + Intergenic
1044733253 8:95250041-95250063 CAGGGGAAGGGAGACATGGGTGG - Intronic
1045316439 8:101047687-101047709 TTGGGGCAGGGGGTATCGGGAGG - Intergenic
1045744405 8:105400405-105400427 GTGGGGTAGGGGGAGTGGGGAGG - Intronic
1045842645 8:106597754-106597776 CTGGGGAATGGGGAATCCGAGGG - Intronic
1046026901 8:108735361-108735383 CTGAGGAGTGGGGAAATGGGGGG - Intronic
1046054832 8:109067053-109067075 GTGGGGTAGGGGGAAAGGGGAGG - Intergenic
1046221999 8:111228683-111228705 AGGGGGAAGGAGGTATTGGGTGG - Intergenic
1046318398 8:112537018-112537040 TTGGGGTAGGGGGAAGGGGGAGG + Intronic
1046708313 8:117480131-117480153 GTGGTGAAGGGGGAGGTGGGAGG + Intergenic
1046776728 8:118172104-118172126 GTGGGGTAGGGGGAGTGGGGAGG + Intergenic
1048049673 8:130805537-130805559 TTGGAGAAGTGGGAATAGGGTGG + Intronic
1048249973 8:132856745-132856767 GTGGGGAATGGGGAAATTGGAGG + Intergenic
1048373695 8:133803101-133803123 GTGGGGTAGGGGGAGTGGGGAGG + Intergenic
1048456696 8:134584788-134584810 CGGGGGAAGGGGAAAGAGGGCGG + Intronic
1048841927 8:138574251-138574273 CTGGGAAAAGGGGAGTTGGTAGG - Intergenic
1049043793 8:140132738-140132760 CTGGGAAAGGTGCAAGTGGGAGG + Intronic
1049070605 8:140352690-140352712 CTGGGGAAGGGGTGAGTGGGAGG - Intronic
1049074958 8:140388227-140388249 GTGGGGAGGGGGGAGGTGGGAGG + Intronic
1049100255 8:140574133-140574155 GTGGGGAAGTGGGGGTTGGGGGG - Intronic
1049498121 8:142946231-142946253 CTGGTGAAGGGGGCAGTGAGTGG - Intergenic
1050024386 9:1319164-1319186 CTGGGGAAAGGTTCATTGGGAGG - Intergenic
1050052042 9:1612768-1612790 CTGGGGAGGAGGGAATTCGGAGG - Intergenic
1050305339 9:4300010-4300032 GAGGGGAAGGGGGAAGAGGGAGG + Intronic
1050373586 9:4947853-4947875 GTGGGGTAGGGGGAGTGGGGAGG - Intergenic
1051089478 9:13389263-13389285 ATGGAGCAGGGGGGATTGGGGGG + Intergenic
1051524768 9:18031602-18031624 CTGGGGAAGGGGAGATGGGAGGG + Intergenic
1052281199 9:26735332-26735354 CTGGGGAAGTTCGAACTGGGCGG - Intergenic
1052359428 9:27538360-27538382 AATGGGATGGGGGAATTGGGAGG - Intergenic
1052722647 9:32190852-32190874 GTGGGGTAGGGGGAGTGGGGAGG + Intergenic
1052800052 9:32958276-32958298 CTGGGGAAGCTTGAACTGGGTGG + Intergenic
1053029443 9:34761838-34761860 GTGGGGTAGGGGGAGTGGGGAGG - Intergenic
1053049698 9:34949847-34949869 CGGGGGTAGGGGGAAAGGGGTGG + Intergenic
1053160246 9:35809133-35809155 CTGGGGTGGGTGGAATGGGGAGG - Intronic
1053166884 9:35851245-35851267 GTGGGGAACAGGGAATTGGCGGG - Intronic
1053174626 9:35912977-35912999 CTGGTGAAGCGGGCATGGGGAGG + Intergenic
1053358324 9:37465471-37465493 CTGGGAGAGGCGGAATGGGGCGG - Intergenic
1054453872 9:65419961-65419983 GAGGGGAAGGGAGAAATGGGAGG + Intergenic
1054775583 9:69121421-69121443 TGGGGGCAGGGGGAGTTGGGCGG - Intronic
1055397257 9:75889229-75889251 CTGGAGAAAGGGGAAGGGGGAGG - Intergenic
1055782676 9:79836258-79836280 CTGTGAAACAGGGAATTGGGAGG + Intergenic
1055931618 9:81565129-81565151 CTGGGGAGGGGGGAGGGGGGAGG + Intergenic
1056034609 9:82590690-82590712 CTGGGGTAATTGGAATTGGGAGG - Intergenic
1056096004 9:83254114-83254136 ATGGGGTAGGGGGAAGGGGGAGG + Intronic
1056410083 9:86317091-86317113 CTGGGGAAGGGAGGGTTGAGGGG + Intronic
1056641323 9:88373455-88373477 GGGGGGAATGGGGAATTGAGGGG - Intergenic
1056656005 9:88509673-88509695 CTGGGGATTGAGGAACTGGGTGG - Intergenic
1056663860 9:88565011-88565033 CTGGGGGAGGAGAAAATGGGAGG - Intronic
1057216199 9:93230199-93230221 CTGGGGAGTGGGGAGTGGGGTGG + Intronic
1058552117 9:106126109-106126131 GTGGGGTAGGGGGAGTGGGGAGG - Intergenic
1058928521 9:109694024-109694046 GTGGGGAAGGGGGAGATTGGGGG - Intronic
1059323853 9:113490316-113490338 CTGGAGAAGGGGAAAGTGGATGG - Intronic
1059633797 9:116153716-116153738 GAGGGGAGGGGGGACTTGGGGGG + Intergenic
1059891933 9:118813556-118813578 CTGGGGAAGAGGGAGTGGGGCGG - Intergenic
1059910497 9:119038581-119038603 ATGGGGTAGGGGGAAGGGGGAGG - Intergenic
1060402195 9:123355643-123355665 GTGGGGAGGGGGGAGTGGGGAGG + Intergenic
1060527750 9:124330053-124330075 CCAGGGAGGGGGGAAGTGGGAGG - Intronic
1060593146 9:124832003-124832025 CTGGGTAATGGGGCATTCGGTGG - Intergenic
1060734053 9:126055124-126055146 CTGGGGAAGGTGGACGAGGGTGG + Intergenic
1060824924 9:126682509-126682531 CTGGGGGTGGGGGCATTGGGAGG + Intronic
1060825953 9:126688314-126688336 CTGGGGAAGGGGCAGCAGGGCGG - Intronic
1060851059 9:126876199-126876221 GGGGGGAAGGGGGAAAGGGGGGG - Intronic
1061242823 9:129384159-129384181 CTTGGGATGGGGGAAAGGGGTGG - Intergenic
1061360409 9:130138430-130138452 ATGGGGAAGGGGGAAGGGCGAGG - Exonic
1061768025 9:132894855-132894877 CTGAGGCAGGGGGATTTGGTAGG - Exonic
1062143737 9:134976727-134976749 ATGGGGGAGGGGGAAGGGGGAGG - Intergenic
1062546688 9:137066721-137066743 CTGGGTAAGGGAGGAGTGGGCGG + Intronic
1062594624 9:137293608-137293630 CTGGGGCAGGAGGAATTGACTGG + Intergenic
1062640491 9:137515893-137515915 GTGGGGAGGGGGGATTTGGGGGG - Intronic
1062740962 9:138175208-138175230 CCGGGGACGGTGGAACTGGGTGG + Intergenic
1062754654 9:138280725-138280747 CTGGGGAAGGGGGCAAAGGCAGG + Intergenic
1203400021 Un_KI270519v1:78727-78749 GTGGGGAAGGGGGATTGGGGAGG + Intergenic
1203578561 Un_KI270745v1:24885-24907 CTGGGGAAGGGGGCAAAGGCAGG + Intergenic
1203666414 Un_KI270754v1:22942-22964 CGGTGGAAGGGGGAAACGGGTGG + Intergenic
1203667564 Un_KI270754v1:28581-28603 CGGTGGAAGGGGGAAACGGGTGG + Intergenic
1185582024 X:1217111-1217133 CTGGGAAAAGGGGAAGTGGCCGG + Intergenic
1185608500 X:1380576-1380598 GTGGGGGAGGGGGAAGGGGGAGG + Intronic
1185735880 X:2495769-2495791 CGGGGGGAGGGGGGTTTGGGGGG + Intronic
1185951087 X:4434989-4435011 GTGGGGAAGGAGAAATGGGGAGG + Intergenic
1186055237 X:5643018-5643040 CAGGGGAAAGGGGAAGGGGGAGG + Intergenic
1186198135 X:7130288-7130310 CAGGGTTAGGGGGAATTCGGAGG + Intronic
1186552246 X:10518471-10518493 GTGGGGAAGGGGGTAGTAGGGGG - Intronic
1186782654 X:12928750-12928772 GTGGGGTGGGGGGAAGTGGGAGG + Intergenic
1186847951 X:13550126-13550148 CAGGGAAAGGAGGAATTGTGAGG - Intergenic
1187002455 X:15196713-15196735 TTGGGGGAGGGGGAAGGGGGGGG - Intergenic
1187088642 X:16069567-16069589 AAGGGTAATGGGGAATTGGGGGG - Intergenic
1188715503 X:33455644-33455666 CGGGGGAAGGGGAAAAAGGGTGG - Intergenic
1188845598 X:35068283-35068305 GTGGGGTAGGGGGAGTGGGGAGG - Intergenic
1189485377 X:41426833-41426855 GTGGGGAGGGGGGAGTGGGGAGG - Intergenic
1190829758 X:54049022-54049044 GTGGAAAAGGGGGGATTGGGGGG + Intergenic
1191147028 X:57177943-57177965 TAGGGGAAGGGGAAATGGGGAGG - Intergenic
1192318015 X:70066989-70067011 CTGGGGTAGGGGCAATAGGCTGG + Intergenic
1192318378 X:70068502-70068524 CTGGGAAAGGGGGCATAGGCTGG + Intergenic
1192422465 X:71045727-71045749 CTTGGGAATGGGGGATTGTGGGG - Intergenic
1192432962 X:71125124-71125146 CTGGGGGATGGGAAAATGGGTGG - Exonic
1192451877 X:71249918-71249940 CTGTGGAAAGGGGAGTGGGGAGG - Intronic
1192671602 X:73149647-73149669 TTGGGGATGGGGGAAATGGTGGG - Intergenic
1193146014 X:78076507-78076529 ATGGGGTAGGGGGAGTGGGGAGG - Intronic
1193474480 X:81946266-81946288 GTGGGGTGGGGGGAATGGGGAGG + Intergenic
1193855092 X:86590956-86590978 GCGGGGAAGGGGGAAGGGGGAGG - Intronic
1194234137 X:91361265-91361287 AGGGGGAAGGAGGAATAGGGTGG + Intergenic
1194288593 X:92040119-92040141 CTGGGGCTGGGGGGATTGGAGGG + Intronic
1194620578 X:96165873-96165895 CAGGGGAAGATGGGATTGGGTGG - Intergenic
1194726942 X:97409864-97409886 CTGGGGAAGCTCGAACTGGGCGG + Intronic
1194734936 X:97501047-97501069 CTTGGGGAGGGGGAATGGTGGGG - Intronic
1195124155 X:101788405-101788427 CTGGGGGAAGGGTAGTTGGGAGG - Intergenic
1195252595 X:103063567-103063589 CGGGAGATGGGGGAGTTGGGAGG + Intronic
1195776136 X:108408065-108408087 CTTGGGAAGGCTGAAGTGGGAGG + Intronic
1195828854 X:109033210-109033232 CTGGGGTAGGGGGAGTGAGGGGG - Intergenic
1196171786 X:112596117-112596139 GTGGGGTAGGGGGAAGGGGGAGG + Intergenic
1196402433 X:115330491-115330513 CGGGGGGAGGGGGAGGTGGGCGG + Intergenic
1196935482 X:120726379-120726401 CTGGGGCTGTGGGATTTGGGAGG + Intergenic
1197008342 X:121531345-121531367 CTGGGGTAGGGGGAGCGGGGAGG - Intergenic
1197373952 X:125659268-125659290 GTGGGGTAGGGGGAAGGGGGAGG + Intergenic
1197651352 X:129068214-129068236 TGGGGGAAGGGGGAAATGGGAGG + Intergenic
1197805013 X:130390300-130390322 CTGTTGAAGGGGGGTTTGGGGGG - Intergenic
1198518331 X:137429378-137429400 CTGGGGAAGGGGGAAGTCTTGGG - Intergenic
1198553102 X:137765073-137765095 GTGGGGTAGGGGGAAGGGGGAGG - Intergenic
1198672499 X:139095993-139096015 ATGGTGAAGGGGGAATTCTGGGG + Intronic
1199285527 X:146050282-146050304 CTCGGAAAGGGGGATTTGGCAGG - Intergenic
1199381914 X:147181372-147181394 CTGGGTAAGGTGGAAGAGGGAGG + Intergenic
1199770758 X:150973779-150973801 CGGGGGAGGGGGGAGGTGGGTGG + Intergenic
1199911816 X:152295347-152295369 CTGGGGAAGCTTGAACTGGGTGG - Intronic
1200574748 Y:4874324-4874346 GTGGGGTAGGGGGAGGTGGGAGG + Intergenic
1200606114 Y:5264684-5264706 CTGGGGCTGGGGGGATTGGAGGG + Intronic
1200689120 Y:6288810-6288832 GTGGGGTAGGGGGAAGTGGAGGG - Intergenic
1201046153 Y:9885912-9885934 GTGGGGTAGGGGGAAGTGGAGGG + Intergenic
1201314417 Y:12629749-12629771 CGGGGGAAGCTCGAATTGGGTGG - Intergenic
1201526782 Y:14944900-14944922 GTGGGGTTGGGGGAATGGGGAGG + Intergenic
1201707192 Y:16950135-16950157 CTGGGGAAAGGGGAAGTTGTGGG + Intergenic
1201901391 Y:19048329-19048351 CTGGGGAAGGGAGAAAGTGGCGG - Intergenic
1202381198 Y:24277505-24277527 CTGGGGAAGGGGGCAAAGGCAGG + Intergenic
1202489587 Y:25392621-25392643 CTGGGGAAGGGGGCAAAGGCAGG - Intergenic