ID: 1147250445

View in Genome Browser
Species Human (GRCh38)
Location 17:39150149-39150171
Sequence GTGGTCTCCCTGAAAATTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 114}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147250439_1147250445 0 Left 1147250439 17:39150126-39150148 CCACGTCTCTGGCCACCCTCTGT 0: 1
1: 0
2: 2
3: 23
4: 276
Right 1147250445 17:39150149-39150171 GTGGTCTCCCTGAAAATTGGTGG 0: 1
1: 0
2: 3
3: 12
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147250445 Original CRISPR GTGGTCTCCCTGAAAATTGG TGG Intronic
900848953 1:5126861-5126883 TTGGTCTCCCTGAGCATTTGGGG - Intergenic
901734166 1:11301760-11301782 GTGATCTCCCTGATAAATGATGG + Intergenic
902364591 1:15963526-15963548 GAGGTCTCACTGAACCTTGGTGG + Intronic
904302680 1:29565281-29565303 GTGGTCTGCCAGAAAATTTAGGG + Intergenic
905927918 1:41765128-41765150 GGGGGCTCCCAGAAATTTGGTGG + Intronic
907662800 1:56408822-56408844 GTGGTCACACTGCTAATTGGTGG - Intergenic
908399508 1:63757648-63757670 GTGATCTCTCTGAAAATGTGTGG + Intergenic
910443475 1:87276883-87276905 GTGTTCTCCCTGAAATTTGGGGG + Intergenic
910529115 1:88214957-88214979 GAGGTCTCCCTGAAAAATTCAGG - Intergenic
911060148 1:93740506-93740528 GTGGTCTCCCTGCATCTTGCTGG - Intronic
911384181 1:97154411-97154433 ATGTTCTCACTGATAATTGGGGG + Intronic
912126800 1:106549563-106549585 GTGTTCTCCCTGGAATTTGAAGG + Intergenic
918019902 1:180677333-180677355 TCAGTCTCCCTGAAAATTCGGGG + Intronic
918447422 1:184629247-184629269 GGGCTGTCCCTGAAAGTTGGAGG - Intergenic
920698061 1:208196790-208196812 GTGTTGTCCCTGAGAATGGGTGG + Intronic
1065656060 10:27951476-27951498 GTGGTATCCCAGATTATTGGAGG + Intronic
1065882052 10:30045277-30045299 GGGGTCTCCCTCAAATTTGAGGG - Intronic
1066206897 10:33198440-33198462 GTTGTCTACTTGAAAATTGCAGG - Intronic
1073946662 10:108758343-108758365 TCAGTCTCCCTGAAAATTTGAGG - Intergenic
1076633800 10:131869579-131869601 CTGGTCTCCCAGGAAAATGGAGG + Intergenic
1078369301 11:10731757-10731779 GCTGTCTCCCTGAAAACTCGAGG - Intergenic
1079075645 11:17384012-17384034 GGGGTCTCCCTCAGAGTTGGTGG + Intergenic
1079467516 11:20745450-20745472 GTGTTCTTCCTCAAAATTGCGGG + Intronic
1083231771 11:61326079-61326101 GTGGTAGCCCTGATAATGGGGGG - Intronic
1084272772 11:68038110-68038132 GTGGTTCCTCAGAAAATTGGGGG - Intergenic
1085076880 11:73598860-73598882 CTGGTCTCCCTGCAAATTTGAGG + Intergenic
1091632741 12:2174161-2174183 GTGGTATCCCAGATAAATGGTGG + Intronic
1091835797 12:3584685-3584707 GTGCACTCACTGAAATTTGGTGG - Intronic
1097847431 12:64381084-64381106 ATAGTCTCCCTGAGAATTCGGGG + Intronic
1099116939 12:78638996-78639018 GAGTTGTTCCTGAAAATTGGTGG - Intergenic
1100223556 12:92533339-92533361 TCAGTCTCCCTGAAAATTCGGGG + Intergenic
1100537581 12:95525583-95525605 GTGGTCCCCAGGAAAAGTGGAGG - Intronic
1108484712 13:50911977-50911999 ATTGTATCCCTGAAAATTGTAGG + Intronic
1112771305 13:102798100-102798122 GATGTCTCCTTGAAAATTGAGGG + Intronic
1114772555 14:25444822-25444844 CTCCTCTCCCTGGAAATTGGAGG - Intergenic
1120248670 14:82035711-82035733 GTGGTGTCCCTGAATATTGGAGG + Intergenic
1126568282 15:50123615-50123637 TCAGTCTCCCTGAAAATTTGGGG - Intronic
1127724155 15:61731544-61731566 GTGTACTCCCTGATAATTTGGGG - Intergenic
1128145770 15:65331770-65331792 GAGGTCTCCCAGCAAGTTGGTGG + Intronic
1128604253 15:69024560-69024582 GTGGTCTCTCTGAAAATATGTGG - Intronic
1130240966 15:82190569-82190591 GTGGTCTCCATAAAAAAAGGAGG + Intronic
1137503548 16:49030207-49030229 ATGGTGTACCTGAAAAGTGGCGG + Intergenic
1139360915 16:66399483-66399505 GTGGGGTCCCTGAAAGTTGGAGG + Intronic
1139484237 16:67247144-67247166 GTGGGCGCCATGAAAACTGGTGG - Intronic
1143787675 17:9268253-9268275 GTGGGCACCATGAAGATTGGTGG + Intronic
1144423178 17:15116375-15116397 GAGGTCACACTGAAAATTGAAGG - Intergenic
1147250445 17:39150149-39150171 GTGGTCTCCCTGAAAATTGGTGG + Intronic
1148389519 17:47260996-47261018 GTCATCTACCTGAAAATTGCTGG - Intronic
1148563336 17:48618791-48618813 CTGCTCTCCCAGAAAACTGGTGG - Intronic
1158015677 18:52780722-52780744 GTGGTCTGCCTCACACTTGGAGG - Intronic
1158558100 18:58491654-58491676 TCAGTCTCCCTGAAAATTTGGGG - Intronic
1158694684 18:59693394-59693416 TTGGTCTCCCTGAGAGTGGGTGG + Intronic
1161590427 19:5126926-5126948 GTGGTGTCCTTGGAAATGGGTGG + Intronic
1163065938 19:14795409-14795431 TTAGTCTCCCTGAAAATCTGGGG + Intronic
926752287 2:16207657-16207679 TTAGTCTCCCTGAGAATTTGGGG + Intergenic
930313230 2:49768684-49768706 ATGGTCTCCCTGGAAAGGGGAGG - Intergenic
932429196 2:71663856-71663878 GAGGACTCCCGGTAAATTGGGGG - Intronic
933665737 2:84963461-84963483 GTGGTATCCCAGAAAATGAGAGG + Intergenic
934932580 2:98440127-98440149 ATTGTCTGCCTGAAAATTGAAGG - Intergenic
939079510 2:137642612-137642634 CTGGTCTGCATGTAAATTGGAGG + Exonic
944211527 2:197211129-197211151 GTGATCTCCCAGAATATTGAGGG - Intronic
947640893 2:231707461-231707483 GGGGACTACCTGAAATTTGGGGG - Intronic
948135930 2:235636326-235636348 GTGGTCATCCCAAAAATTGGGGG - Intronic
948259449 2:236592033-236592055 GTGGTCTCCCTGGATGTTAGTGG + Intergenic
1169685449 20:8266652-8266674 GAGGTCTTCCTGAAAGGTGGTGG - Intronic
1170127638 20:12983578-12983600 GTGCTTTCACTGAAAATTTGGGG + Intergenic
1170455232 20:16526595-16526617 GTGGCCTCACTGAAAATTCTAGG + Intronic
1173813493 20:45970702-45970724 GAGGTCTCCCAGTAAACTGGAGG + Intronic
1177842560 21:26250762-26250784 CTGGTCTCCCTGATCATTGTGGG + Intergenic
1179034541 21:37748151-37748173 GTGGTGTCCCTCAATAATGGTGG + Intronic
1179068635 21:38051156-38051178 GTGGTCTCCCTGAGATTGGGAGG + Intronic
1181162711 22:20967442-20967464 GTGGTCTCCCGGGAGAATGGAGG + Intronic
1181681692 22:24499883-24499905 GAGGTCTCCCTGCCAATTGCAGG + Intronic
1183036510 22:35144618-35144640 GAGGTCACCAGGAAAATTGGAGG + Intergenic
1183076393 22:35430045-35430067 TTGGTCACCCTAAAAATGGGGGG + Intergenic
949194342 3:1287517-1287539 TTGGTCTCCCTAAGAATTGGAGG + Intronic
950478099 3:13226845-13226867 GGGGTCTCCCTGAGATCTGGAGG - Intergenic
951113450 3:18832824-18832846 TTAGACTCCCTGAAAATTTGAGG + Intergenic
951825513 3:26864015-26864037 TTAGTCTCCTTGAATATTGGGGG - Intergenic
952568099 3:34682044-34682066 CTGGTCTCCATGAAAGTGGGAGG + Intergenic
955939869 3:64137578-64137600 GTGGTCTCCCTGACATTTTCTGG - Intronic
960570347 3:119179466-119179488 GTGGGCAACCTGAAAATTTGGGG + Intronic
960803388 3:121560564-121560586 GTCGTCTCCTTGAAGATTGGAGG + Intergenic
962494891 3:135929211-135929233 TTGTTCTCCCTGAAAATGGGAGG + Intergenic
963052195 3:141151832-141151854 GTGAGCTCCTTGAATATTGGTGG - Intergenic
965455129 3:168890026-168890048 GTGGTTTCTCTGAACATTGCGGG + Intergenic
966516088 3:180822129-180822151 TTGGTCTCCCTGGGAGTTGGTGG + Intronic
968649586 4:1755196-1755218 GTGGCTTCCCTGAAAGCTGGTGG - Intergenic
970370430 4:15400545-15400567 ATGGTCTCCTTGAATGTTGGAGG - Intronic
970719939 4:18974721-18974743 GTAGATTCCCAGAAAATTGGTGG + Intergenic
970920881 4:21393458-21393480 GTGGCCTTTCTGAAAATGGGTGG - Intronic
975862132 4:78688857-78688879 GGGGACTCCATGAGAATTGGAGG + Intergenic
978307914 4:107352245-107352267 TTAGTCTCCCTGAAAACTTGGGG - Intergenic
985542266 5:492522-492544 TTGGGCTCCCTGAAAAGTCGGGG - Intronic
985591337 5:766974-766996 GTGGTCTCCCTGACAGTGGGTGG - Intergenic
985639075 5:1054775-1054797 GTGTTCCTCCTGGAAATTGGTGG - Intronic
986325458 5:6670067-6670089 GTGCTCTCCCTGGAGAGTGGGGG - Intergenic
987869279 5:23592246-23592268 CTGATCTCCCTGAAAAATGGGGG + Intergenic
991961615 5:72050405-72050427 GTGATTTCCCTGAAAAATGAGGG + Intergenic
998108236 5:139481933-139481955 GTGGTCTCCCTGGGTCTTGGTGG - Intronic
1002069621 5:176671623-176671645 GTGGGCTCCCCGAAATGTGGGGG + Intergenic
1002912770 6:1503296-1503318 ATGGTCTCTGTGATAATTGGAGG + Intergenic
1005218795 6:23562611-23562633 TTATTCTCCCTGAAAATTTGGGG + Intergenic
1009823456 6:68835960-68835982 GTGGTCTCCTTGTAGAGTGGAGG - Intronic
1011803611 6:91046451-91046473 ATGGTGTCCCTGAAAATCGCTGG + Intergenic
1012313351 6:97755562-97755584 TTGTTCTCCCTGAAATTGGGTGG + Intergenic
1021015393 7:15525588-15525610 GAGATCTCCCTGAAAGTTGAAGG - Intronic
1021562429 7:21981762-21981784 GGGGTCTCACTGAATATTTGTGG + Intergenic
1022185196 7:27960625-27960647 GTGGTTGCCCTGACAATTGAGGG + Intronic
1029629181 7:101739796-101739818 CTTCTCTCCCTGAAAATTGCAGG - Intergenic
1035637440 8:1156997-1157019 CTGGCCTGCCTGAAACTTGGAGG - Intergenic
1036005922 8:4663439-4663461 GTAGTAACCCTGAATATTGGAGG + Intronic
1039006646 8:33045611-33045633 GTGGTCTCTCTGAAAATAGCAGG - Intergenic
1039013590 8:33122507-33122529 TTGGTCTCCCTGAAAATTTGGGG - Intergenic
1039382142 8:37095722-37095744 GTGGTTTCTCTGGAAATGGGCGG - Intergenic
1041786392 8:61638938-61638960 GTAGTGTGCCAGAAAATTGGAGG - Intronic
1044806794 8:96016682-96016704 GTGCCCTCCCTGGAGATTGGGGG - Intergenic
1045084803 8:98670856-98670878 GAGGTCTCACTGACAATTGAAGG - Intronic
1047085090 8:121507114-121507136 GTGGTAGCACTGAAAATTGGTGG + Intergenic
1052271113 9:26628859-26628881 GTGGTATCACTCAAAATAGGAGG + Intergenic
1057542577 9:95989257-95989279 GTTCCCTCCCTGAAAGTTGGGGG + Intronic
1058128570 9:101224269-101224291 GTGCTCTGCCAGAAAATAGGGGG + Intronic
1059250592 9:112884381-112884403 TTGCTCTCCCTGAAGATTGATGG + Intronic
1187304116 X:18079591-18079613 CAAGTCTCCCTGAAATTTGGAGG - Intergenic
1188836249 X:34958620-34958642 GTGGTCAACATGTAAATTGGGGG + Intergenic
1190477512 X:50842565-50842587 GCAGTCTCCCTGAACATTTGGGG + Intergenic
1193202791 X:78712054-78712076 CTGATATGCCTGAAAATTGGAGG + Intergenic
1194284317 X:91990819-91990841 GTGGCCTCCCTGAACTTTGGGGG + Intronic
1200601885 Y:5215378-5215400 GTGGCCTCCCTGAACTCTGGGGG + Intronic
1201547779 Y:15184816-15184838 TTAGTCTCCCTGATAATTTGGGG + Intergenic