ID: 1147251279

View in Genome Browser
Species Human (GRCh38)
Location 17:39153935-39153957
Sequence GAATTACTCACTTGGAAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 159}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147251279 Original CRISPR GAATTACTCACTTGGAAGCA GGG Intronic
904931538 1:34091137-34091159 GAAACAATCACTTGGAAGCATGG - Intronic
906906277 1:49896771-49896793 GGATTTCTCCCTGGGAAGCAAGG + Intronic
908315799 1:62931018-62931040 AAATTAATCATTTGGAAACAAGG - Intergenic
908894637 1:68884661-68884683 GAATTTCTCACATTGATGCAGGG + Intergenic
910015967 1:82524166-82524188 GAAATTCTCTCTTAGAAGCAAGG - Intergenic
911076580 1:93881322-93881344 CTAATACTCACTTGCAAGCATGG + Intergenic
911579719 1:99620818-99620840 GGATTAACCACTTGGAAGCGGGG + Intergenic
911618841 1:100043825-100043847 GAATTACTCACTTAGAATAATGG + Intronic
912335883 1:108862384-108862406 GATTTAATCCCTTGGAATCAGGG + Intronic
920785385 1:209035854-209035876 AAATTAATCACTTGGAGGCACGG - Intergenic
920995503 1:210987054-210987076 GATTCACTCACCTGGAAGAAAGG - Intronic
921165646 1:212504987-212505009 GAATAACTCACTTGTATGAATGG + Intergenic
923817408 1:237396303-237396325 GAGTTACTCACTTGAAATCAAGG - Intronic
1062903276 10:1161831-1161853 GAAATACTCGCATAGAAGCAAGG - Intergenic
1064029051 10:11871403-11871425 GTCTTGCTTACTTGGAAGCAGGG - Exonic
1066819143 10:39462700-39462722 AAATTACTCAATTGAAAGAAAGG + Intergenic
1067019234 10:42780914-42780936 GAAATACTCACTTGGAACAATGG + Intergenic
1067398490 10:45947948-45947970 GTCTTATTCACTTGGAATCAGGG + Intergenic
1067866803 10:49917031-49917053 GTCTTATTCACTTGGAATCAGGG + Intronic
1067950872 10:50737908-50737930 GAAATACTCATTTGGAACAATGG + Intergenic
1069278682 10:66625801-66625823 GAATTTCTCACCTGAAACCATGG - Intronic
1070900043 10:80020629-80020651 GAATTAATCAGTTGGAAAAAAGG + Intergenic
1070901846 10:80036871-80036893 GAATTAATCAGTTGGAAAAAAGG + Intergenic
1072642237 10:97220565-97220587 GTATTACTCACTGTGAAGAAAGG - Intronic
1076084635 10:127615533-127615555 GATTTTGTGACTTGGAAGCAAGG + Intergenic
1076312636 10:129519451-129519473 GGATTAATCATTTGGAAGCGGGG + Intronic
1078027934 11:7716350-7716372 GACTTTCTCACTTGGATGCCAGG + Intergenic
1079166122 11:18045140-18045162 GAATTAGTCTTTTGAAAGCATGG + Intergenic
1079233159 11:18667490-18667512 GAATTGCTCACTCGGGAGCTTGG + Intergenic
1081030123 11:38069705-38069727 GAAATAATCCCTTGGATGCAAGG - Intergenic
1081269520 11:41066288-41066310 GAATTAATCAAGTGGAAGAAAGG + Intronic
1082015407 11:47482391-47482413 GAATTTCTTTCTTGGAGGCAAGG + Intronic
1082077301 11:47984204-47984226 AAATTGCTCATTTGGAAGCCAGG - Intronic
1083862021 11:65425430-65425452 GAATTAGTCACTTGAAAGATGGG + Intergenic
1084893280 11:72247653-72247675 GAATTTCTTCCCTGGAAGCAAGG - Intergenic
1086739932 11:90354212-90354234 CAATTACTCACATGGAAAAAGGG + Intergenic
1087177743 11:95110668-95110690 GAATGACTGACTGGGAAGAATGG - Intronic
1087220059 11:95537124-95537146 AAATTTCTGAGTTGGAAGCAAGG - Intergenic
1088834148 11:113563148-113563170 GAATTACTCAGTTATAAGGAAGG - Intergenic
1089524511 11:119088162-119088184 GAATCACTGGCTTGGAAGAAAGG - Intronic
1093060962 12:14603386-14603408 GATTATGTCACTTGGAAGCAGGG + Intergenic
1097374008 12:58819000-58819022 GAAGTTCTCACTTTGAACCATGG - Intergenic
1099519318 12:83641175-83641197 GAAATACTCAATTGGAGTCATGG - Intergenic
1100474526 12:94923271-94923293 TAAATTCTCACTTCGAAGCATGG + Intronic
1101615993 12:106337708-106337730 GACTTCCTCACTTGTAAGAAGGG + Intronic
1105316620 13:19271202-19271224 GAATCAATCAAGTGGAAGCAAGG + Intergenic
1105534505 13:21252021-21252043 GAATTTCTCCCTGGGATGCAAGG + Intergenic
1106975013 13:35200700-35200722 TAATTAAACACTGGGAAGCAAGG - Intronic
1109868524 13:68300162-68300184 GAATTACACACCTGGATTCAAGG - Intergenic
1110722870 13:78785254-78785276 GAATTTATCACTTGGAATCATGG - Intergenic
1111456980 13:88497058-88497080 GAATTATGAAGTTGGAAGCATGG - Intergenic
1112606639 13:100912780-100912802 GAATATTTCACTTGGAAGCAGGG + Intergenic
1114276433 14:21149895-21149917 GAATTAGTCACTTGGAAGTTGGG - Intergenic
1117834637 14:59790884-59790906 GAAATAATGACTTGGAAGAAAGG - Intronic
1117921818 14:60732772-60732794 AAACTACTAACTTGGAAGCATGG - Intergenic
1118825476 14:69376409-69376431 GAATTACTATCTTGGAGGAAAGG - Intergenic
1120741598 14:88114871-88114893 GAAATACTGACTTGAAAGAAGGG - Intergenic
1121321828 14:92996009-92996031 GACCTGCTCTCTTGGAAGCATGG - Intronic
1126924989 15:53574928-53574950 GATTTCCTCACTTGGAAGTGAGG - Intronic
1127373880 15:58364276-58364298 GAATTGATCACGTGGAAGAAAGG + Intronic
1128539094 15:68512513-68512535 AAATTACTCTCTTGGATGCCTGG + Intergenic
1129090860 15:73148928-73148950 GAACTACTCAGATGGAAGCAGGG + Intronic
1129552004 15:76462228-76462250 GGAATAGTCACTTGGAAGAAAGG - Intronic
1134028144 16:10970351-10970373 GAAGTACTCAGTGGGATGCAGGG - Intronic
1135800716 16:25492518-25492540 GTCTTACTGACTTGGAAGAAGGG - Intergenic
1140230489 16:73113518-73113540 TAATTACTCACATTAAAGCAAGG - Intergenic
1141840877 16:86573321-86573343 GAAGTGCTCACTGGGAGGCAAGG - Intergenic
1144201972 17:12949719-12949741 GGGGTACTCACTTGGAAGCCTGG - Exonic
1147251279 17:39153935-39153957 GAATTACTCACTTGGAAGCAGGG + Intronic
1152030933 17:77842571-77842593 GACTCACTCACTTGCAGGCAGGG - Intergenic
1153353029 18:4102903-4102925 GAATTCCCCACTAGGAAACATGG - Intronic
1155249194 18:23939118-23939140 GAATTCCTCACTTAGGATCAAGG + Intronic
1155488352 18:26371843-26371865 GAATTTCTCACTGTGAGGCAGGG - Intronic
1157993952 18:52532623-52532645 GAATTACTCATTTGAAAAAAGGG - Intronic
1158412745 18:57222165-57222187 GTATTAGACCCTTGGAAGCAGGG + Intergenic
1158859090 18:61574643-61574665 GAATAGCTCACTTGGAGACAAGG - Intergenic
1159753412 18:72331765-72331787 GAGTTACTCTTTTTGAAGCAGGG + Intergenic
1159935206 18:74360287-74360309 TATTGGCTCACTTGGAAGCATGG + Intergenic
1160565670 18:79785401-79785423 GAATTACTCAGCTTGAAGAAAGG + Intergenic
1161898929 19:7103319-7103341 CAATTACTCACTTTGAACAAGGG + Intergenic
925764477 2:7217749-7217771 CAATTATTGACTAGGAAGCAGGG - Intergenic
926979874 2:18557698-18557720 GAAATACTTACTTAGAAGCAAGG + Intronic
927253652 2:21020628-21020650 TAAGTACACACTTGGAAGGAAGG - Intronic
928690377 2:33792679-33792701 GCATTACCACCTTGGAAGCATGG + Intergenic
930318999 2:49830903-49830925 TTCTTACTGACTTGGAAGCAAGG + Intergenic
933332824 2:80916468-80916490 GAATTTATCACTGGGATGCAAGG - Intergenic
937753317 2:125504639-125504661 GAATTTATCACTAGGATGCAAGG - Intergenic
937860042 2:126700728-126700750 GAATTGCTCACTTAAAAGCAGGG - Intergenic
939529500 2:143339572-143339594 GAATTACTCTATTGGCAGCGAGG + Intronic
941454139 2:165695455-165695477 CAATTACGTACTTGGAACCAGGG + Intergenic
947142546 2:227032641-227032663 GAATTTCACACTGGGAAGGAAGG + Intronic
949011004 2:241678417-241678439 GAATTGCACACTAGGAAGCGTGG - Intronic
1171161019 20:22923627-22923649 GACTCAATCTCTTGGAAGCATGG + Intergenic
1175567652 20:59993531-59993553 GAGTTATTCACTTAGAAGAATGG + Intronic
1177639829 21:23832784-23832806 GAATTAATCACTTGGTGGCTTGG - Intergenic
1177749269 21:25259696-25259718 GAATTACAGCCTTGGAAACAGGG - Intergenic
1182903479 22:33918596-33918618 GAATTACTCACTGGCACGCTTGG - Intronic
949399093 3:3646866-3646888 GAATTGCTCACTCGGGAGCTCGG + Intergenic
952534568 3:34296164-34296186 GATTGTCTCACTTTGAAGCAGGG + Intergenic
957440130 3:80234741-80234763 GCTTTACTCATTTGGAAGCCTGG - Intergenic
960290795 3:115881987-115882009 TCATTAATCACTTGGGAGCAGGG - Intronic
964648943 3:158990353-158990375 GAATTAATCAAGTGGAAGAAAGG - Intronic
966468496 3:180260272-180260294 GAATTTATCACTGGGATGCAAGG + Intergenic
969998506 4:11339924-11339946 GCAATAGGCACTTGGAAGCAAGG - Intergenic
970737075 4:19184513-19184535 CAATTACTCACTAGATAGCAGGG + Intergenic
970740530 4:19232295-19232317 GAAAAACTCACTTGGCAACATGG - Intergenic
972402828 4:38720906-38720928 GAACTGGTCACTTGGAAGCTGGG + Intergenic
974574593 4:63701652-63701674 GAAGTACTCACTTTGGACCACGG + Intergenic
976466554 4:85376080-85376102 GCATTACACACTTGTAAGAATGG - Intergenic
976639950 4:87327786-87327808 GAAGTTCTGTCTTGGAAGCAGGG + Intergenic
976779691 4:88745406-88745428 AAAATACTCAATTGGCAGCAAGG + Intronic
978630935 4:110743358-110743380 GACTTAGGCACTTGGAAGCTAGG + Intergenic
978876273 4:113643735-113643757 GAAATAAGCACTTGGAATCAAGG - Intronic
978948851 4:114531996-114532018 GAATTTATCCCTGGGAAGCAAGG + Intergenic
983898440 4:173106117-173106139 GAATTGCTCACTCGGGAGCTCGG + Intergenic
984503020 4:180580212-180580234 GAATTACTGATTTAGAGGCATGG + Intergenic
985295753 4:188435609-188435631 CAATGACTGAATTGGAAGCAGGG + Intergenic
986367008 5:7042587-7042609 GAATTGCTCACTGGGGAGCTCGG - Intergenic
989357343 5:40559378-40559400 AAATTACTTACTTGGAAACATGG - Intergenic
991606227 5:68404074-68404096 GATTTACTAACGTGGAAACAGGG + Intergenic
992182609 5:74212935-74212957 TAATTACTCACATTGAAACATGG + Intergenic
992655878 5:78909083-78909105 GGAATACTGAATTGGAAGCATGG + Intronic
994990194 5:106986580-106986602 GAATAACTAACCTGGAATCATGG - Intergenic
998718438 5:144912834-144912856 GAATAACTCAATAGTAAGCATGG - Intergenic
999706579 5:154278129-154278151 GACATACTAACTTGGAAGGAGGG - Intronic
1000878296 5:166667610-166667632 GAATCATTCACTTAGAAGAATGG + Intergenic
1003271531 6:4611829-4611851 GAATTGCTCTCTTGGGAGCACGG - Intergenic
1003553762 6:7121989-7122011 GCATGCCTCACTTGGATGCATGG + Intronic
1005241691 6:23837523-23837545 GAATTGCTCACTCGGGAGCTCGG + Intergenic
1007783861 6:44269334-44269356 CAATTACTCACAGGGAACCAAGG - Intergenic
1008930091 6:56930303-56930325 GAATTAATGACTTCGAAGAAGGG + Intronic
1014014664 6:116516561-116516583 AAAATACTCCCCTGGAAGCAGGG + Exonic
1014424081 6:121281663-121281685 GAATTACTCTCCTGCAAGTATGG - Exonic
1016437244 6:144049540-144049562 GACCTTCTCACATGGAAGCAGGG + Intronic
1017267946 6:152473154-152473176 CAATTTCTCACATAGAAGCAAGG + Intronic
1017571563 6:155749966-155749988 GAATCAATCACGTGGAAGAAAGG + Intergenic
1018323628 6:162639790-162639812 TAATTATTCACATGGATGCAAGG + Intronic
1018522097 6:164661240-164661262 AAATTACTCACCTGGAAGAGAGG - Intergenic
1019843463 7:3473606-3473628 GAATAAAGCACATGGAAGCAAGG - Intronic
1021404923 7:20254152-20254174 GCTTGACTCACTTGGAAACAGGG - Intergenic
1024153112 7:46592321-46592343 GAATTAATCAAGTGGAAGAAAGG + Intergenic
1026082897 7:67237992-67238014 GAATTAGTCACATGGTAACATGG + Intronic
1026694161 7:72576014-72576036 GAATTAGTCACATGGTAACACGG - Intronic
1030067752 7:105673471-105673493 GGCTTACTCACTTGACAGCATGG + Intronic
1031637332 7:124117712-124117734 GTATGAATCACTAGGAAGCATGG - Intergenic
1031715565 7:125104984-125105006 AAATAACTCTCTTTGAAGCAAGG + Intergenic
1032010140 7:128340843-128340865 AAATTACTTACTTGGAAAGAAGG - Intronic
1033396071 7:140975016-140975038 AAATTACTCACTTAGAAACTTGG - Intergenic
1033780863 7:144667540-144667562 GAATTACTCTCATGGTAACAGGG - Intronic
1034824590 7:154250178-154250200 GAATTGCTCACTCGGGAGCTTGG + Intronic
1036506421 8:9360540-9360562 GAATTACTCTGTTGAAAACATGG - Intergenic
1039244765 8:35596691-35596713 GGATAACTCCCCTGGAAGCAGGG + Intronic
1044549100 8:93492600-93492622 AAATTATTCATTTGGCAGCAGGG - Intergenic
1044842170 8:96345808-96345830 GAATCACTCACTTGGCCACAGGG + Intergenic
1045314019 8:101027750-101027772 GTCTTTCTCCCTTGGAAGCATGG + Intergenic
1046876414 8:119259580-119259602 GAAAGCCTAACTTGGAAGCAAGG + Intergenic
1047722876 8:127658119-127658141 GAGTTACTCACTTAGAATAAGGG + Intergenic
1048545145 8:135379709-135379731 CAATTATACACTTGGAAGCCAGG + Intergenic
1048741550 8:137566435-137566457 AAATTACTTAATTTGAAGCATGG - Intergenic
1052532869 9:29709910-29709932 GAGTTACTCACTTAGAATAATGG + Intergenic
1055717996 9:79139794-79139816 CAATTACTCTCATGGAAGGAAGG + Intergenic
1057016455 9:91656919-91656941 GCATCACTCACCTGGATGCAGGG + Intronic
1057940468 9:99278293-99278315 AAATTACTCTCTTGATAGCAAGG - Intergenic
1059214916 9:112552649-112552671 GGATTACTCACTTAAAAACAAGG + Intronic
1190254003 X:48748814-48748836 GAACCACAGACTTGGAAGCAAGG - Intergenic
1193313233 X:80033046-80033068 GAGTCACTTACTTAGAAGCAGGG - Intergenic
1193642758 X:84031930-84031952 GGATTAGTCACTGGGATGCATGG + Intergenic
1197026948 X:121763125-121763147 GAATTTATCACTGGGATGCAAGG + Intergenic
1197524565 X:127545819-127545841 CAATTACTCAATTGGAAAAAAGG + Intergenic
1199017524 X:142836065-142836087 GAATTACTCTTTTTAAAGCAGGG - Intergenic
1199026732 X:142948048-142948070 GAATTTCTCACTTCAGAGCAAGG + Intergenic
1199333943 X:146596519-146596541 GAATTAATCCCTGGGATGCAAGG - Intergenic
1199652328 X:149958726-149958748 GAGTTACTCACTTAGAATAATGG + Intergenic
1199830845 X:151547471-151547493 GAATTGATCACGTGGAAGAAAGG + Intergenic