ID: 1147253376

View in Genome Browser
Species Human (GRCh38)
Location 17:39166603-39166625
Sequence CTTTCTTTGCTTAAGCTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 219}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147253371_1147253376 -2 Left 1147253371 17:39166582-39166604 CCTGCTGTTGCTTGTGAATTTCT 0: 1
1: 0
2: 1
3: 11
4: 226
Right 1147253376 17:39166603-39166625 CTTTCTTTGCTTAAGCTGGGGGG 0: 1
1: 0
2: 1
3: 21
4: 219
1147253369_1147253376 26 Left 1147253369 17:39166554-39166576 CCTGAGGAGGGAATGGAAGGTGG 0: 1
1: 1
2: 2
3: 36
4: 384
Right 1147253376 17:39166603-39166625 CTTTCTTTGCTTAAGCTGGGGGG 0: 1
1: 0
2: 1
3: 21
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147253376 Original CRISPR CTTTCTTTGCTTAAGCTGGG GGG Intronic
901295626 1:8158839-8158861 CCTTCTTTCCTTATCCTGGGTGG - Intergenic
903033948 1:20482360-20482382 TTTTCTCTGCTTTGGCTGGGGGG - Intergenic
909696421 1:78473324-78473346 ATTTCATTGCTTATGCTGGGAGG + Intronic
911489575 1:98546816-98546838 CTTTCTTGCCTTAGGCAGGGTGG - Intergenic
913064223 1:115235209-115235231 CTTTCTTTGATTAATCTCAGGGG + Intergenic
914333166 1:146691183-146691205 CTTTCTGAGCTGAAGTTGGGTGG - Intergenic
914678393 1:149921314-149921336 TTTTCTTTTTTTAAGGTGGGAGG + Intergenic
918530055 1:185509387-185509409 CTTTCTTAGCTAATACTGGGTGG - Intergenic
923236238 1:232035975-232035997 TTTTCTTTTCTTAAGCTGTTGGG - Intronic
1062976481 10:1687364-1687386 CTTCCTTTACTTAGGCAGGGAGG - Intronic
1065377039 10:25053873-25053895 GTTTACTTTCTTAAGCTGGGTGG - Intronic
1066789995 10:39051675-39051697 CTTTCTTTGATTCAGCAGGTTGG + Intergenic
1066791004 10:39063461-39063483 CTTTCTTTGATTCAGCAGGTTGG - Intergenic
1066794497 10:39104315-39104337 CTTTTTTTGATTAAGCAGGTTGG + Intergenic
1066795670 10:39117608-39117630 CTTTCTTTGATTCAGCAGGTTGG + Intergenic
1066796606 10:39128788-39128810 CTTTCTTTTCTTCAGCAGGTTGG + Intergenic
1066931424 10:41764964-41764986 CTTTCTTTGATTAAGCAGTTTGG + Intergenic
1068429399 10:56912309-56912331 CTTTCTGTGGTTACGGTGGGAGG + Intergenic
1068775245 10:60861932-60861954 CTTTCCTTGCTGCAGCTGGCAGG + Intergenic
1069725463 10:70574844-70574866 CCCTCTTTGCTTAAGCTAGCTGG - Intergenic
1074470599 10:113723169-113723191 CTTTTTTTGTTTTAGCTGTGAGG - Intronic
1075988237 10:126807320-126807342 CTTGCTTTGATTAAGCTGGCTGG - Intergenic
1079338124 11:19589275-19589297 CTGCCTCTGGTTAAGCTGGGAGG - Intronic
1080346283 11:31329357-31329379 CTTTCTTTGCTTAAGCTAGTTGG + Intronic
1080491830 11:32773246-32773268 CTGTATTTGCTTAGGTTGGGGGG + Intronic
1080586716 11:33689380-33689402 CTCTCTTTACTTAAGCCAGGAGG - Intergenic
1080943106 11:36941297-36941319 GTTTCTTTGCTTCTGCTGGGAGG - Intergenic
1081850338 11:46271318-46271340 CTTTCTTTACTTGAGCTGTGAGG - Intergenic
1088511454 11:110579891-110579913 CCTTCTTTGTATAGGCTGGGCGG + Exonic
1089177946 11:116561754-116561776 CTTTCTTTGCAAAGGCTGGTTGG - Intergenic
1089707418 11:120289699-120289721 CTTTCTTTGCTTTTGCTGCCTGG + Intronic
1089925578 11:122254116-122254138 TTTCCTTGGCTTAAGCTTGGAGG - Intergenic
1090524928 11:127522916-127522938 CTTTCTTTGTTTTGGATGGGAGG - Intergenic
1091512260 12:1139739-1139761 AAATCATTGCTTAAGCTGGGAGG + Intronic
1092658947 12:10718426-10718448 CTTGCTTTGCTTTTGCTGGGAGG - Intronic
1093365507 12:18291877-18291899 TTTTTTTTGCTTAAGCTAGCAGG - Intronic
1093810102 12:23482118-23482140 CTTTTTTTGCTTAAGCTGTTGGG - Intergenic
1093990921 12:25589521-25589543 GTTTTGTTTCTTAAGCTGGGTGG + Intronic
1094827440 12:34281192-34281214 CTTTCTTTGATTCAGCAGGTTGG - Intergenic
1094883607 12:34834640-34834662 CTTTCTTTTCTTAAGCAGTTTGG - Intergenic
1095029513 12:37251355-37251377 CTTTCTTTTCTTAAGCAGTTTGG - Intergenic
1095057569 12:37632225-37632247 CTTTCTTTGATTGAGCTGTTTGG - Intergenic
1095067643 12:37799986-37800008 CTTTATTTGATTAAGCTGATTGG + Intergenic
1095603016 12:44036299-44036321 CATTAGTTGCTTAAGCTGAGTGG - Intronic
1098228515 12:68349264-68349286 GTTTCTCTGCTTAATCTGGCAGG - Intergenic
1099326003 12:81215151-81215173 CTTGCTTTGATTATGCTGTGGGG + Intronic
1101035873 12:100705839-100705861 CTTTCTTTTCTGAGGGTGGGAGG + Intergenic
1104605620 12:130185416-130185438 CATTCCTCGGTTAAGCTGGGTGG + Intergenic
1106339779 13:28817735-28817757 CTTTCTTTGCATGAAGTGGGTGG - Intergenic
1106574910 13:30965779-30965801 TTTTATTTGCTTAATCTGGCAGG - Intronic
1108237491 13:48423234-48423256 CTTTCACTGCTTAAGCTGCTGGG + Intronic
1109559901 13:64033115-64033137 CTTTCTTGGCTTTTGCTGGTAGG - Intergenic
1110371552 13:74746778-74746800 CTCTCTTAGCTTAAGGTGGATGG - Intergenic
1111688961 13:91537124-91537146 CTTGTTTTTCTTAAGGTGGGAGG - Intronic
1114716984 14:24837350-24837372 CTTTCTTTACTTAAGTTCGGGGG + Intronic
1114727475 14:24954292-24954314 ATTGCTTTGCCTAAGGTGGGAGG + Intronic
1115193250 14:30769529-30769551 CTTTCCTTGTTTAAGATGGCAGG + Intergenic
1117230629 14:53714068-53714090 CACTGTTTACTTAAGCTGGGTGG - Intergenic
1117315274 14:54566529-54566551 CTTTCTTTGCTGTCGTTGGGGGG + Intergenic
1118206042 14:63724560-63724582 CTTCCTTTGCTTCAGCTGTTTGG - Intronic
1118397333 14:65348759-65348781 CCTTCTTTGCCTAAGCTAGTTGG - Intergenic
1119723957 14:76910602-76910624 CTCTTTTTGCTTAAGCTAGTTGG + Intergenic
1120085347 14:80265919-80265941 ATTTCTTTTCTTAAGCTTAGTGG + Intronic
1126850425 15:52793564-52793586 TTTTCTTTGCTGAACCTGGTAGG - Intergenic
1128916714 15:71569648-71569670 CTTTCTTTGCTTTGGCTGCTAGG - Intronic
1129531386 15:76268175-76268197 TTTTTTTTGCTGTAGCTGGGAGG - Intronic
1129720459 15:77875210-77875232 CTTGCTTTGCTGCTGCTGGGTGG - Intergenic
1131561676 15:93449024-93449046 GTTTATTTTCTTAAACTGGGAGG + Intergenic
1131641945 15:94302350-94302372 CTTTCTTTGCTGATGCTGGTGGG - Intronic
1131723483 15:95197105-95197127 CTTTGTTTGCAAATGCTGGGAGG - Intergenic
1136915037 16:34181108-34181130 CTTTCTTTGATTGAGCAGGTTGG + Intergenic
1137074148 16:35940865-35940887 TTTTCTTTGATTAAGCTTGTTGG - Intergenic
1137076591 16:35972544-35972566 CTTTCTTTGATTGAGCAGGATGG - Intergenic
1137320961 16:47381576-47381598 GTTTCTATGCTCAAGCTAGGAGG + Intronic
1137359824 16:47804051-47804073 CCATCTTTGCTTAAGCTGCTTGG - Intergenic
1139660534 16:68417629-68417651 CTTTCTTTGCTTTGGCTGCTAGG + Intronic
1140000455 16:71020071-71020093 CTTTCTGAGCTGAAGTTGGGTGG + Intronic
1140809843 16:78566553-78566575 CTGTCTGTGCTGAGGCTGGGAGG + Intronic
1140976647 16:80065954-80065976 CTTTCTTTGCCTTAGCTGCCAGG + Intergenic
1143928488 17:10395091-10395113 CTTTCCCTGCTTCATCTGGGAGG + Intronic
1144061192 17:11584072-11584094 CTCTCTTTTCTTGAGCTGGTGGG - Intergenic
1145004170 17:19328136-19328158 GTTTTATTGCTTAAGTTGGGTGG + Intronic
1146226187 17:31068408-31068430 CTTTCCTGGCTGAAGCTGAGTGG + Intergenic
1146294523 17:31639263-31639285 GTTTCTTTGGTTAAGCTCTGGGG - Intergenic
1147253376 17:39166603-39166625 CTTTCTTTGCTTAAGCTGGGGGG + Intronic
1147404705 17:40202743-40202765 TTTTCATTTCCTAAGCTGGGAGG - Intergenic
1147520306 17:41165582-41165604 AATTCTTTGTATAAGCTGGGGGG - Intergenic
1148379356 17:47182385-47182407 ATTTTATTTCTTAAGCTGGGTGG - Intronic
1149264619 17:54913956-54913978 ATCTTTTTGCTTAAGCTGGGTGG - Intronic
1150582057 17:66483208-66483230 CTTTCGTTGTTTAAGCTGCCCGG - Intronic
1155286795 18:24297204-24297226 TTTTCCTGGCTTAATCTGGGAGG + Intronic
1156827230 18:41445692-41445714 TGTTCTGTGCTTTAGCTGGGTGG - Intergenic
1164328750 19:24230396-24230418 CTTTCTTTGATTAAGCAGTTTGG - Intergenic
1166456224 19:42942186-42942208 CTTTCTCTGCTTCAGCTGCCAGG - Intronic
1166697074 19:44858151-44858173 TTTTCTTTTCTCAAGTTGGGTGG + Intronic
1166698115 19:44865735-44865757 CTCTCTTGGCTTCAGCTGTGAGG + Intronic
1168651711 19:58096385-58096407 CTTCATTTGCTGAGGCTGGGGGG - Intronic
925536871 2:4927287-4927309 ATTTCTTTCCTGAAGCTAGGTGG - Intergenic
926891893 2:17645542-17645564 CTTTCTGTGCCCACGCTGGGTGG + Intronic
927172182 2:20379408-20379430 CTGGCTTTGCTGAAGCTTGGAGG + Intergenic
927703954 2:25285752-25285774 CCCTCTTTGCTTAAGCAGGGAGG - Intronic
930010608 2:46935399-46935421 TTTTTTTTGCTTAAGCTCAGTGG - Intronic
930167571 2:48218309-48218331 CTTTGTTGGCTTAAGCTTGTGGG + Intergenic
931239550 2:60439801-60439823 CTTTCCTGGCTTAGGCTGGGAGG - Intergenic
932261401 2:70330673-70330695 TTTTTTTTGCTTCAGCTGGGAGG - Intergenic
933813920 2:86050822-86050844 CTTTCTTTGGTTATCCTGGAAGG + Intronic
936119833 2:109731789-109731811 GTTTCATTTCTTAAGCTGGAGGG + Intergenic
937487019 2:122325819-122325841 CTTTCTTTAAATAATCTGGGAGG + Intergenic
940833171 2:158491308-158491330 CTTACTTTGCCTGAGCTGTGCGG + Intronic
941484731 2:166066056-166066078 GTTCCTATGCTTTAGCTGGGTGG + Intronic
941511043 2:166410317-166410339 CTTTCCTTTCTTTACCTGGGAGG - Exonic
942353371 2:175078558-175078580 CTTTCAGTGCTAAAACTGGGCGG + Intronic
943332281 2:186573973-186573995 TTTTCTTTGCTTAAGCTCAGTGG - Intergenic
945684872 2:212957112-212957134 CTTCCTTTCCTTATGGTGGGTGG + Intergenic
945993612 2:216417074-216417096 TTTTCCTTTCTTAAGCTAGGGGG - Intronic
948866121 2:240775724-240775746 CTTTCTGGGCTGAGGCTGGGAGG - Intronic
1169016172 20:2294350-2294372 CTGTGTTTGCTTAACCTTGGAGG - Intergenic
1170111736 20:12811683-12811705 TTTTCTTTGTTGAAGCGGGGTGG - Intergenic
1170891998 20:20383829-20383851 TTTTCTTTTCTTAAGCTGTTGGG + Intergenic
1170895532 20:20409586-20409608 ATTTCTTAGTTTAAGCTGGCTGG + Intronic
1171734900 20:28766908-28766930 TTTTCTTTGATTGAGCTGGTTGG - Intergenic
1173142345 20:40495204-40495226 CTTTCTCTGGTGAAGCTTGGGGG - Intergenic
1173417949 20:42874920-42874942 CTTTCGTTGCTCAGGCTGGAGGG + Intronic
1176320345 21:5311923-5311945 CTTTCTTTGATTGAGCAGGTTGG + Intergenic
1176759019 21:10756093-10756115 CTTTCTTTGATTGAGCTGCTTGG - Intergenic
1184614344 22:45627835-45627857 CGGTCTTTGCTTATGCTGGGTGG + Intergenic
950415941 3:12869121-12869143 CTCTCTTTGCCCAGGCTGGGCGG + Intronic
950417389 3:12876236-12876258 CTCTCTTTGCCCAGGCTGGGCGG + Intergenic
950876745 3:16282357-16282379 TTTTTTTTTTTTAAGCTGGGTGG - Intronic
951644955 3:24879495-24879517 TTTTTTTTTCTTAACCTGGGAGG + Intergenic
952797303 3:37252219-37252241 GTTCCTTTGCTTGACCTGGGAGG - Intronic
953512783 3:43559730-43559752 CTTTCCTTGCCTATGCTTGGGGG - Intronic
954130375 3:48557504-48557526 CTTTCTTTGCTTTGGCTGCTGGG + Intronic
955586742 3:60486521-60486543 CTTTCTTTGCCTAACCTGTCAGG - Intronic
956962724 3:74421496-74421518 CTTTCTTTGCTTACTCTGTTAGG + Intronic
957404604 3:79761473-79761495 CTTTTATTACTTAACCTGGGTGG + Intronic
958679599 3:97310655-97310677 CTTACTATGTTTAAGCTGGAAGG - Intronic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
962490718 3:135891419-135891441 CTTTATTTGTTTAAGGTTGGTGG - Intergenic
964362396 3:155912353-155912375 TTTTCTCTGTTTAAGCTAGGGGG + Intronic
965602562 3:170469484-170469506 CTTTCTTTTCTGTAGGTGGGGGG + Intronic
967731371 3:192909990-192910012 CTTTCTTTGCTTAGGCTCTTAGG - Intronic
967804159 3:193699771-193699793 TTTTCTTTGCTTCAGCTGCCAGG + Intergenic
970328707 4:14956404-14956426 CTTTCTTTGCTTTGGCTGCCAGG - Intergenic
971993582 4:33933794-33933816 CTTTCTTTGCTTAATCTCTGTGG - Intergenic
972353035 4:38254906-38254928 TTTTCTTTGCTAAAGAAGGGAGG + Intergenic
974282288 4:59813095-59813117 TTTTCATTTCTTAAGCTGGCTGG + Intergenic
975134200 4:70858287-70858309 CATTCTTTCCTAAAGATGGGAGG - Intergenic
975961141 4:79906941-79906963 CTTTATTTGCTTAGCCTGGTGGG + Intronic
977910395 4:102528006-102528028 CTTTCTTGGCTTGAGCTTGGTGG + Intronic
977919084 4:102624187-102624209 CAGGCTTTGCTTCAGCTGGGAGG - Intergenic
978552304 4:109940241-109940263 TTTTATTTGCTAAATCTGGGTGG - Intronic
982080156 4:151781747-151781769 CTTTGTTTGCTGAGGCTGGAGGG + Intergenic
983177635 4:164610199-164610221 CTTTCTTTTCATAAGATGGAGGG + Intergenic
985835554 5:2269569-2269591 CCTCCTGTGCCTAAGCTGGGTGG + Intergenic
986584899 5:9305505-9305527 CCATCATTGCTTAATCTGGGTGG + Intronic
988555729 5:32234334-32234356 CAGGCTTTGCTTGAGCTGGGAGG - Intronic
988601145 5:32640542-32640564 TTTTCTTTCCTTATGCTGGAGGG + Intergenic
989271826 5:39542622-39542644 CTTTCTTCACTTATGCTGAGTGG - Intergenic
989637470 5:43551860-43551882 CTTTTTTTGCTTAAAATGGCAGG - Intronic
990622176 5:57571550-57571572 CTTGCTTTGCTGAGGCTGGGTGG + Intergenic
991146086 5:63306110-63306132 CTTTCTGGGATTAAGCTTGGAGG + Intergenic
992968683 5:82031968-82031990 CTCTCTTTGCCTACGCTGGCAGG + Intronic
994454816 5:99992181-99992203 TATTATTGGCTTAAGCTGGGCGG - Intergenic
996077444 5:119213630-119213652 GTTTTATTTCTTAAGCTGGGTGG - Intronic
996386739 5:122916763-122916785 CTTTCTTTACATAAGCTGCTTGG + Intronic
998034521 5:138903292-138903314 GTTTATGTGCTTAAGTTGGGCGG + Intronic
1000681867 5:164194986-164195008 GTTTCTTTGCATAAGATGGTGGG + Intergenic
1001989475 5:176104482-176104504 CTCTCCTTGCTCAAGATGGGTGG - Intronic
1002444381 5:179280187-179280209 CTTTTTTGGCCTAAGCTGGCCGG + Intronic
1003843289 6:10145445-10145467 TTTTGTTTTTTTAAGCTGGGTGG + Intronic
1006902210 6:37510527-37510549 GTTTTCTTTCTTAAGCTGGGTGG + Intergenic
1008428604 6:51388422-51388444 CTGTCTTTGTTTAAGCAGTGGGG + Intergenic
1009176595 6:60467502-60467524 CTTTCTTTCCTTTAGTTGGGGGG - Intergenic
1010731763 6:79398723-79398745 CATTGGTTGCTTAAGCTGGATGG + Intergenic
1011758224 6:90527718-90527740 GTTCCATTCCTTAAGCTGGGTGG + Intronic
1011845264 6:91555141-91555163 TTTTGTTTGCTTCAGCTGAGAGG - Intergenic
1015627604 6:135197046-135197068 CTCTCTTTGCTGAAGCTGTAGGG - Exonic
1018926763 6:168212288-168212310 GTTGTTTTTCTTAAGCTGGGTGG + Intergenic
1021281852 7:18729414-18729436 CTTTCCTTGGTTAAGAGGGGTGG + Intronic
1022329214 7:29361657-29361679 TTTTCTTTGCTAAAGCTCAGAGG + Intronic
1022356942 7:29624781-29624803 ATTTATTTTCTTGAGCTGGGGGG + Intergenic
1022910151 7:34893010-34893032 TGTTCATTGCTGAAGCTGGGTGG + Intergenic
1024084355 7:45881277-45881299 CTATCATTGCTGCAGCTGGGTGG - Intergenic
1024304753 7:47919307-47919329 CTTTCCTGACTTAAGCTAGGAGG - Intronic
1025522040 7:61747598-61747620 CTTTCTTTGATTGAGCTGTCTGG - Intergenic
1025545769 7:62165714-62165736 CTTTCTTTGATTGAGCTGTCTGG - Intergenic
1026021566 7:66711414-66711436 TTTTTTTTGCATAAGCTGTGAGG + Intronic
1026298255 7:69075022-69075044 ACTTCCTTTCTTAAGCTGGGTGG - Intergenic
1028004782 7:85551032-85551054 CTTTCTTTCCTTTACCTGGTTGG - Intergenic
1030855331 7:114548995-114549017 CTTACTTCACTAAAGCTGGGAGG - Intronic
1031165966 7:118227344-118227366 CTCTCTTGGGTAAAGCTGGGAGG + Intronic
1033114811 7:138615823-138615845 TTTTCCTTTCTTAAACTGGGTGG - Intronic
1033294325 7:140116574-140116596 CTGTTTTTGCTTAATTTGGGTGG + Intronic
1034237975 7:149587418-149587440 CTTGCTTTGTTTAAACTGGTAGG + Intergenic
1036738759 8:11342704-11342726 CTTTCATTGCTTCTGCTGGAAGG + Intergenic
1036765114 8:11544890-11544912 CTTTCTTGTCTGAAGTTGGGAGG - Intronic
1040115056 8:43607824-43607846 CTTTCTTTTTTTAAGCAGGTGGG + Intergenic
1040115214 8:43609699-43609721 CTTTCTTTGATTCAGCAGGTTGG + Intergenic
1040117745 8:43643742-43643764 CTTTCTTTGATTCAGCAGGTCGG + Intergenic
1040128736 8:43769426-43769448 CTTTCTTTGATTCAGTTGGTTGG + Intergenic
1040133646 8:43827143-43827165 CTTTCTTTGATTAAGCAGGTTGG + Intergenic
1040137736 8:43874900-43874922 CTTTCTTTGATTCAGCAGGTTGG + Intergenic
1040320410 8:46292246-46292268 CTTTCTTTGATTCAGCAGGTTGG - Intergenic
1040326534 8:46345552-46345574 CTTTCTTTGATTCAGCTGGTTGG + Intergenic
1041545616 8:59039205-59039227 CATTCTTTGCTTAATCGGGCTGG - Intronic
1041671781 8:60499262-60499284 CTATCTTTGCTTATTCTTGGAGG - Intergenic
1042992797 8:74659472-74659494 ATTTTTTTGCTGAAGCTGGAGGG + Intronic
1043596817 8:81897230-81897252 TTTTCTTTGCTTTAGCAGGCTGG + Intergenic
1044047582 8:87456949-87456971 CTTCCTTTGTTTAAGCCTGGAGG + Intronic
1044260565 8:90114906-90114928 CTTTCTTGGCTTTTGCTGGCAGG + Intergenic
1045943047 8:107760946-107760968 CTTTCTATTCTTAGACTGGGAGG + Intergenic
1046213428 8:111110606-111110628 CTTTCTTTGCTTAACATTAGGGG + Intergenic
1046244798 8:111545246-111545268 CTTTGTTTCCTTAACCTTGGGGG - Intergenic
1046844646 8:118902281-118902303 CTTTCTGAGCCTAAGCTGGAAGG + Intergenic
1046844652 8:118902315-118902337 CTTTCTGAGCCTAAGCTGGGAGG + Intergenic
1047190557 8:122675315-122675337 CCTTTTTTGCTTAAGCTAGCTGG + Intergenic
1047265768 8:123307226-123307248 CTTTCTTTTTTGAACCTGGGAGG + Intergenic
1050150749 9:2617242-2617264 CTTTCTATGCTGAGGCTGTGGGG + Intergenic
1052420736 9:28240754-28240776 CTTTCGTTGCTTATGCTTGTGGG - Intronic
1052952312 9:34222822-34222844 TTTTCTTTTCTTAAGCTCAGTGG - Intronic
1055291786 9:74789088-74789110 CTTTCTGTGTTTAAGATGGAGGG - Intronic
1058327903 9:103721147-103721169 CTTTCTTTGAATAAGATGGAGGG - Intergenic
1060157123 9:121327538-121327560 CCTTCTTTCCTTCAGCTTGGGGG + Intronic
1060446604 9:123694364-123694386 CTTTCTTTGCCTCACCTGGTTGG - Intronic
1060835237 9:126750882-126750904 CCTTTTTTGCTTAAGCTAGTAGG - Intergenic
1061822755 9:133237711-133237733 CTTCCTTTGCCTCAGATGGGAGG + Intergenic
1203396786 Un_KI270519v1:25665-25687 CTTTCTTTGATTGAGCTGTTTGG - Intergenic
1203402176 Un_KI270519v1:118624-118646 CTTTCTTTGCATGAGCAGTGTGG + Intergenic
1185565138 X:1089201-1089223 CTCTCATTGCCTAAGCTGGAGGG - Intergenic
1187081469 X:15993728-15993750 CTTTATTTTCTGAAGATGGGGGG + Intergenic
1187744362 X:22391995-22392017 CTTTTTTTGCTTAGGGTGAGAGG + Intergenic
1188569281 X:31562908-31562930 CTTACATTGCATAAGCTAGGAGG + Intronic
1191577059 X:62717538-62717560 CTTTCTTTGATTCAGCAGGTTGG - Intergenic
1192069953 X:67928074-67928096 CTTTGTTTGCCTATGCTGTGGGG - Intergenic
1192590312 X:72354190-72354212 CATTCTTTGCTGAAGCAGGCTGG + Intronic
1192698599 X:73444792-73444814 CTTTCTTTGCTCAAGCTTTCAGG - Intergenic
1196488214 X:116238758-116238780 CTTACTTTGCTTATGTTGGCAGG + Intergenic
1201775143 Y:17654264-17654286 CTTTCTTTGATTCAGCAGGTTGG - Intergenic
1201779082 Y:17698563-17698585 CTTTCTTTGGTTTAGCAGGTTGG - Intergenic
1201822474 Y:18207429-18207451 CTTTCTTTGGTTTAGCAGGTTGG + Intergenic
1201826413 Y:18251725-18251747 CTTTCTTTGATTCAGCAGGTTGG + Intergenic