ID: 1147253472

View in Genome Browser
Species Human (GRCh38)
Location 17:39167192-39167214
Sequence AGGGAGAAGCCCCATGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 1, 2: 4, 3: 44, 4: 306}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147253472_1147253477 -4 Left 1147253472 17:39167192-39167214 CCAGCCACATGGGGCTTCTCCCT 0: 1
1: 1
2: 4
3: 44
4: 306
Right 1147253477 17:39167211-39167233 CCCTACACTGGGCTTATAGACGG 0: 1
1: 0
2: 0
3: 6
4: 102
1147253472_1147253479 -3 Left 1147253472 17:39167192-39167214 CCAGCCACATGGGGCTTCTCCCT 0: 1
1: 1
2: 4
3: 44
4: 306
Right 1147253479 17:39167212-39167234 CCTACACTGGGCTTATAGACGGG 0: 1
1: 0
2: 0
3: 4
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147253472 Original CRISPR AGGGAGAAGCCCCATGTGGC TGG (reversed) Intronic
900973441 1:6004042-6004064 AGGGAGGAGCCCCCAGTGCCTGG + Intronic
902097508 1:13958796-13958818 AGAGAGGAGACCAATGTGGCTGG + Intergenic
903236381 1:21953134-21953156 AGGGAGAGGCCCCTGGTGGCAGG - Intergenic
903281744 1:22254120-22254142 ACGGAGAAGCCCGATGTCCCGGG + Intergenic
903912028 1:26734573-26734595 TGGTAGAAGCTCCATGTGGGAGG + Intronic
904041071 1:27585652-27585674 TTCGAGAAGCCCCTTGTGGCAGG + Intronic
906170670 1:43722327-43722349 TGAGAGAAGCTCCATGTTGCAGG + Intronic
906527879 1:46506963-46506985 AGGGAGAGGGGCCATGAGGCAGG - Intergenic
907237715 1:53063045-53063067 AGGCAGAAGCCCCAGGTTCCAGG + Intronic
909818309 1:80025484-80025506 AGGCAGAAACCCCATATAGCTGG + Intergenic
909976455 1:82051297-82051319 AGGAAGATGGCCCATGTGGTTGG - Intergenic
910646110 1:89517186-89517208 AGGGACAAGGCCAATGAGGCTGG + Intergenic
911131589 1:94393852-94393874 AGTCATAAGGCCCATGTGGCAGG + Intergenic
914862567 1:151398842-151398864 TCAGAGCAGCCCCATGTGGCAGG - Intergenic
915330054 1:155105816-155105838 ATGAAGAAGCCCAGTGTGGCTGG + Intergenic
915465124 1:156092844-156092866 AAGGAGAAAGTCCATGTGGCTGG - Intronic
916084863 1:161261091-161261113 AAAGAGGAGCCCCATGGGGCTGG - Intronic
916511323 1:165474577-165474599 AGGGAGGAGGCCAGTGTGGCTGG + Intergenic
917184067 1:172332603-172332625 AGAGAAAAGCCCCAGCTGGCCGG - Intronic
920499976 1:206479938-206479960 AGGGGCAACCCCCAGGTGGCAGG + Intronic
920836269 1:209513899-209513921 AGGGCGAAGGCAGATGTGGCAGG - Intergenic
923701883 1:236307518-236307540 AGGGAAAGGCCCCAAGAGGCAGG - Intergenic
1062768910 10:84770-84792 AGGCTGAAGCCCCATGGGTCTGG + Intergenic
1062837051 10:642424-642446 AGGGAGGAGCCACACGGGGCAGG + Intronic
1063201689 10:3790523-3790545 AGTGACAAGCCAAATGTGGCTGG + Intergenic
1063852557 10:10209504-10209526 AGGCAGAAGACACATATGGCTGG + Intergenic
1063995674 10:11616424-11616446 ATGGAGAGGCCACATGTAGCTGG + Intergenic
1064029494 10:11874938-11874960 AGGGAGAAGCCCCAGAGGCCTGG - Intergenic
1064090366 10:12378133-12378155 AGGGTGAACGCCCATGAGGCTGG - Intronic
1066429857 10:35341189-35341211 AGGAAGGAGGCCAATGTGGCTGG - Intronic
1068220751 10:54042608-54042630 AGCAAGAAGCCCAGTGTGGCTGG + Intronic
1069569189 10:69484271-69484293 AGGGAGCAGCCCCGGCTGGCAGG - Intronic
1069722840 10:70560638-70560660 AGGGAGAGGCCCACTGAGGCAGG - Intronic
1070320429 10:75350939-75350961 ATGAAGTAGCCCCATGTGGCAGG - Intergenic
1072533484 10:96341570-96341592 AGAGAAAAGGCCCACGTGGCAGG + Intergenic
1073171322 10:101511222-101511244 AGACAGAAGGCCAATGTGGCTGG - Intronic
1073186213 10:101616611-101616633 AGGGAGATGGCCCAGGTGGCAGG + Intronic
1073458244 10:103650603-103650625 AGGGGCAGGCCCCAGGTGGCTGG - Intronic
1076267387 10:129119346-129119368 AGGCAGAAGCCACATGGGGGTGG + Intergenic
1076833702 10:133009526-133009548 GGGGAGGAGCCCCAGGTGCCGGG - Intergenic
1076907823 10:133372383-133372405 AGAGGGCAGCCCCCTGTGGCTGG + Intronic
1077179859 11:1207423-1207445 AGGAAGAAGCCCCTGGGGGCAGG + Intergenic
1077236317 11:1483607-1483629 AGGGTGCAGACCCCTGTGGCAGG - Intronic
1078067277 11:8086712-8086734 GGGGAGAAGCCACCTGTGCCTGG - Intronic
1078451963 11:11447110-11447132 AGGAAGGAGGCCCCTGTGGCTGG - Intronic
1083240565 11:61384848-61384870 AGGGAGCTGCCCCAGGTGGAAGG + Intergenic
1083261479 11:61525410-61525432 AGGAAGGAGGCCGATGTGGCTGG - Intronic
1083553694 11:63609474-63609496 AGGGCTAAGACCCATCTGGCAGG + Intronic
1083593405 11:63908031-63908053 AGGGACAAGCCCCATGTGCTGGG + Intronic
1083725400 11:64625383-64625405 AGAGAGCAGCCCAGTGTGGCTGG + Intronic
1084267331 11:68011791-68011813 AGGGAGGAGACCCCTGGGGCAGG - Intronic
1085937570 11:81168129-81168151 ATTGCGAAGGCCCATGTGGCAGG + Intergenic
1086207306 11:84274925-84274947 ATGGAGAAGAAGCATGTGGCTGG - Intronic
1087093418 11:94298412-94298434 AGGGAGTAGCTCAGTGTGGCTGG + Intergenic
1087426532 11:97994340-97994362 AGGGTGAAACTCCATGAGGCTGG - Intergenic
1088023061 11:105143277-105143299 AGTGAGAGGCCCCTTGTGCCAGG - Intergenic
1088521769 11:110709688-110709710 AGGAAGAAGGCCCATGTGGTTGG + Intronic
1089059318 11:115613332-115613354 AGTGAGAAGGCCCACGAGGCTGG - Intergenic
1090371830 11:126260893-126260915 AGTTAGGAGCCACATGTGGCTGG + Intronic
1092140248 12:6178816-6178838 ATGGAGAAGCGTCATGGGGCAGG + Intergenic
1092497011 12:9006451-9006473 AGAAAGAAGGCTCATGTGGCTGG + Intronic
1094850004 12:34378122-34378144 GGGGACAAGCCCAAGGTGGCAGG - Intergenic
1094850135 12:34378681-34378703 AGGGACCAGCCCAAGGTGGCAGG - Intergenic
1094870495 12:34596745-34596767 AGGGACCAGCCCAAGGTGGCAGG + Intergenic
1094870583 12:34597202-34597224 AGGGGGAAGCCCCAAGCAGCAGG + Intergenic
1096694331 12:53339058-53339080 AGGGAGAGGCGCCATGTGGCAGG + Intronic
1097757649 12:63425128-63425150 AGAGAGAAGACCCTTGTGGATGG + Intergenic
1097832866 12:64244031-64244053 AGAGAGAAGACCAATGTGGTGGG + Intergenic
1098308869 12:69128184-69128206 AGGAAGAAACCCTATGTGGTAGG + Intergenic
1098548476 12:71737344-71737366 AGGGTGAAACTCCATGAGGCTGG - Intergenic
1100853279 12:98736014-98736036 AGCCAGACGGCCCATGTGGCTGG + Intronic
1101551469 12:105766462-105766484 AGGGAGAAGCTTCCTGTGGGAGG - Intergenic
1101650629 12:106674122-106674144 AATGAGGAGGCCCATGTGGCTGG - Intronic
1102222759 12:111205423-111205445 TATGAGAAGCCCCTTGTGGCGGG - Intronic
1103089924 12:118090564-118090586 AGGGAGAAGGCCGGCGTGGCAGG - Intronic
1104644071 12:130484680-130484702 TGGGAGGAGGCCCATGTGGCTGG - Intronic
1105858367 13:24390333-24390355 AGGTGGGAGCCCCACGTGGCTGG + Intergenic
1106548107 13:30747848-30747870 AGGGAGAAGCGACATGAGGGTGG - Intronic
1107823215 13:44304896-44304918 AGGAACATTCCCCATGTGGCTGG + Intergenic
1109255233 13:60072085-60072107 TGGGAGAGGGCCCATGTGGAAGG - Intronic
1112007003 13:95262192-95262214 AAGGAGATGGCCCACGTGGCTGG + Intronic
1113142908 13:107174754-107174776 AGGGAGAAGCAGGATGTGGCTGG + Intronic
1113150105 13:107253700-107253722 TGCGAGAAGACCCGTGTGGCTGG - Intronic
1113531343 13:111029769-111029791 AGGGAGAGGACCCGAGTGGCAGG - Intergenic
1113873859 13:113582589-113582611 AGGGAGAAGTCCCCAGAGGCTGG + Intergenic
1114052197 14:18930015-18930037 AGGGAGACTCCCCATGTAGGTGG + Intergenic
1114054200 14:18952604-18952626 AGGGAGACTCCCCATGTAGATGG + Intergenic
1114108356 14:19449328-19449350 AGGGAGACTCCCCATGTAGATGG - Intergenic
1114110362 14:19471909-19471931 AGGGAGACTCCCCATGTAGGTGG - Intergenic
1114435748 14:22706314-22706336 AGGGAGAAGCCACAGGTAACGGG + Intergenic
1114572623 14:23684211-23684233 AGCGAGAAGGCCAGTGTGGCTGG + Intergenic
1115320510 14:32076069-32076091 ATCGAGAAGCCCCGTGGGGCGGG - Intergenic
1115755989 14:36526130-36526152 AGGCAGAACCCCCTTGTGTCAGG - Intergenic
1116946083 14:50836559-50836581 AGCCAGTAGCCCCGTGTGGCTGG - Intergenic
1117827761 14:59721222-59721244 AGGGCTCAGCCCCTTGTGGCAGG - Intronic
1118242578 14:64074300-64074322 AGGGAGAAGATCAGTGTGGCTGG + Intronic
1118805941 14:69237002-69237024 AGGGAGAAAGCCCAAGTGTCTGG - Intronic
1120457374 14:84749308-84749330 AGCAAGAAGACCAATGTGGCTGG - Intergenic
1120591225 14:86375064-86375086 AGGGAGGAGTCACCTGTGGCTGG - Intergenic
1121068539 14:90994100-90994122 TGGGAGAATCCCCATCTGTCTGG - Intronic
1121650658 14:95555509-95555531 AGGGAGAATCTCCAGGTGGCTGG + Intergenic
1122268618 14:100558329-100558351 AGGGAGAGGCAGCATGTGCCTGG - Intronic
1122509939 14:102258307-102258329 AGGGAAGAGGCCCATGTGGCTGG - Intronic
1124252197 15:28114101-28114123 TGGGTGAGGCCCCGTGTGGCAGG - Intronic
1124452515 15:29808984-29809006 GCTGAGTAGCCCCATGTGGCTGG - Intronic
1125267310 15:37897983-37898005 AGAGAGGAGGCCAATGTGGCTGG - Intergenic
1127308019 15:57727218-57727240 AGCAAGGAGGCCCATGTGGCTGG - Intronic
1127566301 15:60192227-60192249 AGTGAGAAGACCGAGGTGGCTGG + Intergenic
1127757339 15:62105346-62105368 AGGGAGAAGGAGCAGGTGGCAGG + Intergenic
1128213571 15:65918536-65918558 AGGGACAAATGCCATGTGGCAGG + Intronic
1128625054 15:69192957-69192979 AGGGTGAACCCCCAAGAGGCTGG - Intronic
1128659102 15:69484809-69484831 AGAGAGAAGGCCCCTGAGGCAGG - Intergenic
1129250674 15:74307235-74307257 AGGGACAAGCCCCATTTCCCAGG - Intronic
1129677909 15:77642365-77642387 AGGGAGAGGCCCCATGGTGTGGG + Intronic
1129692949 15:77724069-77724091 TGGGAGAAGCCCCGGGTGACTGG - Intronic
1130931705 15:88433230-88433252 AGGGACAAGTCCAGTGTGGCTGG - Intergenic
1131231924 15:90665705-90665727 AGGGCGAAGCCCCACGACGCAGG - Intergenic
1132537822 16:492090-492112 CGGCAGAAGCCCCCTGGGGCAGG - Intronic
1132758958 16:1499754-1499776 AGGGTGAAGCAAGATGTGGCCGG - Intronic
1133165427 16:3943612-3943634 ATGGAGTAGCCCTGTGTGGCAGG - Intergenic
1133225577 16:4338852-4338874 AGGGAGAGGCCCCAGATGGGGGG - Exonic
1133255777 16:4514763-4514785 AGGGAGAAGCCGGATGTGGAAGG - Exonic
1134123316 16:11599755-11599777 TGGGAGGAGGCCCCTGTGGCTGG - Intronic
1136136426 16:28259240-28259262 AGTGAGAAGGCACAGGTGGCGGG + Intergenic
1137238112 16:46632275-46632297 AGGGTGAAACTCCATGAGGCTGG + Intergenic
1137343594 16:47634599-47634621 AGAGAGGAGGCCTATGTGGCAGG + Intronic
1137433139 16:48434508-48434530 GGGGAGGAGCCAGATGTGGCTGG - Intronic
1137525786 16:49235070-49235092 AGGAAGAAGACCAATATGGCAGG - Intergenic
1138086174 16:54135686-54135708 TGGGAGGAGCCCCTTGTGGGGGG - Intergenic
1138197214 16:55060512-55060534 AGCAAGGAGACCCATGTGGCTGG - Intergenic
1138998311 16:62478694-62478716 AGGCAGCTGCCCCATGTGACAGG + Intergenic
1139296070 16:65902002-65902024 AGGGAGAAGCCCCATGAGGCAGG + Intergenic
1139474864 16:67198129-67198151 AGGGACATGCCCTGTGTGGCTGG + Exonic
1139568743 16:67797072-67797094 ACCTAGCAGCCCCATGTGGCAGG - Intronic
1140297788 16:73726018-73726040 AGGTAAAAGCTCCATGTGACAGG + Intergenic
1141089064 16:81117568-81117590 AGGGAGCAGCCCTGTGGGGCGGG - Intergenic
1141177880 16:81732757-81732779 TGGGAGAGACCCCATGAGGCAGG + Intergenic
1142351913 16:89584469-89584491 AGGGAGACGCCCTACATGGCGGG - Intronic
1144783711 17:17820365-17820387 AGAGAGGAGCTCAATGTGGCAGG + Exonic
1146047654 17:29523326-29523348 AGGGAGATGGACCAGGTGGCTGG - Intronic
1146910612 17:36646306-36646328 ATGGAGCGGCCCCAGGTGGCAGG - Intergenic
1147253472 17:39167192-39167214 AGGGAGAAGCCCCATGTGGCTGG - Intronic
1147997352 17:44367884-44367906 AGCAAGGAGGCCCATGTGGCTGG - Intergenic
1148587476 17:48791231-48791253 AGAGAGAAGCCCCAGGCAGCAGG + Intronic
1148597973 17:48872081-48872103 AGGGAGAAGCCCCTTCTGTCTGG + Intergenic
1148905314 17:50908222-50908244 ACACAGAAGCTCCATGTGGCTGG - Intergenic
1149995925 17:61405869-61405891 AGGGAGAAGGCCCAGGGAGCTGG + Intronic
1151243433 17:72776004-72776026 AGGGAGAGGGAACATGTGGCAGG - Intronic
1151644882 17:75423624-75423646 AGGGAGAAAACACAGGTGGCAGG + Intergenic
1151647180 17:75441259-75441281 AGAGAGAAGGCCAGTGTGGCTGG + Intronic
1152349363 17:79775719-79775741 TGGGAGTAGCCACATGTAGCTGG - Intergenic
1152632240 17:81415449-81415471 AGCGCGAGGCCCCATGTGGTTGG + Intronic
1152962000 18:85752-85774 AGGCTGAAGCCCCATGGGTCTGG + Intergenic
1153646275 18:7198925-7198947 ATGGAAAAGCCCAATATGGCTGG - Intergenic
1153878936 18:9403918-9403940 CTGGAGCAGCCCCATGGGGCCGG - Intergenic
1157167174 18:45368518-45368540 AGTCATAAGCCCAATGTGGCAGG - Intronic
1157199140 18:45643998-45644020 AGGCAGAAGGCCCAGGTGCCTGG - Exonic
1157315174 18:46580887-46580909 AGAGAGAAGGCCAATATGGCTGG + Intronic
1157485271 18:48082618-48082640 AGGGAGAAGCTCCAGGTATCTGG + Intronic
1157890474 18:51411255-51411277 AGAGAGAAGGCCAATGGGGCTGG + Intergenic
1160034342 18:75286917-75286939 AAGGAGAAGCCGCCTGTGGCTGG + Exonic
1160680202 19:408807-408829 AGGGAGGAGCCACAGGTGGGTGG - Intronic
1160744553 19:704490-704512 AGGGAGACGTTCCAGGTGGCCGG - Intergenic
1160758801 19:772152-772174 AGGGAGGAGGCCCGTGTGGCTGG - Intergenic
1161205555 19:3039395-3039417 AGGGAGAAGGCCTGTGTGGCTGG - Intronic
1161226163 19:3146934-3146956 AGTGAGGAGGCCCTTGTGGCTGG - Intronic
1161239332 19:3213328-3213350 AGTGAGGAGGCCCATGTGGCTGG + Intergenic
1161245853 19:3251440-3251462 AGGGAGGAGGCCCGTGTGGCTGG + Intronic
1161253085 19:3291711-3291733 AGTGAGGAGGCCCATGTGGCTGG + Intronic
1161267904 19:3373458-3373480 AGCGAGGAGGCCCATGTGGCTGG - Intronic
1161273391 19:3402841-3402863 AGCGAGGAGGCCCCTGTGGCTGG + Intronic
1161301611 19:3545414-3545436 AGGGAGGAGGCCTGTGTGGCTGG - Intronic
1161306886 19:3573453-3573475 AGGGAGAAGCCCCCTGACCCAGG - Intronic
1161345964 19:3768839-3768861 AGCGAGGAGGCCCATGCGGCTGG - Intergenic
1161442598 19:4300787-4300809 AGCGAGGAGGCCCGTGTGGCTGG + Intronic
1161483013 19:4520024-4520046 AGTGAAAAGGCCCGTGTGGCTGG - Intergenic
1161503810 19:4633187-4633209 AGCAAGGAGGCCCATGTGGCTGG + Intergenic
1161515477 19:4693852-4693874 AGGGAGGAGGCCCCTGTGGCTGG - Intronic
1161621433 19:5299299-5299321 AGCGAGGAGGCCCATGTAGCTGG - Intronic
1161625396 19:5323620-5323642 AGCGAGGAGGCCCGTGTGGCTGG + Intronic
1161649334 19:5474737-5474759 AGCGAGGAGGCCCATGTGGCTGG + Intergenic
1161650358 19:5480530-5480552 AACGAGGAGGCCCATGTGGCTGG + Intergenic
1161658840 19:5533494-5533516 AGTGAGGAGGCCCATGTGGCTGG + Intergenic
1161664224 19:5565168-5565190 AGCGAGGAGGCCCGTGTGGCTGG - Intergenic
1161719740 19:5896202-5896224 AGTGAGGAGGCCCGTGTGGCTGG + Intronic
1161741093 19:6021666-6021688 AGCGAGGAGGCCCGTGTGGCTGG + Intronic
1161863706 19:6818439-6818461 AGCAAGGAGGCCCATGTGGCTGG - Intronic
1162153648 19:8662501-8662523 ACGGAGGAGGCCCATGCGGCTGG + Intergenic
1162156378 19:8680907-8680929 ATTGAGGAGGCCCATGTGGCTGG + Intergenic
1162304434 19:9863207-9863229 AAGGAGGAGGCCCATGTGGCTGG + Intronic
1163011709 19:14430763-14430785 AGTTAGAAGGCTCATGTGGCTGG + Intergenic
1163083136 19:14957930-14957952 AGAGAGAAGACCAATGTGGCTGG + Intronic
1163647199 19:18496093-18496115 AGGGAGTAACCCCATCTGTCCGG - Intronic
1164254613 19:23516505-23516527 AGGAGGCAGCCCCATGTGGGAGG + Intergenic
1164305927 19:24003856-24003878 AGGGAGGAGCAGCATTTGGCCGG + Intergenic
1164870569 19:31640081-31640103 AGGGAGAAGACGGATCTGGCTGG + Intergenic
1165389239 19:35528812-35528834 AGGGAGAAGGCCTGTGTGGCTGG - Intergenic
1166070648 19:40385380-40385402 AGTGAGGAGACCCTTGTGGCTGG - Intronic
1166320755 19:42017541-42017563 AGTGAGAAGCCCCATTTGAGGGG + Intronic
1166514125 19:43433044-43433066 GGGGAGAGCCCCCTTGTGGCTGG - Intergenic
1166730263 19:45055358-45055380 AGAGAGAAGGCCCGTGTGGCTGG + Intronic
1166731319 19:45060620-45060642 AGGGAGAAGCCCTACCTGGGTGG - Exonic
1166947053 19:46403926-46403948 AGGGAGAAGCCCCTGGTTGGCGG + Intergenic
1167763090 19:51461728-51461750 AGGGAGAGGAACCATGGGGCTGG - Intergenic
925370349 2:3340322-3340344 AAGGAGAAGCCAGATATGGCCGG + Intronic
925806793 2:7658745-7658767 AGGAAGAAGACACAAGTGGCTGG - Intergenic
928310399 2:30204923-30204945 AGGGAAAAGCAACATGTGCCTGG - Intergenic
929959174 2:46483597-46483619 AGGGAGAAGACCCACGTGTGTGG + Intronic
932133068 2:69204837-69204859 GGAGAGCAGCCCCATGTGGGAGG - Intronic
932402259 2:71489141-71489163 AGGGAGACCCCCGTTGTGGCAGG - Intronic
935105789 2:100042104-100042126 AGGAAGAAGGCCAGTGTGGCAGG - Intronic
938470229 2:131553332-131553354 AGGGAGACTCCCCATGTAGGTGG + Intergenic
938761969 2:134434150-134434172 TGGGAGAAGCGCCAGGTAGCGGG - Intronic
938778148 2:134560003-134560025 AGCGAGGAGCCCCATGTGGCTGG - Intronic
940855235 2:158724209-158724231 AGAGACATGCCCCATGTGGACGG + Intergenic
943441923 2:187935628-187935650 AGGGAGGAGACCCAAGTGGGTGG + Intergenic
944287975 2:197973682-197973704 AGGAAGAAGTCCAGTGTGGCCGG + Intronic
945317011 2:208380259-208380281 AGGAAGCAGCCCCAAGTGACAGG + Intronic
946406185 2:219493175-219493197 AGGAAGGAGCCCCAGGTGTCAGG + Exonic
947702521 2:232246395-232246417 AGTGGGAAGGCCCATGTGACTGG + Intronic
948384682 2:237574200-237574222 AGGAAGCAGGCCCATGCGGCAGG - Intergenic
948778910 2:240305016-240305038 ACGGAGCAGGCCCACGTGGCTGG - Intergenic
1168811261 20:706251-706273 AGAGAGAAGGCCAAGGTGGCTGG + Intergenic
1169219230 20:3811897-3811919 AGGGAGGGGCCTCACGTGGCTGG + Intergenic
1169223682 20:3842425-3842447 AGGGAGAAGTCCCCTGTGTTGGG + Intergenic
1170658772 20:18316067-18316089 AAGGAGAAGCCCTATGTGTGCGG + Exonic
1171421458 20:25020558-25020580 AGGGAGCAGGGCCATGTGCCCGG + Intronic
1173251695 20:41366977-41366999 AGGGAGCAGCCCCAGGTGGCAGG + Intergenic
1173622363 20:44446225-44446247 AGGGAGGAGCCCAAGGGGGCTGG - Intergenic
1173670993 20:44798815-44798837 AGGGAGACGCAGCATGGGGCAGG - Intronic
1174081011 20:47970742-47970764 AGCCAGGAGCCCCGTGTGGCTGG - Intergenic
1174135487 20:48376114-48376136 AGCCAGGAGCCCCGTGTGGCTGG + Intergenic
1174215530 20:48913297-48913319 AGGCAGAAGCATCATTTGGCTGG - Intergenic
1174313952 20:49682449-49682471 AGCGAGAAGGCCCGTGTGGCTGG - Intronic
1174342223 20:49905131-49905153 TGGGAGAGGCCCCGTGTGGCAGG + Exonic
1174392293 20:50225183-50225205 ACTGAGGAGGCCCATGTGGCTGG + Intergenic
1174416968 20:50373863-50373885 AGGGAGGAGGCCAGTGTGGCTGG + Intergenic
1174777596 20:53359704-53359726 AGAGAGAAGGCCACTGTGGCTGG + Intronic
1175366334 20:58458832-58458854 AGAGAGAAGGCCAGTGTGGCCGG + Intergenic
1175401102 20:58700373-58700395 AGGGAGAGGCCGCTTGTGTCAGG + Intronic
1177421881 21:20870081-20870103 AGCAAGGAGGCCCATGTGGCTGG - Intergenic
1178762962 21:35421571-35421593 AGCCAGAAGCTCCATGTGGCAGG + Intronic
1179824735 21:43957578-43957600 AGGGGGAAACCCCGTGTGGAGGG - Intronic
1180099100 21:45576084-45576106 TGGGAGAAGGCCCAGGGGGCCGG - Intergenic
1180470669 22:15652388-15652410 AGGGAGACTCCCCATGTAGGTGG + Intergenic
1180472671 22:15674983-15675005 AGGGAGACTCCCCATGTAGATGG + Intergenic
1182021847 22:27088323-27088345 ATGGAGAAGCCACATGTGGGTGG - Intergenic
1182192511 22:28477442-28477464 ATTGAGAAGGCCAATGTGGCTGG - Intronic
1183671587 22:39276053-39276075 AGGTAGAAGCAGCAGGTGGCCGG + Intergenic
1184393210 22:44217618-44217640 AGGCAGAGGCCCCAGGTGACGGG + Intronic
1184750810 22:46485466-46485488 CGGGAGGAGGCCCATGTGCCTGG + Intronic
1185036545 22:48480850-48480872 AAGTAGAATCCTCATGTGGCCGG + Intergenic
950155141 3:10716355-10716377 AGGGAGGAGGCCAGTGTGGCTGG - Intergenic
950463679 3:13140707-13140729 ACAGATAAGCCCCATGTTGCAGG + Intergenic
951856300 3:27200895-27200917 AGTGGGAAGCACCATGTGGCTGG + Intronic
953232102 3:41074461-41074483 AGGAAGCAGGCCCATGTGTCAGG + Intergenic
953883332 3:46702512-46702534 AGGGAGAAGGCCCAGGAGCCAGG + Intronic
953974197 3:47370353-47370375 AGGGTCAAGTCCCATGTGGGTGG - Intergenic
954007713 3:47605473-47605495 TGGAAGAAGCCAGATGTGGCCGG + Intronic
954301467 3:49702894-49702916 GTGGAGAAGCCGCCTGTGGCTGG - Intronic
959108867 3:102097580-102097602 AGGAAGAAGCCACATGTTTCAGG - Intergenic
961489600 3:127245368-127245390 AGTGAGAGGCTCCATGTGGGTGG - Intergenic
961658146 3:128454412-128454434 TGGGAGGAGGCCCATGTGGCAGG - Intergenic
961919382 3:130409770-130409792 AGGGAAAATCACCATGTAGCAGG + Intronic
962053087 3:131840097-131840119 AGGGAAAAGCCACATCTGTCAGG + Intronic
962845967 3:139274164-139274186 AGGGAGGAGCTGCATGGGGCTGG - Intronic
962973888 3:140429480-140429502 AGGAAGGAGCACAATGTGGCTGG + Intronic
967355272 3:188562603-188562625 AAGGAGAAGATCCATCTGGCAGG - Intronic
967392652 3:188972511-188972533 AGGAAGCAGCCCCAGCTGGCAGG - Intronic
968828162 4:2914827-2914849 AGGGAGAGTCCCCATCGGGCCGG + Intronic
968915272 4:3494530-3494552 AGGCAGAGGCCCCACGTGGAGGG - Intronic
969364653 4:6687168-6687190 GGGAAGCAGCTCCATGTGGCGGG - Intergenic
972211975 4:36849427-36849449 AGTGAGAAGCTCCGTGTGCCAGG + Intergenic
979312876 4:119224699-119224721 AGGGAGAAACTCCAGGAGGCTGG + Intronic
982090350 4:151875144-151875166 ACCGAGGAGGCCCATGTGGCTGG + Intergenic
983800786 4:171927657-171927679 ACCAAGAAGACCCATGTGGCTGG - Intronic
983999748 4:174225605-174225627 AGGCAGAAGCCGTATCTGGCAGG - Intergenic
984921090 4:184765148-184765170 AGGGAGAACCCCTATGTGACTGG + Intronic
987955539 5:24735175-24735197 AGGGAGAATCCGGATGTGGTAGG + Intergenic
988499415 5:31771994-31772016 GTGGAGAAGCCCCATCTGGTTGG + Intronic
991203516 5:64021996-64022018 AGGTGGAAGCCACATGTTGCAGG + Intergenic
993137392 5:83986862-83986884 AAGGAGAATTTCCATGTGGCTGG + Intronic
994682011 5:102899857-102899879 AGGGAGCTGGTCCATGTGGCTGG + Intronic
995123166 5:108556576-108556598 AGGGAACAGCGCCATGTGGCAGG - Intergenic
995283933 5:110365392-110365414 AGAAAGAAGCCCAGTGTGGCAGG + Intronic
995856758 5:116600812-116600834 AGAGAAAAGGCCCATGTGGCTGG + Intergenic
997248426 5:132370549-132370571 AGGGAGGAGCACACTGTGGCTGG - Intronic
997413828 5:133710076-133710098 AGGGAGGAGTGCCATGAGGCAGG + Intergenic
998354006 5:141519489-141519511 AGGCAGAGGTCCCATGTGGTAGG + Intronic
999204990 5:149841438-149841460 AGGAAGAAAACCCAGGTGGCGGG - Intronic
1001023699 5:168205675-168205697 TGATAGAAGCCCAATGTGGCAGG + Intronic
1001770564 5:174293024-174293046 AGGGAGAGGGGCCCTGTGGCAGG + Intergenic
1002104578 5:176873829-176873851 AGGGAGCAGACGCTTGTGGCAGG - Intronic
1002178840 5:177419147-177419169 ATGGAGAGACCCTATGTGGCAGG - Intronic
1002258494 5:177977887-177977909 GGGGTGAAGCCTCATGTGTCGGG + Intergenic
1002501373 5:179649659-179649681 GGGGTGAAGCCTCATGTGTCGGG - Intergenic
1004199502 6:13534650-13534672 AGGGAGCAGCCCGACGTGGCTGG + Intergenic
1006139725 6:31920955-31920977 GGGGAGGAGCCCCATGGGGCAGG + Intronic
1006432637 6:34007370-34007392 AGTGAGGAGGCCCAAGTGGCTGG + Intergenic
1006511601 6:34524512-34524534 AAGGTGCAGACCCATGTGGCTGG - Intronic
1006931275 6:37690099-37690121 AGTGAGGAGTCCAATGTGGCTGG - Intronic
1007745965 6:44043088-44043110 AGGGAGGTGCCCCAAGTGGCAGG - Intergenic
1008149791 6:47937013-47937035 AGCAAGAAAGCCCATGTGGCTGG + Intronic
1011807562 6:91089310-91089332 AGCAAGAAGGCCCAAGTGGCTGG - Intergenic
1014579167 6:123113624-123113646 AGGTAGAAGCTCCATCTGGGAGG - Intergenic
1015333673 6:132010149-132010171 AGCAAGTAGCCCAATGTGGCTGG + Intergenic
1018057749 6:160067160-160067182 AGACAGAAACCCCGTGTGGCTGG - Intronic
1019156690 6:170044011-170044033 AGGGAGCAGCCCCGTGTGGAGGG - Intergenic
1019446935 7:1076259-1076281 AGGGAGGAGCACCATGAGGGAGG + Intronic
1019468092 7:1201535-1201557 AGGAAGAAGATGCATGTGGCTGG + Intergenic
1019701276 7:2476022-2476044 AGGCTGCAGCCCCATGAGGCTGG - Intronic
1020845983 7:13284376-13284398 AGGGAGAAGGCTCAGGTGGCTGG - Intergenic
1021809600 7:24390515-24390537 AGGGAGAAGGCCCATTAGGCGGG - Intergenic
1022833344 7:34090396-34090418 AGGGAGAAGCAATATGAGGCTGG - Intronic
1022960730 7:35423908-35423930 GAGGAGAAAGCCCATGTGGCTGG - Intergenic
1024004436 7:45215175-45215197 AAGGAGAAGACCCAGGTGGATGG - Intergenic
1024392557 7:48831992-48832014 AGGGAGAAGCTCCAGGAGACAGG + Intergenic
1028964772 7:96789969-96789991 AGAGAGAAGGCCCATGTGGCTGG - Intergenic
1034302670 7:150030241-150030263 AGCCACTAGCCCCATGTGGCTGG + Intergenic
1034448703 7:151126222-151126244 AGGGAGGAGCCACACGTGTCTGG + Intronic
1034777240 7:153839550-153839572 AGGGAGAAGTCCCACTGGGCAGG + Intergenic
1034803391 7:154067057-154067079 AGCCACTAGCCCCATGTGGCTGG - Intronic
1037985843 8:23290090-23290112 AGAGAGAGGCCCCAGCTGGCAGG + Exonic
1037994433 8:23342111-23342133 AGGGGGAACACCCACGTGGCAGG - Intronic
1041572927 8:59358152-59358174 AGGAAAAAGGCCCATGTGGCTGG - Intergenic
1042569808 8:70151050-70151072 AGGTAGAAGCTCCATGTGTGGGG + Intronic
1042722914 8:71843943-71843965 AGGAAGCGGCCCCGTGTGGCTGG - Exonic
1044230625 8:89773430-89773452 AGTGAGAAGGCCTGTGTGGCTGG + Intronic
1046521847 8:115335154-115335176 AGGGAGAAAACCAATGTGGCGGG - Intergenic
1047714743 8:127585198-127585220 AGAGAGAAGCTCAGTGTGGCTGG - Intergenic
1048488587 8:134871008-134871030 AGGCAGGAGGTCCATGTGGCTGG + Intergenic
1049050786 8:140193391-140193413 AGGGAGAAGCTTCATGTTGTAGG + Intronic
1049053024 8:140214108-140214130 AGGGAAAAGCCTCCTGTTGCCGG + Intronic
1049222117 8:141432959-141432981 GGGGAGATGCCCCAGGTGGAAGG + Intergenic
1049447985 8:142640334-142640356 AGGGAGGAGCCCCAGCTGGGAGG - Intergenic
1049597404 8:143491157-143491179 AGGGCGGAGCCCCCTGTGCCTGG - Intronic
1049858639 8:144881837-144881859 GGGGAGAAGCCCTATGTGTGTGG - Exonic
1050265552 9:3885668-3885690 AATGAGAAGCCCCATGTGAATGG + Intronic
1050847830 9:10245748-10245770 AGGGGGAAGACAGATGTGGCAGG + Intronic
1053090889 9:35275444-35275466 GGGGAGAAGACCCAAGTGGCTGG - Intronic
1060513808 9:124253319-124253341 AGGGATAAGAACCAGGTGGCTGG + Intergenic
1060722526 9:125988553-125988575 AGGAAGAGGACCCATGTGCCTGG - Intergenic
1061590487 9:131594610-131594632 AGGGTGAAGCACCCTGTGGCAGG - Intronic
1061972590 9:134053028-134053050 AGGGAGAAGCCACGCGTGTCCGG - Intronic
1062560295 9:137138653-137138675 AGGGAGAGGCCCCATCTGCGTGG - Intronic
1062736143 9:138138365-138138387 AGGCTGAAGCCCCATGGGTCTGG - Intergenic
1187106302 X:16245938-16245960 AGAGAGAAGGCCAGTGTGGCTGG + Intergenic
1187641861 X:21300146-21300168 AGGGAGGATCCCAACGTGGCAGG - Intergenic
1189303068 X:39966845-39966867 GGGAAGAAGCCCCCTGTAGCAGG - Intergenic
1189848626 X:45158097-45158119 AGGGGGCAGACCCCTGTGGCTGG + Intronic
1189877139 X:45447642-45447664 AGGCAGAGGCCCCAGGTGTCTGG + Intergenic
1194685706 X:96911494-96911516 TGTGAGGAGACCCATGTGGCAGG - Intronic
1195160607 X:102167104-102167126 AAGGGGAATCCACATGTGGCAGG + Intergenic
1197497828 X:127207659-127207681 TGGGAGAAACCCGATGAGGCTGG - Intergenic
1198531375 X:137551724-137551746 GGGGACAACCACCATGTGGCTGG + Intergenic
1200398378 X:156004374-156004396 AGGCTGAAGCCCCATGGGTCTGG - Intronic