ID: 1147257835

View in Genome Browser
Species Human (GRCh38)
Location 17:39192660-39192682
Sequence GAGGAGGACTGCAGGGATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 474
Summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 433}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147257835 Original CRISPR GAGGAGGACTGCAGGGATGT AGG Intronic
900701800 1:4053268-4053290 GAGGAGGACTCCAGGCAGGGAGG - Intergenic
900773449 1:4563804-4563826 GAGGAGGTCAGTAGGGATGGTGG + Intergenic
901459446 1:9382987-9383009 GGTGAGGACTGCAGGGATGAGGG - Intergenic
901514863 1:9738350-9738372 GGGGAGGGCTGCAGGGCTGCAGG - Intronic
901805929 1:11738517-11738539 AATGAGGACTGCTGGGATGGAGG + Intronic
902198778 1:14818501-14818523 GAGCATGCCTGCATGGATGTGGG + Intronic
902553193 1:17231359-17231381 GAGGCTGAGTGCAGGGCTGTGGG - Intronic
902693869 1:18127287-18127309 GGGGAGTACAGCAGGGCTGTGGG + Intronic
903360659 1:22775029-22775051 GAGGAGGGCAGCAGGGGAGTGGG - Intronic
903942564 1:26941821-26941843 GAGATGGACTGCAGGGACTTGGG + Intronic
903947462 1:26972668-26972690 GAGGAGGATGGAAGGGATGGAGG + Intergenic
904382110 1:30118610-30118632 GAGGAGGACAGCAGGGCTCAGGG + Intergenic
904432666 1:30475025-30475047 GAAGAGGACAGCAGCGATGAAGG - Intergenic
904439330 1:30520072-30520094 GAGGAGGACTGAGGGGCTGGGGG - Intergenic
904615386 1:31746717-31746739 GAGAAGGGCTGCAGGGAAGTTGG - Intronic
904983066 1:34522967-34522989 TTGCAGGACTGCAGGGAAGTTGG + Intergenic
907333109 1:53684195-53684217 GAGCTGGACTGCAGAGATCTTGG - Intronic
912587133 1:110777410-110777432 GAGTAGGAGTGCAGGGATCTTGG + Intergenic
913319643 1:117579235-117579257 GCGGAGGTCTGCAGGTATGGGGG + Intergenic
913582042 1:120235640-120235662 CAGGAGGGCTTCAGGGATGCTGG - Intergenic
913626132 1:120662751-120662773 CAGGAGGGCTTCAGGGATGCTGG + Intergenic
913998873 1:143675404-143675426 GAGGAGGAGGGCAAGGAAGTCGG + Intergenic
914448918 1:147773575-147773597 GGGGAGGGCTGCAGGGAGGAGGG - Intergenic
914509507 1:148318472-148318494 GAGGAGGAGGGCAAGGAAGTCGG + Intergenic
914563973 1:148847101-148847123 CAGGAGGGCTTCAGGGATGCTGG - Intronic
914608853 1:149283117-149283139 CAGGAGGGCTTCAGGGATGCTGG + Intergenic
914814396 1:151052891-151052913 GAGGAGAAGGGCAGGGAGGTAGG + Exonic
915509131 1:156377078-156377100 CACGAGGACAGCAGGGATGTCGG + Intronic
915524827 1:156469093-156469115 CAGGAGGACTGTGGGGATGAGGG + Intronic
915748124 1:158180961-158180983 GAGGAGGGCTGCCGGGGTCTGGG + Exonic
915835677 1:159173024-159173046 GAGGAGGAGGGCTGGGATGGAGG + Intronic
916275309 1:162987643-162987665 GAGGGGTGCTGCAGGGAAGTCGG - Intergenic
916876308 1:168973290-168973312 GAGGAAGACTGGGAGGATGTGGG - Intergenic
917837762 1:178954310-178954332 GAGGAAGACAGCAGCGAAGTCGG - Intergenic
918416960 1:184320031-184320053 GAGCAGGACTGGAGGGGTGGGGG - Intergenic
918521557 1:185420542-185420564 GAAAAGGACTGCAGGGAAGCCGG + Intergenic
919755262 1:201062453-201062475 GAGGAGGAGTGCAGGTACATGGG - Exonic
920455381 1:206097238-206097260 AAGGAGGGCTGCAGGGAGGCAGG - Intronic
921075569 1:211697808-211697830 CAGGAGGGCTGCAGGCATGTAGG + Intergenic
921222400 1:212982368-212982390 GAGGAGGATGGCAGGGAGGTGGG + Intronic
922466525 1:225848696-225848718 GTGGGGGAGTGCAGGGATGAGGG + Intronic
922797706 1:228349157-228349179 GAGGAGGCATGGAGGGCTGTGGG + Intronic
922936507 1:229426898-229426920 TAGAAGGACTGCAGGGAAATGGG - Intergenic
924575574 1:245277801-245277823 GAGTAGAACTGCAGGGAGGATGG + Intronic
924671237 1:246128210-246128232 GAGGAGGAGTGCAGGAATTGGGG - Intronic
924716966 1:246584685-246584707 GTGGAGGACTGCAGGGCTGCCGG - Intronic
1063054525 10:2489827-2489849 GGATAGGACTGCAGGGATCTGGG + Intergenic
1063085338 10:2812918-2812940 CAGGAGGACTGATGTGATGTGGG - Intergenic
1063120861 10:3104969-3104991 CAGGAGGCCTGCAGGGACCTAGG - Intronic
1063201179 10:3785944-3785966 GAGGATGACTAGGGGGATGTAGG - Intergenic
1063455495 10:6179612-6179634 CAGGAGGACTGCAGGCAAGAGGG + Intronic
1064715261 10:18170237-18170259 GAGGAGGAATGAATGGATGTAGG + Intronic
1065791232 10:29262718-29262740 GAGGAGCAATACAGGGATGCTGG + Intergenic
1069572213 10:69501114-69501136 GGGGAGGACTGCAAGGAGGCAGG + Intronic
1069784289 10:70977875-70977897 CAGGATGACTGCAGGGATGATGG + Intergenic
1069948039 10:72000875-72000897 GGGGAGGCCAGCAGGGGTGTGGG + Intronic
1070736867 10:78869047-78869069 GAGGAAGAATGCAGGGCTGCAGG - Intergenic
1070796329 10:79219052-79219074 GTGGAGGCCTGCCTGGATGTAGG + Intronic
1073671106 10:105590858-105590880 GAGGTGGAGTGCAGTCATGTGGG + Intergenic
1073775869 10:106785350-106785372 AAGGAGGAGAGGAGGGATGTAGG - Intronic
1073803727 10:107072180-107072202 CAGGAAGACTGCAGGGTTGGAGG - Intronic
1074595282 10:114858730-114858752 GAGGAGGAATGGAGAGAAGTTGG + Intronic
1075753227 10:124791310-124791332 GAGTAGGAGGGGAGGGATGTGGG - Intronic
1075959865 10:126559009-126559031 GAGATGGACTTCAGTGATGTGGG - Intronic
1076594429 10:131617231-131617253 GAGGAGGACGGCAGTGGTGCAGG - Intergenic
1076687197 10:132203552-132203574 GGGGAGGACTGCAAGGAGGGAGG + Intronic
1076793669 10:132788847-132788869 GGGGAGGACGGCGGGGGTGTCGG + Intergenic
1076921455 10:133456634-133456656 GAGGAGGACTGGGAGGATGGCGG + Intergenic
1077090976 11:777970-777992 GGGGAGGCCTGCAGGGTTGTGGG + Intronic
1077189906 11:1251588-1251610 GGGGAGCACTGCAGGGGTGCGGG - Exonic
1077332537 11:1989791-1989813 GAGGAGGACGGCAGGCCTGCTGG + Intergenic
1077377958 11:2214483-2214505 GAGGAGGTCTCCAGGGCTGGAGG - Intergenic
1077688488 11:4319288-4319310 TAGGAGGAATCCTGGGATGTGGG + Intergenic
1077741248 11:4848438-4848460 GAGGAGCACTGCAGAGAGGTGGG + Exonic
1077847944 11:6045887-6045909 CAGGAGGACTAAAGGGATGAAGG + Intergenic
1078339446 11:10488569-10488591 GAGTAAGGCTGCAGAGATGTGGG + Intronic
1078855985 11:15206672-15206694 GGGGAGGACTGCAGGGTTTGGGG + Intronic
1079390707 11:20019621-20019643 GAGGAGGGGTCCAGGGATGGAGG + Intronic
1081997066 11:47372591-47372613 GAGGGTGAGTGCATGGATGTGGG + Intronic
1082910333 11:58366022-58366044 GATGATGACTGCAGTGAGGTGGG + Intergenic
1083065551 11:59920123-59920145 GAGATGCACTGCAGGAATGTAGG - Intergenic
1083293115 11:61700698-61700720 GTGCAGGACTGCAGGGAGGGAGG - Intronic
1083977535 11:66135629-66135651 GAGGAGGCCAGCAGGGATGAGGG - Intronic
1084356944 11:68645355-68645377 GGGGAGGACGGCAGGGCTGGAGG + Intergenic
1084579563 11:70014664-70014686 GAGCAGGATTGCTGGGTTGTGGG + Intergenic
1085390410 11:76179255-76179277 GAGAAGGGCTGCAGGGCTGCAGG + Intergenic
1085471803 11:76763290-76763312 CAGGAGTAATGCAGGGATGACGG + Intergenic
1085531682 11:77195477-77195499 GAGGAGGCCCTCAGGGAGGTGGG - Intronic
1087969883 11:104467134-104467156 GGGGTGGATTGGAGGGATGTGGG + Intergenic
1088002026 11:104893899-104893921 GAGGAGGTGAGCAGAGATGTAGG - Intergenic
1088194040 11:107256529-107256551 GTGGAGGCCTGCAGGGCTTTTGG - Intergenic
1088510254 11:110566324-110566346 GAGAAGGGTTGCAGGGAAGTGGG + Intergenic
1089297826 11:117480602-117480624 GAGGAGGGCAGCAGGGAGCTTGG + Intronic
1089401081 11:118165083-118165105 GAGGAGGAGTGGAGGGAAGCAGG - Exonic
1089734470 11:120540169-120540191 GAGGAGGGCAGCTTGGATGTGGG + Intronic
1090029262 11:123194085-123194107 GGAGAGGACATCAGGGATGTGGG - Intronic
1090267371 11:125361787-125361809 GAGGAAGTCTGAAGGGAAGTTGG + Intronic
1090963517 11:131578456-131578478 GGGGAGAGCTGCAGGGAAGTGGG + Intronic
1202815518 11_KI270721v1_random:44967-44989 GAGGAGGACGGCAGGCCTGCTGG + Intergenic
1091382276 12:69650-69672 AAGGAGAGCTGCAGGGATGAGGG - Intronic
1091710536 12:2737205-2737227 GAGGAGGAAGCCAGGGATCTGGG - Intergenic
1091838527 12:3602816-3602838 GATGAGGACTCCGGGGATGGGGG - Intergenic
1091854497 12:3728571-3728593 GAGGAAGAGTGCAGGGGTGAGGG - Intronic
1092063448 12:5569422-5569444 AAGGAGGACTGGAGGGGTGAGGG - Intronic
1092217434 12:6693211-6693233 GAGAGGCACTGCAGGGGTGTGGG - Intergenic
1092728808 12:11509184-11509206 GAGGAGGAAGCCAGGGATCTGGG + Intergenic
1094293106 12:28874096-28874118 GAGGGGGACAGCAGGGACATAGG + Intergenic
1095527394 12:43143620-43143642 GAGGAGGACTTGTGGGATGTTGG - Intergenic
1095587018 12:43860712-43860734 GAGGAGAAGTGGAGGGAGGTGGG + Intronic
1096079151 12:48822458-48822480 GAGCAGGACCCCGGGGATGTGGG - Intronic
1098762918 12:74447377-74447399 GAGGAGGATTGGAGTGATGTTGG - Intergenic
1101063422 12:100995138-100995160 GGGGAGGACTGCATGGGGGTGGG + Intronic
1101147392 12:101854058-101854080 GAGGAGGAAGGCAGAGAAGTAGG + Intergenic
1103932579 12:124458367-124458389 GAGAAAGACAGCAGGTATGTAGG + Intronic
1104058140 12:125245860-125245882 CTGGAGGACTGCTGGGGTGTGGG - Intronic
1105006823 12:132726687-132726709 GAGGTGGACGGCAGGGATCAGGG - Exonic
1105997636 13:25687496-25687518 GGGAAGGCCTGCTGGGATGTGGG - Intronic
1106038918 13:26071072-26071094 GAGGAGGAATGAAGCGAAGTTGG - Intergenic
1108642402 13:52395059-52395081 GATGGTGACTGCAGGGATGTGGG + Intronic
1109015605 13:57008763-57008785 GAGGAGAAATGCAGAGATGTTGG + Intergenic
1111997471 13:95178938-95178960 GAGGAGGACTGCATTGGTTTTGG + Intronic
1113023736 13:105918017-105918039 GGTGGGGACAGCAGGGATGTCGG - Intergenic
1117295438 14:54374900-54374922 GGAGAGGAATGCAGAGATGTGGG - Intergenic
1117737620 14:58783478-58783500 GAGGACGACTCCAAGGATTTTGG + Intergenic
1117823331 14:59674081-59674103 GGGGAAGATTGAAGGGATGTGGG - Intronic
1117920203 14:60721398-60721420 GCGGGGCACTGCGGGGATGTCGG - Intronic
1119339944 14:73868587-73868609 GAGGAGGAGTTTAGGGATATGGG - Intronic
1119753602 14:77098387-77098409 GAGGAGGGGAGCAGGGATGACGG + Intronic
1119787405 14:77323814-77323836 CCGGAGGACTGCTGGGAGGTGGG + Intronic
1120344500 14:83268337-83268359 GGGGAGGACTCCAGAAATGTTGG + Intergenic
1122836470 14:104433208-104433230 GAGGAGGCCTTCAGGAAGGTGGG + Intergenic
1122837158 14:104435972-104435994 GGGATGGACTGCAGGGTTGTTGG - Intergenic
1123048694 14:105530516-105530538 GAGAAGGAAACCAGGGATGTGGG - Intergenic
1123109758 14:105860577-105860599 GGGCAGGACTGCAGGGAACTGGG - Intergenic
1124578138 15:30927425-30927447 GAGACGGGCTGCAGGGATGAGGG + Intronic
1125695323 15:41632414-41632436 GGGGAGGAGAGGAGGGATGTTGG - Intronic
1125743155 15:41981504-41981526 GAGGAAGCCTGAAGGGATGAGGG + Intergenic
1125756643 15:42069714-42069736 CAGAGGGCCTGCAGGGATGTGGG + Intronic
1126417970 15:48438634-48438656 GAAGAGGAGGGCAGGGCTGTGGG + Intronic
1127663963 15:61126490-61126512 GAGGGGGAATGAAGTGATGTTGG - Intronic
1128878066 15:71218287-71218309 GATGAGTACTGCAGGGATCTGGG - Intronic
1128914010 15:71543413-71543435 GAGCAGGGCAGCAGGAATGTGGG + Intronic
1129137816 15:73570060-73570082 AAAGAGGACTATAGGGATGTTGG - Intronic
1129551198 15:76451381-76451403 GAGTGGGATTGCTGGGATGTAGG + Intronic
1130711506 15:86286443-86286465 GGGGAGGAATGGAGAGATGTTGG - Intronic
1130927144 15:88394186-88394208 GAGGAGGGGAGGAGGGATGTTGG + Intergenic
1132010223 15:98268420-98268442 GAGGATGACTGCAGCCAGGTCGG - Intergenic
1132301932 15:100781407-100781429 GAGGAGGAAAGGAGGGGTGTGGG - Intergenic
1132304345 15:100800706-100800728 GAGAAGAAGTGGAGGGATGTGGG + Intergenic
1132943374 16:2519433-2519455 CTGGAGGACTGCAGGGAGGGGGG + Intronic
1132946196 16:2532542-2532564 GGGGAGGTCCGCAGGGATGTGGG - Intergenic
1133202594 16:4213248-4213270 GAGAAAGACTGCAGGGAGATTGG + Intronic
1133818378 16:9215158-9215180 GAGGCTGAAGGCAGGGATGTTGG + Intergenic
1134649877 16:15899901-15899923 CAGGAGCACAGCAGGAATGTAGG + Intergenic
1135811596 16:25591999-25592021 GGGCTGGACTGCAGTGATGTGGG + Intergenic
1135991974 16:27223815-27223837 GAGGATGCTTGCAAGGATGTGGG + Intergenic
1136039045 16:27563544-27563566 GAAGAGGGCTGCAGGGAAGAGGG + Intronic
1136095982 16:27957002-27957024 GAGGAGGAAGACAGGGAAGTAGG + Intronic
1136467619 16:30455874-30455896 GAGGGAGAATGGAGGGATGTGGG + Intergenic
1136549939 16:30977641-30977663 GAGGAGGCCTGCATGCATCTGGG + Intronic
1137401243 16:48155964-48155986 GAGGAGGACTTCAGGCGGGTGGG - Intronic
1137505510 16:49050866-49050888 CAGTAGGTCTGGAGGGATGTGGG - Intergenic
1141109073 16:81257220-81257242 CAGGAGGAATCCATGGATGTGGG + Intronic
1141530108 16:84640509-84640531 AAGGAGGACTGCAGGGCCCTGGG - Intergenic
1141775837 16:86122000-86122022 GAGGAGGATGGAAGGGAGGTGGG - Intergenic
1142182287 16:88677102-88677124 GAGCAGGACTCCAGGGAGGGGGG + Intergenic
1142194685 16:88733950-88733972 GAGGAGGACTCCAGGGACGAGGG - Exonic
1142226302 16:88879265-88879287 CAGGAGGACTCCAGCGAGGTAGG - Exonic
1142307314 16:89293017-89293039 GAGGAGGACTTGAGGGCTATCGG - Intronic
1142330245 16:89447477-89447499 GTGGACGACAGCCGGGATGTGGG - Intronic
1142963041 17:3563325-3563347 GAGGCCGACAGCCGGGATGTGGG - Intergenic
1143108562 17:4541359-4541381 GGGCTGGACTGCAGGGATGGGGG - Intronic
1143432953 17:6900268-6900290 GAGGAGGTGTGCAGGGATCGGGG - Intronic
1144481234 17:15630725-15630747 GAGGAGGACTGCTTGAGTGTGGG + Intronic
1144485645 17:15662037-15662059 GAGCTGGAGTGCATGGATGTCGG - Intronic
1144917080 17:18733006-18733028 GAGGAGGACTGCTTGAGTGTGGG - Intronic
1145051610 17:19666222-19666244 GAGGATGACTCCTGGGATTTTGG + Intronic
1145875930 17:28318398-28318420 GGGGAGGACTCGAGGGACGTAGG - Intergenic
1147257835 17:39192660-39192682 GAGGAGGACTGCAGGGATGTAGG + Intronic
1147343274 17:39768352-39768374 GAGGGGGAGTGCAGGAATGAAGG + Intronic
1147440690 17:40445537-40445559 GAGGTGGACTCCAGGGGTCTGGG + Intronic
1147779355 17:42929033-42929055 GAGGAGGACTCCAGATATCTTGG + Intergenic
1148441071 17:47711855-47711877 GGGGAGGGGTGCAGGGAGGTGGG - Exonic
1148790150 17:50168276-50168298 GAAGGGGTGTGCAGGGATGTGGG + Intronic
1149256480 17:54832992-54833014 GAGCAGGACTGCAGGGTCATAGG - Intergenic
1150636972 17:66919828-66919850 CAGGAGGAATGAAGGGATGTGGG - Intergenic
1151389343 17:73775381-73775403 GAGTAGGACTGCATGTATATGGG + Intergenic
1151458755 17:74242239-74242261 CTGGAGGTCTGCAGGGCTGTAGG + Intronic
1152230761 17:79112921-79112943 GGGTAGGACTTCAGGGATGGTGG + Intronic
1153972315 18:10237825-10237847 GAGGCGGAGTGCAGGGTGGTGGG + Intergenic
1154043627 18:10883742-10883764 GGGGAGGATTGGAGAGATGTTGG - Intronic
1154303202 18:13212813-13212835 GAGGAGAATTGCTGGGATGCAGG + Intergenic
1155063136 18:22246277-22246299 GAGGTGGAGGGCAGGGATGGAGG + Intergenic
1155785168 18:29887867-29887889 GAGGAGGACAGAAGGAAGGTAGG - Intergenic
1156267475 18:35501612-35501634 GAGCAGGAGTGCAGGGACCTGGG - Intergenic
1156848555 18:41698805-41698827 GAGGAGGACTATAGGCATTTGGG - Intergenic
1157476854 18:48029215-48029237 GAGAAGGACTGGAGGGCTGGTGG + Exonic
1158009913 18:52716741-52716763 AAGGAGGACTACAGGGAGCTAGG - Intronic
1158102263 18:53842614-53842636 GAGGAGGACTACAGAGAAGCAGG - Intergenic
1158906611 18:62019221-62019243 GAGGTGGAATGAAGGGACGTGGG - Intergenic
1160609781 18:80075982-80076004 GAGGAGGAGTGCAGTGCTCTGGG - Intronic
1160844434 19:1160225-1160247 CAGCCGGGCTGCAGGGATGTGGG - Intronic
1161446149 19:4320391-4320413 GAGGAGGACTTGAGGCCTGTGGG + Intronic
1161964814 19:7541998-7542020 GAGGGGGTTTCCAGGGATGTGGG - Exonic
1162111124 19:8400330-8400352 GAGGAGGAAGGCTGGGATGCTGG - Intronic
1162555131 19:11381842-11381864 TAGGAGCACTGCAGGCATGGGGG + Exonic
1162601566 19:11674004-11674026 CAGGCGCACTGCAGGGAGGTGGG + Intergenic
1162917285 19:13881298-13881320 GAGGAGGCAGGCAGGGGTGTGGG - Intergenic
1163094567 19:15047314-15047336 GAACAGTATTGCAGGGATGTTGG - Intergenic
1163184742 19:15629486-15629508 CTGGAGGACTGCGGGGATCTAGG + Exonic
1163421548 19:17216154-17216176 GAGGAGGTCTGCAGAAATGTGGG - Exonic
1163762587 19:19145713-19145735 GAAGAGGCCTGGAGGGAGGTGGG + Exonic
1164018027 19:21269927-21269949 GAGGATGGCTTCTGGGATGTGGG - Intronic
1164878553 19:31711510-31711532 GGGGAGGACTCCAGGGTTTTGGG - Intergenic
1165927752 19:39337501-39337523 GAGGACAGCTGCAGAGATGTAGG - Intronic
1165949909 19:39468557-39468579 GTGGAGGAGTGCAGGGAGGTGGG + Intronic
1165958647 19:39517084-39517106 CAGGAGGACTGCTTGAATGTAGG - Intronic
1166222643 19:41375622-41375644 GAGGAGTGCTGAAGGGGTGTTGG - Intronic
1166493341 19:43278884-43278906 CAGGAAGACTGCAGGTATGATGG - Intergenic
1167552685 19:50171989-50172011 GAGGTGGACTGGAGGCAGGTTGG - Intergenic
1167742974 19:51335531-51335553 GGGGAAGACTGCAGGGTTGGAGG + Intronic
1168125654 19:54281099-54281121 GAGGAGAAATGCAGGGAAGTAGG + Exonic
1168130255 19:54313155-54313177 GAGGAGAAATGCAGGGAAATAGG + Intergenic
1168171604 19:54593621-54593643 GAGGAGAAATGCAGGGAAATAGG - Intronic
1168348427 19:55661951-55661973 GAGGAGGAGTGTAGGGAGGAGGG - Intronic
925293103 2:2761541-2761563 GAGAAGGGCTGCAGGGTTATAGG - Intergenic
925900448 2:8505541-8505563 GACTAGGACTGCAGGGCTGCTGG - Intergenic
925980177 2:9170302-9170324 GAGGAGTTCTGCTGTGATGTAGG + Intergenic
926010092 2:9400418-9400440 GAGGAGGAAGGCAGGGAGGAGGG - Intronic
927708310 2:25310559-25310581 GAGGCGGAGTGCAGAGCTGTGGG - Intronic
927872377 2:26631779-26631801 CAGGAGGACTGGAGGTATGAGGG + Intronic
928026189 2:27741253-27741275 GAGGGAGACTGCAGGGAGGGAGG - Intergenic
928311811 2:30217605-30217627 GAGGTGAACTGCAGAGAAGTGGG - Intergenic
929009128 2:37423846-37423868 GAAGAGGACTGCTGGGACTTGGG + Intergenic
929314823 2:40464617-40464639 GAGGAGGAATGGAGTGGTGTGGG + Intronic
929863538 2:45699145-45699167 GAGGAGGACAGGAGGGAGTTGGG - Intronic
930696347 2:54415947-54415969 CAGGAGGACAGCAGGGATTAGGG - Intergenic
931962847 2:67501189-67501211 GAGCAGGACCTCTGGGATGTTGG + Intergenic
932048636 2:68376901-68376923 GTGGGGGACTGCAGGGAGGTGGG - Intronic
932135264 2:69223342-69223364 GAGGAAGACTGCAGGGGACTTGG - Intronic
932140574 2:69273686-69273708 GAGGAGGGGTGGAGGGGTGTGGG - Intergenic
932220688 2:69996770-69996792 CATGGGGGCTGCAGGGATGTCGG + Intergenic
932222647 2:70011521-70011543 GAGGAGGACTCCTGGGATTCTGG + Intergenic
932485168 2:72080411-72080433 GTGGTGGGCTGCAGGGATGGGGG - Intergenic
932816342 2:74865170-74865192 GAGGAGGGCTGCAGGGAGGAGGG + Intronic
933832280 2:86220523-86220545 GAGGATGGCAGCAGTGATGTGGG + Intronic
934944791 2:98532291-98532313 GAGGAGGAGTGATGGGATGAAGG - Intronic
935174556 2:100638438-100638460 GGGGAGGGCTGCAGGGATGCTGG - Intergenic
935331151 2:101978936-101978958 GAGGAGGACAGCAGGCCTTTGGG + Intergenic
935690069 2:105723109-105723131 GAGGATGACTGCATGGATACTGG - Intergenic
937207610 2:120246516-120246538 GAGGAGGAAGGAAAGGATGTTGG - Intronic
938406162 2:131034523-131034545 GCGCAGGAATGCAGGGATGGCGG - Intronic
939835504 2:147125240-147125262 GAGGAGGAATTCAGGGCTGCAGG + Intergenic
940092344 2:149934599-149934621 GAGGAGGAAAGCAGCCATGTTGG + Intergenic
941247744 2:163121878-163121900 GCAGAAAACTGCAGGGATGTAGG - Intergenic
943359732 2:186902743-186902765 GAGGCAGACAGCAGGGCTGTTGG + Intergenic
943721849 2:191212738-191212760 GAAAAGGACTTCAGGGGTGTGGG - Intergenic
946488660 2:220126215-220126237 GAGGAGGACTGCAGGGAAGAAGG + Intergenic
947476287 2:230450612-230450634 GAAGAGGACTGGGGAGATGTTGG - Intronic
948217833 2:236244957-236244979 GAGGAGGGCTGCAGTGGTGCTGG + Intronic
949021206 2:241742408-241742430 GATGAGGACAGGAGGGACGTTGG - Intronic
1168820131 20:767320-767342 CACAGGGACTGCAGGGATGTTGG + Intronic
1168923226 20:1558342-1558364 GAGGAGGCCTGCAGGGAAGGCGG + Exonic
1169842709 20:9957585-9957607 GGGGGTGGCTGCAGGGATGTAGG - Intergenic
1170384321 20:15799426-15799448 GAGGAGGAATGAAGGGAGGTTGG - Intronic
1171164031 20:22955150-22955172 CACGAGGACTGCAAGGAGGTAGG - Intergenic
1173083715 20:39894499-39894521 AAGCAGGACTTCAGGAATGTAGG + Intergenic
1173174540 20:40754541-40754563 GAGGAGGGCTGCAAGGGAGTGGG - Intergenic
1173251147 20:41364844-41364866 AAGGAGGACCCCAGGGATTTGGG - Intronic
1173702851 20:45088299-45088321 GAAGAAGAATGCAGAGATGTGGG + Intergenic
1174426591 20:50435923-50435945 GAGGAGCAGAGCACGGATGTTGG + Intergenic
1175314750 20:58039559-58039581 GAAGAGGACAGCAGGGCTGTGGG + Intergenic
1175433212 20:58921901-58921923 GAGGAGGACTGCAGGTAGACGGG - Intergenic
1175935045 20:62510406-62510428 GTGGAGGGGTGCAGGGATGGAGG - Intergenic
1178423575 21:32461110-32461132 GCTGAGAACTGCAGGGATGGAGG + Intronic
1179519287 21:41931839-41931861 GAGGTGGAGTGGTGGGATGTTGG - Intronic
1180599741 22:17008095-17008117 GAGGGGGACGGCAGGGACATGGG + Exonic
1180800915 22:18631473-18631495 GAGGAGGACTGCAGAGGTGTCGG - Intergenic
1180852148 22:19027030-19027052 GAGGAGGACTGCAGAGGTGTCGG - Intergenic
1181086569 22:20442251-20442273 GAGAAGGACTGCTGGGAGGAAGG - Exonic
1181171116 22:21010788-21010810 GCAGAGGGCTGCAGGGCTGTAGG - Intronic
1181220802 22:21363789-21363811 GAAGAGGACTGCAGAGGTGTTGG + Intergenic
1182675318 22:32034701-32034723 GAGAAGGACTAGAGGGATGCTGG + Intergenic
1184745893 22:46455683-46455705 GAGGAGGACTGCAGGGTGTGAGG + Intronic
1184762119 22:46550616-46550638 GAGGTGGACTGCAGGGAATGTGG + Intergenic
1185167409 22:49270132-49270154 GCGCAGGAGTGCAGGGGTGTTGG + Intergenic
1185296235 22:50056689-50056711 GCGGAGGACCCCAGGGGTGTTGG - Intronic
949819127 3:8096021-8096043 GAGGAGGGCTGCAGGAATCTGGG + Intergenic
950489860 3:13297604-13297626 AAGGAGGAGTGCAGAGAAGTTGG - Intergenic
950575695 3:13830816-13830838 AAGGATGACTACAGGGATGTGGG - Intronic
950668153 3:14509594-14509616 CAGGAGGTCTGCTGGGGTGTGGG + Intronic
951123456 3:18956550-18956572 GAGGAAAACTCCAGGGAAGTTGG - Intergenic
953867434 3:46596353-46596375 GAGGAGGCCTGCAGGGGAGCAGG - Intronic
954102387 3:48385105-48385127 GAGGGGGAATGAAGAGATGTTGG - Intronic
954367110 3:50152055-50152077 GAGGAGGACAGAAGGATTGTGGG + Intergenic
954460482 3:50623917-50623939 GAGGAGGACTGAGCAGATGTAGG - Intronic
955466513 3:59242935-59242957 GAAGAGGACTGAAGGGAGGATGG - Intergenic
955724652 3:61920113-61920135 GGGGACGAGTGCAGGCATGTGGG - Intronic
958966205 3:100561708-100561730 GAGGATGACTGGAGGGAGCTTGG - Intronic
959619975 3:108389509-108389531 AAGCAGGACTGGAGGGTTGTGGG - Intronic
960519491 3:118638604-118638626 GATGAGGAAGGCAGGGATTTTGG + Intergenic
961639016 3:128353327-128353349 GAGAAGGACTGCACTGCTGTTGG - Intronic
961919567 3:130411837-130411859 GAGGAGGTCAGCAGGGAAATGGG - Intronic
962599990 3:136984387-136984409 GTGGAGGATTGCATGGAGGTAGG + Intronic
962990342 3:140572245-140572267 GAGGAGCTCTCCAGGGAAGTAGG + Exonic
964090310 3:152868540-152868562 CAGAAGGGCTGGAGGGATGTGGG - Intergenic
964765030 3:160171329-160171351 GAGGATGACTGATTGGATGTGGG + Intergenic
965590892 3:170358490-170358512 GCGGAGGACTTCAGGGTTTTAGG + Intronic
966496061 3:180582058-180582080 GGGGAGGAATGGAGGGATGGTGG + Intergenic
966549430 3:181187771-181187793 CAGGAGGACTACAGGAATTTGGG + Intergenic
967152140 3:186660326-186660348 GAGGAGGAATCCTGGGCTGTGGG - Intronic
968062972 3:195740038-195740060 GGGGAGGCCTGCAGGCATGAAGG - Intronic
968927907 4:3559621-3559643 GATCAGGACTGGAAGGATGTGGG + Intergenic
968936576 4:3614246-3614268 GAGCTGGGCTGCAGGGAGGTGGG - Intergenic
969292781 4:6251526-6251548 GAGCCAGCCTGCAGGGATGTGGG + Intergenic
969297371 4:6277910-6277932 GAGAAGGACTGCAGAGGAGTGGG - Intronic
969534930 4:7750401-7750423 AAGGATGACTGCAGGGTTGCTGG + Intergenic
969705757 4:8790325-8790347 GAGAGGGGCAGCAGGGATGTGGG - Intergenic
969723590 4:8906625-8906647 GACTTGGAATGCAGGGATGTGGG - Intergenic
970439513 4:16068017-16068039 CATGAGGACTGCAGGGGTGCAGG + Intronic
970450099 4:16157750-16157772 TGCGAGGACTTCAGGGATGTAGG - Intergenic
971301552 4:25446300-25446322 GAGGAGAACTGCATGCGTGTGGG + Intergenic
971865166 4:32160501-32160523 AAGGAGGAAGGAAGGGATGTAGG - Intergenic
971891903 4:32535075-32535097 GTGGAGGACTGGAGGGAAGGTGG + Intergenic
975497791 4:75053848-75053870 GAGGAGGGCTGGAAGGATGGGGG - Intergenic
976474261 4:85464871-85464893 GAAGAGTACTGCAGGGAGGGAGG - Intergenic
976560010 4:86490248-86490270 TAGGAGGAATGAAGGAATGTGGG - Intronic
977665502 4:99642991-99643013 AAAGAGGACTGCAGAGCTGTGGG + Intronic
979902621 4:126242111-126242133 GAAGAAGCCTGCAGGAATGTGGG + Intergenic
981551966 4:145951169-145951191 GAGGAGAACAGCAAGGATGCAGG - Intergenic
981603993 4:146522702-146522724 GGGGAGGGCTGCAGGGATCGGGG + Intergenic
981651918 4:147069910-147069932 GAGGAAGACTGCAAGGAAGAAGG - Intergenic
981965213 4:150591882-150591904 GAGGAGCCCTGGAAGGATGTGGG - Intronic
983273659 4:165592084-165592106 GAGAAGGAATGGAGGGATGGAGG - Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985383392 4:189419485-189419507 GAGGAGCACTTCAGGGAAGACGG + Intergenic
985485613 5:146611-146633 AAGGAGAACTGCAGGGTTGGGGG - Intronic
985752879 5:1692379-1692401 GAGGGGGAGTGCAGGTGTGTGGG + Intergenic
986234217 5:5892663-5892685 GAGAAGGACTGCTGGGGAGTCGG + Intergenic
987136414 5:14903612-14903634 GAGAAGGAACGCAAGGATGTTGG - Intergenic
987288741 5:16487862-16487884 GAGGAAGAAAGAAGGGATGTTGG - Intronic
988152908 5:27410527-27410549 GAGGAATACTTCAGGGATGGGGG - Intergenic
988448971 5:31320618-31320640 GAAGAGCACTGCAGGGCTTTGGG - Intronic
988674431 5:33417174-33417196 GAGGAGCAATGCAGTGATGCAGG - Intergenic
991923240 5:71678709-71678731 GAGGTGGGCTGCAGGGATGTAGG - Intergenic
993425036 5:87752744-87752766 GAAAAGTACTGCAGGGCTGTGGG - Intergenic
994586532 5:101716049-101716071 GAGCAAGACTGCATGGGTGTGGG + Intergenic
996496512 5:124162966-124162988 GAGGCGGCATGCAGGGCTGTGGG + Intergenic
997517263 5:134499234-134499256 TGGGAGGACTGCTGGGAGGTGGG + Intergenic
997852629 5:137346316-137346338 GAGGAGGGGTGCAGGGAAGGAGG - Intronic
998046384 5:138990394-138990416 GGGGAGGACTGCTGGGAATTGGG + Intronic
998080532 5:139271592-139271614 CAAGAGGAGTGCAGGGATGGAGG + Intronic
998183423 5:139961351-139961373 GAGGAGGGGGGCAGGGATGGGGG - Intronic
999275163 5:150325370-150325392 GAGGAGGAGAACAGGGATGTAGG + Intronic
1002063045 5:176637738-176637760 GAGGAGGGCTGGAGGGAGGAGGG + Intronic
1002323586 5:178390327-178390349 GAGGAGGACAGCAGGGAGCAAGG + Intronic
1002443473 5:179276021-179276043 AAGGAGGTCAGCAGGGCTGTGGG + Intronic
1002947691 6:1778896-1778918 CAGGAGGGCAGCAGGGGTGTTGG - Intronic
1003134460 6:3423593-3423615 GGGGAGGAATGCAGGGAGGGAGG + Intronic
1003175411 6:3750297-3750319 GAGGAGGACTGCAGAAAAGAAGG + Intronic
1003624115 6:7727124-7727146 GAGGAGGACTGCGGCGACGGCGG - Exonic
1004143650 6:13045048-13045070 TAGGAGGGCTTCAGGGATGAGGG - Intronic
1006253078 6:32807255-32807277 GTGGATGCCTGCAGGGAGGTGGG - Intergenic
1007341458 6:41193821-41193843 GAGGGGGGCTGCAGAGATGAGGG - Intronic
1007341496 6:41193958-41193980 GATGAGGGTTGCAGGGATGAGGG - Intronic
1007407238 6:41642112-41642134 GAGGAGGAGTACAGGGCTGGGGG + Intronic
1007945925 6:45827125-45827147 GAGGAGGAGTGCAGGAAGGGAGG + Intergenic
1007996715 6:46315584-46315606 GATGAGGTCAGCAGGGCTGTTGG + Intronic
1009450244 6:63791598-63791620 AAGAAGAACTGCTGGGATGTGGG + Intronic
1010537213 6:77045849-77045871 GATGAAGACTGCAAGGATGAAGG + Intergenic
1011305715 6:85924101-85924123 GAGTAGAACTTCTGGGATGTGGG + Intergenic
1012690138 6:102300088-102300110 CAGTAGGGCTTCAGGGATGTGGG - Intergenic
1014913309 6:127118609-127118631 GAGGAGGAGGGCAGGGAGGGGGG - Exonic
1015905013 6:138107637-138107659 GAGCGGGACTGGAGGGTTGTGGG - Intergenic
1016723049 6:147324731-147324753 GGGGAGGACAGCAGGGGTGAAGG - Intronic
1017493050 6:154960639-154960661 GAGGAGCACTGCAGGGACAGAGG - Intronic
1017653226 6:156601843-156601865 GTGGGGGCCTGCAGGGCTGTAGG - Intergenic
1017664064 6:156702309-156702331 TAGGAGGACTTCAGGAATCTAGG + Intergenic
1018258747 6:161949019-161949041 GAAGTGGACTGCAGGGCTGCAGG + Intronic
1018850159 6:167581855-167581877 GATGAGGACTGTAGGGAGGCCGG - Intergenic
1019404922 7:877952-877974 GAGGAGGGAGGCAGGGAGGTGGG - Intronic
1019795294 7:3044009-3044031 GAGGAGGGCGGCAAGGAGGTGGG + Intergenic
1019974455 7:4569483-4569505 AAGGAGTGCTGGAGGGATGTGGG - Intergenic
1020220500 7:6232940-6232962 GCAGAGGGCTGCAGGGAGGTAGG - Intronic
1020832601 7:13110304-13110326 GAGAAGCACTGGAGGGAGGTTGG - Intergenic
1021610495 7:22453065-22453087 GAGAAAGACTGCAGGGGAGTTGG - Intronic
1022114184 7:27248281-27248303 GTGGAGGACAGCAGGGAGGAAGG + Intergenic
1022471253 7:30682942-30682964 GAGGAGGCCTGGAGGGAAGCAGG + Intronic
1022473321 7:30694823-30694845 GAGGAGGAGTGCAGAGGAGTAGG + Intronic
1022476398 7:30713479-30713501 GACCAGGACAGCAGGGATGCAGG - Intronic
1022533878 7:31083897-31083919 GGGGAGGGATGCAGGGATGCTGG + Intronic
1022803562 7:33799076-33799098 GAGCATCACTGCAGGCATGTAGG - Intergenic
1023927080 7:44677334-44677356 GAAGAGGTGTGCAGGGGTGTGGG + Intronic
1024326702 7:48114679-48114701 GAGAAGGAGGGCAGGGATGCAGG - Intergenic
1025248902 7:57338621-57338643 CAGGCTGAGTGCAGGGATGTAGG + Intergenic
1025859251 7:65311162-65311184 TGGAGGGACTGCAGGGATGTGGG - Intergenic
1026815968 7:73512147-73512169 AAGGTGGACTGGAGGGCTGTGGG - Intronic
1026877963 7:73890553-73890575 GAGGGGGTCTGCAAGGAAGTGGG - Intergenic
1027267763 7:76503640-76503662 GGGGCAGACTGCTGGGATGTGGG - Intronic
1029203016 7:98851616-98851638 GAGGAGGGCTGCAGGGAAATGGG + Exonic
1029438267 7:100574273-100574295 GTGGACGACAGCAGCGATGTAGG + Intronic
1029711452 7:102302245-102302267 GCCGAGGCCTGCAGGGATGAGGG + Intronic
1030243883 7:107360094-107360116 GCTGAGGGCTGCATGGATGTCGG + Intronic
1031359713 7:120834451-120834473 GATGAGGGCTGCAGGGAGGCTGG + Intronic
1031521271 7:122769418-122769440 GAGGTGGAGTGAAGGAATGTAGG - Intronic
1032172912 7:129600612-129600634 GCGGGGGACTGAAAGGATGTGGG - Intergenic
1032415679 7:131733607-131733629 GAGGAGGCCTGCAGGGTTTGAGG + Intergenic
1032809283 7:135394226-135394248 GAGGAGTTCTGAAGAGATGTGGG + Exonic
1032870165 7:135976936-135976958 GAGCTGGACTGCGGGGATGGGGG - Intronic
1033025553 7:137768713-137768735 GAGGAGGAAGGCAAGGATATGGG - Intronic
1033033696 7:137850729-137850751 GTGAGGGACTGCAGGGATGGAGG - Intergenic
1034538423 7:151740264-151740286 GAGCAACCCTGCAGGGATGTAGG - Intronic
1034695613 7:153050722-153050744 GTGGAGGACTGGGGAGATGTTGG - Intergenic
1034994878 7:155571160-155571182 GAGGAGGAGGGCCGGGATGGGGG - Intergenic
1035239961 7:157523169-157523191 GAGGTGGGCAGCAGGGATGGTGG + Intergenic
1035260592 7:157659288-157659310 GAGGATGACTGCGGGGACGGGGG + Intronic
1035260615 7:157659333-157659355 GGGGACGACTGCGGGGATGGGGG + Intronic
1035316018 7:157997936-157997958 GGAGAGGAGTGCAGGGAGGTGGG + Intronic
1035573150 8:687586-687608 GAGCAGGACTGGAGGGAGGCGGG + Intronic
1035712399 8:1728805-1728827 GAGGAGCAATGCACAGATGTTGG + Intergenic
1036005234 8:4654552-4654574 GGGGAGGAATGGAGGGATGTTGG + Intronic
1042050346 8:64697568-64697590 GAGGAGGGCTGAAGGAATGAAGG + Intronic
1042669600 8:71246966-71246988 GAGAAGTTCTGGAGGGATGTGGG - Intronic
1042835196 8:73073211-73073233 ACGGAAGACTGCAGGGAAGTAGG - Intronic
1043737670 8:83768318-83768340 GCTGAGGGCTGCAGAGATGTTGG - Intergenic
1045651570 8:104346352-104346374 CAGGAGGACTGCGGGCAGGTGGG - Intronic
1046727191 8:117688767-117688789 GAGGAGGCCTGAAGGTATTTCGG - Intergenic
1047026989 8:120835088-120835110 GATGAGGCCTGGAAGGATGTGGG - Intergenic
1048539768 8:135332164-135332186 AAAGAAGACTGCTGGGATGTGGG + Intergenic
1049148115 8:141017034-141017056 GCGGAAAACTGCAGGGATGCCGG - Intergenic
1050696594 9:8286186-8286208 GAGGAGGAAGGAAGGAATGTTGG - Intergenic
1051326508 9:15977028-15977050 CAGGAGGACTGGAGGAATGGAGG - Intronic
1052163094 9:25289980-25290002 GAGGAGGAATTCTGGGCTGTGGG - Intergenic
1053802765 9:41774702-41774724 GATCAGGACTGGAAGGATGTGGG + Intergenic
1054142479 9:61540368-61540390 GATCAGGACTGGAAGGATGTGGG - Intergenic
1054191068 9:61986048-61986070 GATCAGGACTGGAAGGATGTGGG + Intergenic
1054462223 9:65471518-65471540 GATCAGGACTGGAAGGATGTGGG - Intergenic
1054647300 9:67601669-67601691 GATCAGGACTGGAAGGATGTGGG - Intergenic
1054922076 9:70553107-70553129 GATGAGGACAGCAGGGGTGAAGG - Intronic
1055795283 9:79968968-79968990 GGTGAGGACAGCAGGGATCTAGG - Intergenic
1056260058 9:84839978-84840000 AAGGAGGAAGGGAGGGATGTTGG - Intronic
1056691693 9:88813461-88813483 CAGGAGGCCTGATGGGATGTGGG - Intergenic
1056788537 9:89610569-89610591 GAGGAGGAAGGGAAGGATGTGGG - Intergenic
1057269823 9:93644589-93644611 GAGGAGGACAGCAGGGAACAGGG - Intronic
1057444377 9:95103636-95103658 CAGGAGAACCGCAGGGACGTTGG + Intronic
1057817509 9:98306440-98306462 GAGGTGGGCTGCAGGGAGGGAGG + Intronic
1058538300 9:105985962-105985984 GAGTAAGATTACAGGGATGTCGG - Intergenic
1058592934 9:106584572-106584594 GTAGAGGAGTGCAGGGATGAGGG + Intergenic
1059379973 9:113915476-113915498 GAGGAGGTGTGCAGGCTTGTGGG + Intronic
1059418633 9:114177421-114177443 GAGGAGGACTGCAGAGGGGAGGG + Intronic
1059711794 9:116874360-116874382 GAGGAGGACTCTAGGCATGCAGG - Intronic
1061036819 9:128118803-128118825 AAGGAGGGGTGCAGGGATGGAGG + Intergenic
1061213923 9:129209313-129209335 GAGGAGGGCTGCAGAGAGGGAGG + Intergenic
1061764259 9:132871476-132871498 GCGGTGGAGTGCAGGGCTGTGGG + Intronic
1062250192 9:135589987-135590009 GGGGAGGCCGCCAGGGATGTGGG - Intergenic
1062533485 9:137011651-137011673 GGAGAGGACGGCAGGGAAGTTGG + Exonic
1185603592 X:1354959-1354981 GAGGAGGACTGGGGGGAGGAAGG + Intronic
1186477171 X:9866587-9866609 CAGGAGTTCTGCAGAGATGTAGG + Intronic
1188041044 X:25369924-25369946 CAGTAGGACTCCAGGGATGTGGG + Intergenic
1188603989 X:32005610-32005632 GAGGAGAACTACAGAGATGGGGG + Intronic
1188972599 X:36636133-36636155 GAGGGGGAATGACGGGATGTGGG - Intergenic
1189249952 X:39593110-39593132 GAGAAAGACTGAAGGGAGGTTGG - Intergenic
1189739977 X:44107499-44107521 GAGGAGGACTTCAAGCATTTTGG + Intergenic
1190666196 X:52697938-52697960 TAGCACGTCTGCAGGGATGTGGG + Intronic
1190673222 X:52760472-52760494 TAGCACGTCTGCAGGGATGTGGG - Intronic
1190734093 X:53243775-53243797 TAGGAAGAGTGCAGGGAAGTGGG + Intronic
1190929441 X:54935185-54935207 GAGGAGGAGAGCAGGGAGGCAGG + Intronic
1191034177 X:56007227-56007249 GAGGATGTCTGCAGGGCTTTTGG + Intergenic
1192669748 X:73127429-73127451 GAGGAGGATTTCGAGGATGTCGG - Exonic
1195146756 X:102026262-102026284 CAGCAGGGCTTCAGGGATGTGGG - Intergenic
1197005270 X:121488949-121488971 GAGGAAATCTGCAGGGATGAAGG + Intergenic
1199550438 X:149056165-149056187 GAGGAGAGTTGCATGGATGTTGG + Intergenic
1200273867 X:154713375-154713397 GAGGATGGCTGCAGGGAGGAGGG + Exonic
1200322587 X:155205434-155205456 AAGGAGGACTGCAAGGCTTTTGG - Intronic