ID: 1147258462

View in Genome Browser
Species Human (GRCh38)
Location 17:39195715-39195737
Sequence TCCTCCCCAAGGGGGCAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 225}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147258456_1147258462 4 Left 1147258456 17:39195688-39195710 CCTCTCTCACAATCACAGTAGCT 0: 1
1: 0
2: 1
3: 21
4: 197
Right 1147258462 17:39195715-39195737 TCCTCCCCAAGGGGGCAAGAGGG 0: 1
1: 0
2: 0
3: 17
4: 225
1147258453_1147258462 29 Left 1147258453 17:39195663-39195685 CCCAGACAGGACTTTTTCTCAGC 0: 1
1: 0
2: 1
3: 22
4: 173
Right 1147258462 17:39195715-39195737 TCCTCCCCAAGGGGGCAAGAGGG 0: 1
1: 0
2: 0
3: 17
4: 225
1147258455_1147258462 5 Left 1147258455 17:39195687-39195709 CCCTCTCTCACAATCACAGTAGC 0: 1
1: 0
2: 1
3: 13
4: 186
Right 1147258462 17:39195715-39195737 TCCTCCCCAAGGGGGCAAGAGGG 0: 1
1: 0
2: 0
3: 17
4: 225
1147258454_1147258462 28 Left 1147258454 17:39195664-39195686 CCAGACAGGACTTTTTCTCAGCT 0: 1
1: 0
2: 0
3: 13
4: 167
Right 1147258462 17:39195715-39195737 TCCTCCCCAAGGGGGCAAGAGGG 0: 1
1: 0
2: 0
3: 17
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147258462 Original CRISPR TCCTCCCCAAGGGGGCAAGA GGG Intronic