ID: 1147260749

View in Genome Browser
Species Human (GRCh38)
Location 17:39208708-39208730
Sequence AGGGAGATGCAGAAAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147260749_1147260758 17 Left 1147260749 17:39208708-39208730 CCCTCCTCTTTCTGCATCTCCCT No data
Right 1147260758 17:39208748-39208770 CATCCCACACAGTACAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147260749 Original CRISPR AGGGAGATGCAGAAAGAGGA GGG (reversed) Intergenic
No off target data available for this crispr