ID: 1147262583

View in Genome Browser
Species Human (GRCh38)
Location 17:39217289-39217311
Sequence CTGTGTGAGGGGTAGGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 1, 2: 4, 3: 27, 4: 322}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147262583_1147262592 -9 Left 1147262583 17:39217289-39217311 CCCAGCACCTACCCCTCACACAG 0: 1
1: 1
2: 4
3: 27
4: 322
Right 1147262592 17:39217303-39217325 CTCACACAGTCAGGGTATGAGGG 0: 1
1: 0
2: 1
3: 12
4: 136
1147262583_1147262591 -10 Left 1147262583 17:39217289-39217311 CCCAGCACCTACCCCTCACACAG 0: 1
1: 1
2: 4
3: 27
4: 322
Right 1147262591 17:39217302-39217324 CCTCACACAGTCAGGGTATGAGG 0: 1
1: 0
2: 2
3: 6
4: 144
1147262583_1147262593 -2 Left 1147262583 17:39217289-39217311 CCCAGCACCTACCCCTCACACAG 0: 1
1: 1
2: 4
3: 27
4: 322
Right 1147262593 17:39217310-39217332 AGTCAGGGTATGAGGGAGCACGG 0: 1
1: 0
2: 2
3: 38
4: 343
1147262583_1147262594 23 Left 1147262583 17:39217289-39217311 CCCAGCACCTACCCCTCACACAG 0: 1
1: 1
2: 4
3: 27
4: 322
Right 1147262594 17:39217335-39217357 GCCAGAGTCGTTAGTAAACATGG 0: 1
1: 0
2: 0
3: 3
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147262583 Original CRISPR CTGTGTGAGGGGTAGGTGCT GGG (reversed) Intronic
900584578 1:3426310-3426332 ATGTGTTAGGGGCTGGTGCTGGG - Intronic
900598710 1:3493984-3494006 CTGTGAGAGGGGTGAGTGCTTGG - Exonic
901090057 1:6634991-6635013 CTGTGTCAGGGCTAGGCCCTGGG + Exonic
902469967 1:16642485-16642507 CTGGGTGTGGAGTAGGTGCCAGG + Intergenic
902647674 1:17813258-17813280 CTATGTGAGTTGTAGGTGTTTGG + Intronic
903007601 1:20308936-20308958 CTGTCTGCGGGGTAGGTGCCAGG - Intronic
903049946 1:20593216-20593238 CTGTGTGCTGGGGACGTGCTGGG + Intronic
905274107 1:36806065-36806087 CTGTGGGAGGGGTGGGTGTGTGG - Intronic
905884817 1:41485916-41485938 CTGTGTGCAGGGTAGGTGTCAGG - Intergenic
907474432 1:54695971-54695993 GTGTGTGTTGGGGAGGTGCTAGG + Intronic
908162677 1:61426476-61426498 CGGTTTGCGGGGGAGGTGCTGGG - Exonic
909002510 1:70236177-70236199 CTGGGTGATGGGTACATGCTTGG - Intronic
909149787 1:71987417-71987439 CTGTGGAAGGGGTAGGTGAAGGG + Intronic
909236715 1:73161975-73161997 CTGTGTGAGGGGGTGGTACAGGG + Intergenic
910091779 1:83473002-83473024 GTTTGTGAGTGGTAGGTGGTGGG - Intergenic
911090093 1:94011159-94011181 CTGTGGCAGGGGCTGGTGCTAGG - Intronic
912511127 1:110190811-110190833 CTGAGTCAGGAGTTGGTGCTGGG + Intronic
915658279 1:157380044-157380066 CTGTCGGAAGGGGAGGTGCTGGG + Intergenic
915670733 1:157486645-157486667 CTGTCAGAAGGGGAGGTGCTGGG - Intergenic
916869184 1:168893798-168893820 CTGTGTGAGGAGTATGTTGTAGG - Intergenic
917336041 1:173925250-173925272 CTGTGTTAGGAGTAGGTTCAAGG + Intergenic
918074426 1:181159633-181159655 CTGTGTGATGAGTTGGTGCCAGG + Intergenic
918475508 1:184919917-184919939 CTGGGGGAGGGGGAGGTGTTGGG + Intronic
920825874 1:209423856-209423878 CTGGGTGAGGGGGAGGTGTGGGG + Intergenic
922325807 1:224527156-224527178 GTGTGTGGGGGACAGGTGCTTGG + Intronic
922414059 1:225403973-225403995 CTGTGGGAGCTGGAGGTGCTTGG - Intronic
922979505 1:229813744-229813766 CTCTCTGAGAGGAAGGTGCTAGG - Intergenic
924089217 1:240485583-240485605 GTGTGTTAGGGGTAGGTGTGGGG - Intergenic
924686299 1:246294233-246294255 CTGAGTGAGTGCTATGTGCTGGG - Intronic
1064164495 10:12974568-12974590 GGATGTGTGGGGTAGGTGCTGGG + Intronic
1065138112 10:22692564-22692586 CTGTGAAAGGGGTAGGCACTTGG + Intronic
1067079380 10:43204674-43204696 GCGGGGGAGGGGTAGGTGCTCGG + Intronic
1067479460 10:46585475-46585497 CTGTGTGAGGGGTGGGGCCCTGG + Intronic
1067615278 10:47756323-47756345 CTGTGTGAGGGGTGGGGCCCTGG - Intergenic
1068103220 10:52581787-52581809 CTGTGTGAAGCCTAGGAGCTTGG - Intergenic
1071508163 10:86245334-86245356 CTGTCTGAGGGGTAGGTGCTGGG - Intronic
1071630679 10:87216274-87216296 CTGTGTGAGGGGTGGGGCCCTGG - Intergenic
1071946653 10:90653485-90653507 GTGTGTGAGGGGAAGCTGCAAGG - Intergenic
1072004235 10:91227763-91227785 ATGTGTGAGTGTTAGGTGGTAGG - Intronic
1072736563 10:97883213-97883235 CCGTGTGAGGGAGAGGTTCTTGG - Intronic
1073028472 10:100506069-100506091 CTCTGTGATGGGTAGGAGCTGGG - Exonic
1074372729 10:112913366-112913388 GTGTGTGAGGGGTGGGTGTGTGG + Intergenic
1074658270 10:115619464-115619486 TTGTGTCAGGGGTGGGTGCTGGG + Intronic
1075862893 10:125692723-125692745 CTTTTTGAGGGGAAGATGCTGGG + Intergenic
1076480748 10:130783745-130783767 CTGTGTGAGGGGGTGCTGGTGGG + Intergenic
1076864176 10:133159331-133159353 CTGGGAGTGGGGCAGGTGCTGGG - Intergenic
1077871718 11:6268507-6268529 CTGTGTGAGGCAGAGGGGCTGGG - Intronic
1078672304 11:13376318-13376340 CTGTGTGAGGGGCCGGGGCTAGG + Intronic
1078958293 11:16229070-16229092 CTATGTGATGGGTAGGTGCTAGG - Intronic
1080007298 11:27423431-27423453 GTGTGTGTGGGGTATGTGTTTGG - Intronic
1080034684 11:27699774-27699796 CTGACTGAGGGGAGGGTGCTGGG - Intronic
1080663503 11:34315870-34315892 CACTGTGAGGGGTAGATGCCTGG - Intronic
1082117416 11:48342529-48342551 CTGTGTGGGGGATGGGGGCTAGG - Intergenic
1083342300 11:61966875-61966897 CTGTGTGTGGCGGAGCTGCTGGG - Intronic
1084057232 11:66643379-66643401 CAGTGTCTGGGGTAGGGGCTGGG + Intronic
1085048288 11:73365925-73365947 CTGTGTCTGGGGGAGGTGGTGGG - Exonic
1087116696 11:94533091-94533113 CTTTGTAAGGGGTAGGGGCTGGG - Intergenic
1087822851 11:102731161-102731183 CGGTGTGAGGAGTGGGTGCGTGG - Intergenic
1089042966 11:115471330-115471352 CTGTTTGAGCAATAGGTGCTTGG - Intronic
1090244602 11:125206966-125206988 CTGTGAGAGAGGGAGGGGCTGGG + Intronic
1091321779 11:134656982-134657004 CTGTGAGTGTGGGAGGTGCTCGG + Intergenic
1094057225 12:26279786-26279808 CTTTGTGAGAGGCAGGTGGTAGG - Intronic
1094082144 12:26548638-26548660 TTCTGTGAGGGCTATGTGCTGGG + Intronic
1095958297 12:47819044-47819066 CTGTGTGAGGGGTGGGGGACAGG - Intronic
1096465974 12:51848066-51848088 GTGTGGGAGGGGTGGGGGCTGGG - Intergenic
1096498453 12:52051734-52051756 CTGGGTGCGGGGTAGGAGGTAGG + Intronic
1097143106 12:56919722-56919744 CTGTCTGAGGGTAAGGGGCTAGG + Intergenic
1097185127 12:57192659-57192681 CTGTGGGAGGGCCAGGTGCATGG - Intronic
1097966463 12:65586829-65586851 CTGTGTCTGGGCTAGGTTCTGGG + Intergenic
1098084150 12:66823732-66823754 CTGTGAGTGGTGTAAGTGCTAGG - Intergenic
1098105783 12:67068696-67068718 CCGTCTGTGGGGTGGGTGCTGGG - Intergenic
1098846507 12:75543318-75543340 ATATGTGAGGGGTAGGTGTGGGG + Intergenic
1100029285 12:90166204-90166226 CTAAGTGAGGGGTAGGAGGTGGG - Intergenic
1102456696 12:113075343-113075365 CTGTGTGAGAGGGAAGGGCTGGG + Intronic
1103023466 12:117555100-117555122 CTGGGTGAGGGGTAGGAGGGAGG - Intronic
1103189703 12:118990943-118990965 CTGGGTGCGGGGTGGGTACTTGG - Intronic
1104908197 12:132226685-132226707 CAGTGTGTGGGGTGGGTGTTTGG - Intronic
1106016963 13:25878795-25878817 CAGAGTGAGTGGAAGGTGCTGGG - Intronic
1106463851 13:29995510-29995532 GTGTGTGAGGGGCAGGAGGTGGG + Intergenic
1106463956 13:29996280-29996302 ATATGTGAGGGGTAGGAGGTGGG - Intergenic
1108800068 13:54084095-54084117 CTGTGTGACTGGCAGGTGGTCGG - Intergenic
1109548535 13:63860798-63860820 CAGTGGGAGGGGTAGGTGGGTGG - Intergenic
1109993200 13:70086337-70086359 CTTTGGGAGGCCTAGGTGCTTGG + Intronic
1110293992 13:73840866-73840888 CTTTGTGAGGAGGAGCTGCTAGG - Intronic
1110540818 13:76704987-76705009 CTGTGAGGGGGGTAGGGGGTAGG + Intergenic
1111664488 13:91249847-91249869 CTGTGCCAGGGGCTGGTGCTGGG - Intergenic
1112860441 13:103824110-103824132 CTGTCGGTGGGGTAGGGGCTGGG - Intergenic
1112917755 13:104572206-104572228 GTGTGTGAGAGGCAGGTGCTGGG - Intergenic
1113227885 13:108178747-108178769 CTGTGTGAAGGCTAGCAGCTTGG - Intergenic
1113770336 13:112904174-112904196 CTGGGGTAGGGGTAGGTGTTAGG + Intronic
1114454734 14:22847252-22847274 CTCAGTGAGGGGCAGGAGCTGGG + Exonic
1116787756 14:49306952-49306974 ATGTGTGAGGGGTTGGTATTGGG - Intergenic
1117149581 14:52871954-52871976 CTGTGTGAGGAAGAGGTGTTGGG + Intronic
1117608147 14:57453363-57453385 ATATGTGAGGGGTTGGTTCTAGG + Intergenic
1117881178 14:60315051-60315073 CTGTGAGTGTGGCAGGTGCTCGG + Intergenic
1121050195 14:90815431-90815453 GTGGGTGAGGGGTTGGTGCCTGG - Intronic
1122075097 14:99230771-99230793 GTGTGTGAGGGGTGGGGGCGGGG - Intronic
1122075303 14:99231602-99231624 CTGTGTGAGGGGCACGGGGTGGG + Intronic
1122652137 14:103231878-103231900 CTCTGCCAGGGGTGGGTGCTTGG - Intergenic
1124577767 15:30924853-30924875 CTTTGTGAGGGGCAGCTGCTGGG + Intronic
1125751245 15:42030575-42030597 CTGTGTGAGAGGGAGATGGTGGG + Intronic
1126033690 15:44526780-44526802 CTGTGTGAGCTGAAGGGGCTGGG - Exonic
1126775955 15:52100677-52100699 CTGTGTGATGTGTGGGTTCTGGG + Intergenic
1127007180 15:54583804-54583826 CTGTGTGATGTGTGGGTTCTGGG - Intronic
1128332402 15:66764058-66764080 CTGAGTGAGTGGTGGGTGATTGG + Intronic
1128468079 15:67929398-67929420 CTGTGTGATGGTTAGGTGTATGG - Intergenic
1128702526 15:69814584-69814606 CTGTGTGCTGGGAAGGTGTTAGG - Intergenic
1129234368 15:74214944-74214966 CTGGGCGAGGGATAGGTGCCTGG - Intergenic
1131075127 15:89490727-89490749 CTGCGTGGGAGGGAGGTGCTGGG + Intronic
1132463956 16:69073-69095 CTCTCTGAGGGGCAGGAGCTGGG + Intronic
1132875396 16:2134939-2134961 AGGTGTGAGGGGTAGGGGCAGGG - Intronic
1134062378 16:11206827-11206849 TTGAGTGAGGGCTAGGTGCCAGG - Intergenic
1134519588 16:14912421-14912443 AGGTGTGAGGGGTAGGGGCAGGG + Intronic
1134554343 16:15153814-15153836 AGGTGTGAGGGGTAGGGGCAGGG - Intergenic
1134707260 16:16311077-16311099 AGGTGTGAGGGGTAGGGGCAGGG + Intergenic
1134960281 16:18401048-18401070 AGGTGTGAGGGGTAGGGGCAGGG - Intergenic
1136248717 16:28989847-28989869 CTGCGGGAGGGGCAGGAGCTGGG + Intronic
1136393880 16:29982549-29982571 CTGTCTGGGGAGTAGGTACTGGG + Intronic
1136610721 16:31363348-31363370 CTGTGGGAGGGGCTGATGCTGGG - Exonic
1138449439 16:57084649-57084671 CTGTGTGAAGTATGGGTGCTTGG - Intergenic
1138531448 16:57636558-57636580 CTATGTGAGGGGTAGGGGATAGG - Intronic
1139641300 16:68293632-68293654 CTGTGTGAGAAGAGGGTGCTGGG - Intronic
1139827109 16:69766116-69766138 CTGTCTGAGGGGCAGGTGTAGGG - Intronic
1140067856 16:71626015-71626037 CTGTGTGCTGGGTGGGGGCTGGG - Intergenic
1141272490 16:82553960-82553982 GTGTCTGATGGGTAGGGGCTAGG - Intergenic
1141383123 16:83593873-83593895 CTGTGGTAGTGGTAGGTGCTGGG + Intronic
1142066925 16:88068020-88068042 GTGTGTGATGAGGAGGTGCTTGG + Intronic
1142502274 17:339777-339799 CTGGGTGTGTGGCAGGTGCTCGG - Intronic
1142557471 17:789670-789692 CAGTGTGAGAGCTACGTGCTGGG + Intronic
1143143141 17:4754469-4754491 GTGTGTGTGGGGTAGGGGCAGGG - Intergenic
1143382761 17:6506864-6506886 CTGTGGGAGGGGTGCATGCTTGG - Intronic
1143537463 17:7549695-7549717 CTGTGTGAGGGGTTTGTGCTGGG + Intronic
1145230476 17:21170032-21170054 CTGGTTGAGGGGTGGGGGCTTGG - Intronic
1146209470 17:30930881-30930903 CTATGTGCTGAGTAGGTGCTAGG + Intronic
1146283503 17:31559736-31559758 CTGGGGGAGGGGGAGGTGCGGGG - Intergenic
1146890418 17:36503010-36503032 CTGTCTTAGGGCTAGGGGCTGGG - Intronic
1147177020 17:38662312-38662334 CTCTGTGGAGGGCAGGTGCTGGG - Intergenic
1147262583 17:39217289-39217311 CTGTGTGAGGGGTAGGTGCTGGG - Intronic
1147381967 17:40061694-40061716 GTGTGTTAGGGGGAGCTGCTCGG - Intronic
1147573706 17:41586871-41586893 CTGAGTGAAGAGAAGGTGCTCGG + Exonic
1147887031 17:43691086-43691108 GTGTGTGAGGGGTGGGGGCAGGG + Intergenic
1148351542 17:46945093-46945115 CTGTGAGAGGGCGAGGTGATGGG + Intronic
1149107998 17:52992373-52992395 CTGTATCAGGGGTTGGTGTTGGG + Intergenic
1149244439 17:54688789-54688811 CTGAGTAAGACGTAGGTGCTGGG - Intergenic
1150287389 17:63961884-63961906 CTCTGTGAGGCGGAGGAGCTTGG - Intronic
1150606529 17:66696115-66696137 CTGTGTGATGATTAGATGCTAGG + Intronic
1151376371 17:73691577-73691599 CTGTATGAGGGAAAGCTGCTGGG - Intergenic
1151834309 17:76573174-76573196 AGGTATGAGGGGTAGGAGCTGGG - Exonic
1152856449 17:82667462-82667484 CTGTGGGAGGGAGGGGTGCTCGG - Intronic
1152887950 17:82863583-82863605 CTGGTTGAGGGGTTAGTGCTCGG + Intronic
1153703488 18:7720629-7720651 CTGGGGGATGGGGAGGTGCTGGG - Intronic
1156296658 18:35797853-35797875 CTGTGTGCCAGGTAAGTGCTAGG - Intergenic
1156474250 18:37395590-37395612 GTGAGTGAGGGGTGGATGCTAGG + Intronic
1158696986 18:59712381-59712403 TGGTGTGGGGGGTAGGGGCTTGG + Intergenic
1158714669 18:59867521-59867543 GGGTGTGAGGGGGTGGTGCTGGG - Intergenic
1159300108 18:66552783-66552805 CAGTGTGCAGGGTAGGGGCTGGG + Intronic
1160357274 18:78239023-78239045 CTGCGTCAGGGGCAGGTGCCAGG - Intergenic
1160495973 18:79375635-79375657 CTGAGTGAGGGGAAGGGGCCGGG + Intronic
1160954204 19:1682638-1682660 ATGGGTGACGGGGAGGTGCTGGG - Intergenic
1161010583 19:1957787-1957809 GTGTGTGGGGGGTATGTGCTCGG + Intronic
1161572341 19:5037467-5037489 CTGTGTGATGGCAGGGTGCTGGG - Intronic
1161673603 19:5628702-5628724 CAGTGTTTGGGGTAAGTGCTGGG + Intronic
1161983918 19:7643894-7643916 CTGAGTGAGGGGTGGGGCCTTGG + Intronic
1162068257 19:8138454-8138476 CTGTGACAGGGGCAGGTGCTGGG - Exonic
1162588501 19:11576211-11576233 CTGTGGGTGGGGTGGGAGCTGGG - Intronic
1162730527 19:12715786-12715808 CAGTGGGAGGGGGAGGTGCTAGG - Intronic
1163234009 19:16020645-16020667 CTGTGTGAGTGGTTGGTCCAGGG + Intergenic
1163641538 19:18465190-18465212 CTATGTGAGGGATAGGGGGTTGG - Intronic
1163849237 19:19654195-19654217 CGGGGTGAGAGGTAGGGGCTTGG - Intronic
1164157793 19:22607082-22607104 CTGTGTGAGTGGCAGCGGCTTGG + Intergenic
1164694578 19:30233756-30233778 CAATGGGAGGGGTAGGTGGTGGG + Intronic
1165255899 19:34577126-34577148 CCGTGTGAGAGGTGGTTGCTTGG + Intergenic
1165971650 19:39636882-39636904 CTGTGTGAGGTACAGGTGATTGG - Intergenic
1167078830 19:47265465-47265487 CTGTGTGAGGGGTGGGGACCTGG + Intronic
1167339142 19:48904476-48904498 CTGTGGGAGGGGTACGTGCTGGG + Intronic
1167429816 19:49447808-49447830 CCGGGTGAGGGGCAGGTCCTGGG - Exonic
1167631801 19:50630141-50630163 CTGGGTGAGGGGTCGGGGCAGGG + Exonic
925130222 2:1489147-1489169 GTGTGTGCTGGGTATGTGCTGGG - Intronic
925130237 2:1489243-1489265 GTGTGTGCTGGGTATGTGCTAGG - Intronic
925262250 2:2538924-2538946 CTGTGAGAGGGTTTGCTGCTTGG - Intergenic
927601177 2:24442901-24442923 CTTTGTGAGGGGAAGGTGGGAGG + Intergenic
927875539 2:26653033-26653055 CTGTGCAAGGGGTTGGAGCTTGG - Intergenic
928107170 2:28478018-28478040 CTGTGTGAGAGGGAGTGGCTGGG - Intronic
928907237 2:36381107-36381129 CTGTGTGGGGGGTAGGGGCGGGG - Intronic
930541470 2:52712215-52712237 CTGTGTGAGTGGTAGATGTATGG + Intergenic
932144552 2:69306583-69306605 CTGCGTGAGGGGGAGCGGCTGGG - Intergenic
932309513 2:70728432-70728454 CTGTGTGAGGAGTCAGTCCTGGG + Intronic
932414898 2:71567742-71567764 CTTGGTGAGGGGTAGGGGGTGGG + Intronic
932702414 2:74000966-74000988 CTGTATGGGGGGTAGGTGTGAGG + Intronic
933726567 2:85430649-85430671 CTGGGTGAGGGCTAGGAGGTGGG + Intronic
934564042 2:95328652-95328674 CTGTGTGCTGGGGAGGGGCTCGG + Intronic
937310140 2:120897031-120897053 CTGTGTGAGGGAGAGGGGCTGGG + Intronic
940901493 2:159130370-159130392 AGTTGTGAGGGGAAGGTGCTGGG + Intronic
941570293 2:167161602-167161624 CTGTGTGTGGCCTAGGGGCTTGG - Intronic
941926912 2:170904927-170904949 TTGTGTGGGGGGTGGGGGCTTGG + Intergenic
944141584 2:196462670-196462692 CGGGGGGAGGGGTGGGTGCTTGG - Intronic
944804348 2:203266557-203266579 CTGGCTGAGGGGCACGTGCTGGG - Exonic
944964227 2:204911310-204911332 CTGTGTGAGTGCTTAGTGCTTGG + Intronic
945080084 2:206079762-206079784 CTGTGTTAGGGGAAGGAGTTTGG - Intronic
946178330 2:217935433-217935455 CAGGGTGAGGGGTGGGGGCTGGG - Intronic
947132358 2:226941778-226941800 CTGTGTTATGGGTATGTGCATGG - Intronic
947538197 2:230954221-230954243 CTGTGTCAGGGGAAGGGGCAAGG - Intronic
947917286 2:233841185-233841207 CTGTGTGTGGGGTTGGTCTTTGG + Exonic
948807405 2:240458993-240459015 CAGTGTGAGGGAGAGGGGCTGGG - Intronic
1169956431 20:11108192-11108214 CTGGGTGGGGGGTAGGTTCTGGG + Intergenic
1171968943 20:31551379-31551401 CTATGTGAGGAGTCAGTGCTGGG - Intronic
1171994829 20:31723317-31723339 CTGGGTGAGGGTGAGGCGCTGGG + Intronic
1173346393 20:42204674-42204696 CTGAGGGAGGGGTAGGTGGCAGG + Intronic
1175014544 20:55775292-55775314 GTGTGTAGTGGGTAGGTGCTAGG - Intergenic
1175123583 20:56735526-56735548 CTGTGTGCACAGTAGGTGCTCGG + Intergenic
1175855399 20:62118382-62118404 CTGTGTGATGGGAAGTTCCTTGG - Intergenic
1176376867 21:6091182-6091204 CTGCGGGAGGGGAAGATGCTGGG - Intergenic
1176382634 21:6120847-6120869 ATGTGTGGGGCGTAGGTCCTAGG + Intronic
1179740835 21:43417392-43417414 ATGTGTGGGGCGTAGGTCCTAGG - Intronic
1179746608 21:43447062-43447084 CTGCGGGAGGGGAAGATGCTGGG + Intergenic
1179911226 21:44449937-44449959 CTGAGTGAGGGGCAGGGGCTGGG + Intergenic
1180171783 21:46063124-46063146 CTGTGTCAGGGTTTGTTGCTGGG - Intergenic
1181797388 22:25320090-25320112 CTGTGGGTGGGGTGGGGGCTGGG - Intergenic
1182694003 22:32184431-32184453 CTGTGGGAGGGGGAGCTGTTAGG + Intergenic
1183705852 22:39474551-39474573 CAGTGTGCAGGGAAGGTGCTTGG - Intronic
1183952279 22:41358484-41358506 CTGTGTGAGGTGTGGGAGGTGGG + Exonic
1184114997 22:42417152-42417174 CTGTGTGAGGGTGAGGGGCGAGG - Intronic
1184257354 22:43294819-43294841 CTGTGTGAGGGCTTGGGGGTGGG - Intronic
1184453848 22:44598154-44598176 CTCACTGAGGGGTAGGGGCTGGG - Intergenic
1184467214 22:44675942-44675964 CTCTGTGTGGGCGAGGTGCTGGG + Intronic
1184742998 22:46439924-46439946 CTGTGTGAGGGGTGGGAGGGCGG - Intronic
949208317 3:1467311-1467333 ATATGTGAGAGGGAGGTGCTGGG - Intergenic
950112539 3:10428733-10428755 CTGTGTGAGGAGACTGTGCTGGG + Intronic
950264452 3:11563880-11563902 CTGTGGGTGGGGTAGGCCCTGGG - Intronic
950549968 3:13660280-13660302 CTGTGAAAGGGGCAGGTGTTGGG + Intergenic
951204273 3:19909548-19909570 CTGGGGGTGGGGTAGGTGGTGGG + Intronic
952727191 3:36598363-36598385 CTGAGTGATGAGTAAGTGCTAGG + Intergenic
952818967 3:37469382-37469404 CTGTGTGTGTGGTGGGTGGTAGG + Intronic
953004857 3:38968954-38968976 CTGTGTGTGGGGTAGGGACATGG - Intergenic
953253344 3:41265904-41265926 CTATGTGTGTGGTAGGGGCTTGG + Intronic
953463921 3:43103433-43103455 CTGGGTGAGGGGGCAGTGCTGGG - Intronic
953464297 3:43105702-43105724 CGGGGTGAGGGGGAGGTTCTAGG - Intronic
953506478 3:43490789-43490811 GTGTGTGTGGGGGTGGTGCTGGG - Intronic
954396231 3:50294854-50294876 CTGGGTGGGAGGTAGATGCTGGG + Exonic
954456395 3:50601946-50601968 CTGTGGGAGGAGGAGCTGCTGGG - Intergenic
954878416 3:53818284-53818306 CTGTCTGAGGGGATGGTGTTTGG + Intronic
954971118 3:54652531-54652553 ATGTGTGAGGGAGAGGAGCTGGG + Intronic
955093851 3:55777400-55777422 TGGTCTGAGGGGTAGGTCCTTGG - Intronic
955364538 3:58299833-58299855 CTGGCAGAGGGGTGGGTGCTGGG + Intergenic
956126410 3:66015026-66015048 CTGGGTGAGGGGATGGTGGTGGG - Intronic
957384115 3:79472943-79472965 CTAGGTGAGGGGAAGGTGCTAGG + Intronic
959944556 3:112113040-112113062 ATGAGTGAGGAGTTGGTGCTGGG + Intronic
960788500 3:121400214-121400236 CTGGGTGAGAGGTAGGTGGGAGG - Intronic
960847131 3:122014859-122014881 CTGGTTGAGGGGCAGATGCTTGG + Intronic
961531318 3:127542143-127542165 CTGTGGAAGGGCCAGGTGCTGGG - Intergenic
961814677 3:129543406-129543428 GTGGGTGCTGGGTAGGTGCTGGG - Intronic
961819895 3:129570707-129570729 CTGGGTGAGGGGCAGATGCTTGG + Intronic
963076928 3:141355686-141355708 CTGTGTGGGAGGTGGGTGTTTGG - Intronic
963824141 3:149932919-149932941 CTGTGTGGGGGCTATGTCCTGGG + Intronic
964386698 3:156155213-156155235 CTGTGTGAGGGGTGGTGGCAGGG - Intronic
966578658 3:181534116-181534138 CTGCTTGAGGTGTAGCTGCTGGG - Intergenic
966962792 3:184956895-184956917 TTCTGTGAGGGGTAGGTACCAGG - Intronic
968072010 3:195789925-195789947 CTGTGGGAGGAGTATGTGGTGGG + Exonic
969268849 4:6085238-6085260 CTGTGTGAGGTGCCGGTGCGTGG - Intronic
969439164 4:7207329-7207351 CTGTGTGGGCGGGAGGGGCTCGG - Intronic
969442005 4:7222776-7222798 CTGTGTGGGGTGTGGGTGCTGGG + Intronic
970550066 4:17171450-17171472 CTGTGAGAGGGGTAGAAGGTGGG - Intergenic
973180208 4:47257537-47257559 CTGTGTGTGGGGTGGGTGTAGGG + Intronic
974016212 4:56651607-56651629 CACTGTGATGGGTAGGGGCTGGG + Intronic
976604357 4:86968844-86968866 CCATGTGGGGGGTTGGTGCTGGG + Intronic
980420692 4:132556322-132556344 CTGTGTGAGGGGAAAGTGCCAGG + Intergenic
981877188 4:149560941-149560963 CTGTGTGAAGGGTTGCTGTTGGG - Intergenic
984303246 4:177951622-177951644 GTGTGTGAGTGGCAGGTGTTGGG - Intronic
985511834 5:317899-317921 CAGGGTGAGGGGCAGGTGCAAGG - Intronic
985712911 5:1440002-1440024 CTGGGAGAGGGCTTGGTGCTGGG + Intronic
990123475 5:52485088-52485110 CTGTGTTTGGGGTAGGTTTTTGG - Intergenic
991651621 5:68861404-68861426 TTTTTTGAGGGGTAGGGGCTGGG - Intergenic
992416626 5:76558292-76558314 ATGTGTGAGGGGTAGGGGCTGGG - Intronic
993978346 5:94511013-94511035 CTTTGGGAGGGATAGGTGATGGG + Intronic
995035943 5:107534039-107534061 CTGTGTGTGGCTCAGGTGCTGGG - Intronic
996866157 5:128124770-128124792 AGGTGTGAGGGGTGGGAGCTGGG + Intronic
997571940 5:134936295-134936317 CTGTGTGAGAGGCCGGGGCTGGG - Intronic
997967956 5:138374918-138374940 CTATTTGAGGGGTAGATGCTAGG + Intronic
999375983 5:151086884-151086906 CTGGGTGAGGAGCAGGGGCTGGG + Intronic
1000525724 5:162355170-162355192 GTGTGTGGGGGGTAGGGGGTAGG + Intergenic
1001039185 5:168320606-168320628 CTGTGTGTTTGGTAGGTGCTGGG + Intronic
1002194596 5:177495152-177495174 CTGTGTGAGGGCTATGTAGTGGG + Intronic
1002321344 5:178377819-178377841 CTGTGTGTGTGGCAGGAGCTGGG + Intronic
1003165321 6:3672336-3672358 GTGGGTGAGGGGTGGGGGCTGGG - Intergenic
1003891293 6:10565977-10565999 CTGTGTTTGGTGAAGGTGCTGGG - Intronic
1004179096 6:13365461-13365483 GTGTGTGAGGTGCAGGTGCACGG - Exonic
1004563812 6:16776829-16776851 CTGTGTGAGTACTATGTGCTGGG - Intergenic
1004886278 6:20054197-20054219 CTGTCTGCTGGGTAGGTGCGAGG - Intergenic
1006224018 6:32521423-32521445 CTGCGTGAAGGGTGGGTGCCAGG + Intronic
1006407476 6:33853557-33853579 CTGAGTGAGTGGTGGGTGCAGGG + Intergenic
1006446959 6:34084973-34084995 CTGTGTGCAGGGCAGGTGCTAGG + Intronic
1006789087 6:36686839-36686861 CTGTGTTAGGGGTATATGATGGG + Exonic
1007171149 6:39864571-39864593 GTGTGTGGGGGGTGGGGGCTGGG - Intronic
1007359363 6:41344030-41344052 CAGTGTGAGGTGAAGGGGCTTGG - Intronic
1008153820 6:47989510-47989532 CTGTGTGAAGTCTAGGTACTTGG + Intronic
1010250648 6:73703755-73703777 CTGTATAAGGGGTGGGGGCTGGG + Intronic
1012334755 6:98041414-98041436 CTGTGTTAGGGGTTGGAGCTGGG - Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013932914 6:115556562-115556584 CTGAGTGAGGGTTAGGACCTGGG - Intergenic
1015594608 6:134854466-134854488 GTGTGTGTGGGGTGGGTGATGGG - Intergenic
1017270966 6:152504891-152504913 GTGTATGAGGGGTAGGTGACAGG - Intronic
1017717811 6:157224467-157224489 CTGTGTCAAGGGAATGTGCTGGG - Intergenic
1018230318 6:161669211-161669233 CTGGGTGCTGGGAAGGTGCTGGG - Intronic
1019638972 7:2092556-2092578 GTGTGTGAGGGGAGGATGCTCGG - Intronic
1019644378 7:2121220-2121242 CCATGTGAGGTGTAGGCGCTGGG + Intronic
1022109130 7:27217285-27217307 GTGTGTGTGGGGAAGGTGGTGGG + Intergenic
1022493647 7:30839562-30839584 CTGTGAGTGGTGCAGGTGCTGGG + Intronic
1023915043 7:44582356-44582378 CTGTGTGAGGGGGCGGGGCGCGG - Intergenic
1024980446 7:55153526-55153548 CTGTGCGTGGGGTTGGTCCTAGG + Intronic
1024984915 7:55186485-55186507 CTGTGTGATGTGAACGTGCTGGG - Intronic
1025272764 7:57540322-57540344 CCGTGTGAGGTGTCAGTGCTGGG - Intergenic
1026593644 7:71716342-71716364 TGGTGTGAGGGGAAGGGGCTGGG - Intergenic
1026765435 7:73156830-73156852 TTGTGTGAGGGGTGGGGGCGCGG - Intergenic
1027041909 7:74966524-74966546 TTGTGTGAGGGGTGGGGGCGCGG - Intronic
1027081733 7:75235831-75235853 TTGTGTGAGGGGTGGGGGCGCGG + Intergenic
1027173290 7:75888005-75888027 CTCTGTGTGGGGTAGGAGCCAGG - Exonic
1029113165 7:98223666-98223688 TTTTGTGAGGAGGAGGTGCTGGG - Exonic
1029365122 7:100111830-100111852 CTGTGGGAGGGAGAAGTGCTGGG + Intronic
1029390321 7:100270412-100270434 TTGTGTGAGGGGTGGGGGCGCGG + Intronic
1032215059 7:129951699-129951721 CTCTGTGAGGGTCAGGTTCTTGG - Intronic
1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG + Intronic
1034439661 7:151080333-151080355 CTGTGGGAGAGGGAGGTGGTCGG - Intronic
1037849014 8:22310718-22310740 GTGTGTGAGGGGTAAGGGATAGG - Intronic
1038285312 8:26201102-26201124 CTGTGTGATGGTGAGCTGCTGGG + Intergenic
1040489943 8:47910490-47910512 CAGTGGGAGAGCTAGGTGCTGGG - Intronic
1041370639 8:57156596-57156618 ATGTGCCAGGGATAGGTGCTGGG + Intergenic
1041617737 8:59928007-59928029 TTGTGTGAGGGGTAGGTGAGTGG + Intergenic
1042693314 8:71527985-71528007 ATGTGTGAGGGGTGGGGGCGAGG - Intronic
1042874704 8:73430353-73430375 CTGTGAGAGGGGTACCTGGTCGG - Intronic
1044288230 8:90436309-90436331 CTGTGAGAGTTATAGGTGCTGGG - Intergenic
1044686428 8:94830302-94830324 CCATGTGAGGTGTAGGGGCTGGG + Intronic
1049747057 8:144267408-144267430 CTGCATGAGGGGTAAGAGCTAGG + Intronic
1049986951 9:960662-960684 CTGGCTGAGGGGTACGAGCTGGG + Intronic
1050280240 9:4043112-4043134 CTGTGGGAAGGGGAGGGGCTGGG - Intronic
1053006345 9:34607430-34607452 CTGGGGGAGGGGTAGGTGATGGG - Intergenic
1053017051 9:34667835-34667857 TGGTGTGAGGGGCAGATGCTGGG + Intergenic
1055625657 9:78174853-78174875 CTATGTGAGGATGAGGTGCTTGG - Intergenic
1057631162 9:96720013-96720035 GCGTGTCAGGGGCAGGTGCTTGG + Intergenic
1058657838 9:107240570-107240592 CTTTGTGAGGGGGAGGTGGGTGG + Intergenic
1058830705 9:108813780-108813802 CTGTGTGATGGCTAAGGGCTGGG - Intergenic
1059357137 9:113708703-113708725 CAGAGTGAGGGAAAGGTGCTGGG + Intergenic
1060471742 9:123953753-123953775 GGGTGTGAGGGGGAGGAGCTAGG - Intergenic
1060662022 9:125410188-125410210 CTGTGTGTGTGGTATGTGCGTGG - Intergenic
1061216430 9:129224532-129224554 CTGAGTGAGGAGAAGGTACTAGG + Intergenic
1061579566 9:131528858-131528880 CTGTGAGAGGGCTTAGTGCTGGG - Intronic
1062159723 9:135073689-135073711 CTCTGTGAGGAGATGGTGCTGGG - Intergenic
1186112089 X:6269200-6269222 GTGTGTGAGGGGAAGGTGAGCGG - Intergenic
1186394685 X:9195759-9195781 CTGTGTGTTGGGGAGGGGCTGGG + Intergenic
1186481364 X:9898343-9898365 CTGTACGATGGGTGGGTGCTTGG + Intronic
1186966124 X:14788046-14788068 CTGTGTCAGAGGAAAGTGCTAGG + Intergenic
1190266638 X:48831060-48831082 CTGTGTGAGTGGCAGTTTCTAGG - Intergenic
1196655112 X:118209986-118210008 CGGTGTGAGGGGTGGGTGTGTGG + Intergenic
1198419901 X:136460697-136460719 CCGTGGGAGGCCTAGGTGCTTGG + Intergenic
1201338015 Y:12901270-12901292 CTGTGGGAAGCTTAGGTGCTTGG - Intergenic
1201601268 Y:15730801-15730823 CTGGGTGGGGGGTAGGTGGCAGG + Intergenic