ID: 1147265464

View in Genome Browser
Species Human (GRCh38)
Location 17:39231841-39231863
Sequence AAGGGGGTGGAGCCCTGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147265454_1147265464 13 Left 1147265454 17:39231805-39231827 CCAAGGTAACAGCAAGAGCATAA No data
Right 1147265464 17:39231841-39231863 AAGGGGGTGGAGCCCTGCGGAGG No data
1147265452_1147265464 30 Left 1147265452 17:39231788-39231810 CCACAAAGCATCTGTTACCAAGG No data
Right 1147265464 17:39231841-39231863 AAGGGGGTGGAGCCCTGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147265464 Original CRISPR AAGGGGGTGGAGCCCTGCGG AGG Intergenic