ID: 1147265953

View in Genome Browser
Species Human (GRCh38)
Location 17:39234817-39234839
Sequence TCCTGAATAGCTGGGACTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 673572
Summary {0: 1813, 1: 47694, 2: 166890, 3: 225340, 4: 231835}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147265953_1147265960 16 Left 1147265953 17:39234817-39234839 CCTGTAGTCCCAGCTATTCAGGA 0: 1813
1: 47694
2: 166890
3: 225340
4: 231835
Right 1147265960 17:39234856-39234878 TCGTTTTACCCAGAAGGTGGAGG No data
1147265953_1147265959 13 Left 1147265953 17:39234817-39234839 CCTGTAGTCCCAGCTATTCAGGA 0: 1813
1: 47694
2: 166890
3: 225340
4: 231835
Right 1147265959 17:39234853-39234875 GAATCGTTTTACCCAGAAGGTGG No data
1147265953_1147265961 17 Left 1147265953 17:39234817-39234839 CCTGTAGTCCCAGCTATTCAGGA 0: 1813
1: 47694
2: 166890
3: 225340
4: 231835
Right 1147265961 17:39234857-39234879 CGTTTTACCCAGAAGGTGGAGGG No data
1147265953_1147265958 10 Left 1147265953 17:39234817-39234839 CCTGTAGTCCCAGCTATTCAGGA 0: 1813
1: 47694
2: 166890
3: 225340
4: 231835
Right 1147265958 17:39234850-39234872 CAAGAATCGTTTTACCCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147265953 Original CRISPR TCCTGAATAGCTGGGACTAC AGG (reversed) Intergenic
Too many off-targets to display for this crispr