ID: 1147265957

View in Genome Browser
Species Human (GRCh38)
Location 17:39234826-39234848
Sequence GCCTCAGCCTCCTGAATAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 761282
Summary {0: 3459, 1: 93532, 2: 199322, 3: 235334, 4: 229635}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147265957_1147265961 8 Left 1147265957 17:39234826-39234848 CCAGCTATTCAGGAGGCTGAGGC 0: 3459
1: 93532
2: 199322
3: 235334
4: 229635
Right 1147265961 17:39234857-39234879 CGTTTTACCCAGAAGGTGGAGGG No data
1147265957_1147265958 1 Left 1147265957 17:39234826-39234848 CCAGCTATTCAGGAGGCTGAGGC 0: 3459
1: 93532
2: 199322
3: 235334
4: 229635
Right 1147265958 17:39234850-39234872 CAAGAATCGTTTTACCCAGAAGG No data
1147265957_1147265960 7 Left 1147265957 17:39234826-39234848 CCAGCTATTCAGGAGGCTGAGGC 0: 3459
1: 93532
2: 199322
3: 235334
4: 229635
Right 1147265960 17:39234856-39234878 TCGTTTTACCCAGAAGGTGGAGG No data
1147265957_1147265959 4 Left 1147265957 17:39234826-39234848 CCAGCTATTCAGGAGGCTGAGGC 0: 3459
1: 93532
2: 199322
3: 235334
4: 229635
Right 1147265959 17:39234853-39234875 GAATCGTTTTACCCAGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147265957 Original CRISPR GCCTCAGCCTCCTGAATAGC TGG (reversed) Intergenic
Too many off-targets to display for this crispr