ID: 1147265961

View in Genome Browser
Species Human (GRCh38)
Location 17:39234857-39234879
Sequence CGTTTTACCCAGAAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147265955_1147265961 9 Left 1147265955 17:39234825-39234847 CCCAGCTATTCAGGAGGCTGAGG 0: 4324
1: 106582
2: 211547
3: 247830
4: 263605
Right 1147265961 17:39234857-39234879 CGTTTTACCCAGAAGGTGGAGGG No data
1147265953_1147265961 17 Left 1147265953 17:39234817-39234839 CCTGTAGTCCCAGCTATTCAGGA 0: 1813
1: 47694
2: 166890
3: 225340
4: 231835
Right 1147265961 17:39234857-39234879 CGTTTTACCCAGAAGGTGGAGGG No data
1147265957_1147265961 8 Left 1147265957 17:39234826-39234848 CCAGCTATTCAGGAGGCTGAGGC 0: 3459
1: 93532
2: 199322
3: 235334
4: 229635
Right 1147265961 17:39234857-39234879 CGTTTTACCCAGAAGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147265961 Original CRISPR CGTTTTACCCAGAAGGTGGA GGG Intergenic
No off target data available for this crispr