ID: 1147267566

View in Genome Browser
Species Human (GRCh38)
Location 17:39244169-39244191
Sequence CTGTGGTTGTTGAAGCTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147267561_1147267566 9 Left 1147267561 17:39244137-39244159 CCACTTCCTGCAAAGGACACTCT No data
Right 1147267566 17:39244169-39244191 CTGTGGTTGTTGAAGCTTCCAGG No data
1147267556_1147267566 24 Left 1147267556 17:39244122-39244144 CCCCTGGGGACTCCACCACTTCC No data
Right 1147267566 17:39244169-39244191 CTGTGGTTGTTGAAGCTTCCAGG No data
1147267555_1147267566 25 Left 1147267555 17:39244121-39244143 CCCCCTGGGGACTCCACCACTTC No data
Right 1147267566 17:39244169-39244191 CTGTGGTTGTTGAAGCTTCCAGG No data
1147267560_1147267566 12 Left 1147267560 17:39244134-39244156 CCACCACTTCCTGCAAAGGACAC No data
Right 1147267566 17:39244169-39244191 CTGTGGTTGTTGAAGCTTCCAGG No data
1147267562_1147267566 3 Left 1147267562 17:39244143-39244165 CCTGCAAAGGACACTCTCTGCCC No data
Right 1147267566 17:39244169-39244191 CTGTGGTTGTTGAAGCTTCCAGG No data
1147267558_1147267566 22 Left 1147267558 17:39244124-39244146 CCTGGGGACTCCACCACTTCCTG No data
Right 1147267566 17:39244169-39244191 CTGTGGTTGTTGAAGCTTCCAGG No data
1147267557_1147267566 23 Left 1147267557 17:39244123-39244145 CCCTGGGGACTCCACCACTTCCT No data
Right 1147267566 17:39244169-39244191 CTGTGGTTGTTGAAGCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147267566 Original CRISPR CTGTGGTTGTTGAAGCTTCC AGG Intergenic
No off target data available for this crispr