ID: 1147269076

View in Genome Browser
Species Human (GRCh38)
Location 17:39254520-39254542
Sequence AACCATGCCCAGATGCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 164}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147269072_1147269076 28 Left 1147269072 17:39254469-39254491 CCTAGGGTAAGGACTGTCATTTA 0: 1
1: 0
2: 1
3: 9
4: 119
Right 1147269076 17:39254520-39254542 AACCATGCCCAGATGCAGCTGGG 0: 1
1: 0
2: 1
3: 24
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147269076 Original CRISPR AACCATGCCCAGATGCAGCT GGG Intergenic
900660533 1:3780019-3780041 TATCATGCCAGGATGCAGCTTGG - Exonic
902636690 1:17739442-17739464 GACGATGCCCGGGTGCAGCTGGG - Intergenic
903389401 1:22953532-22953554 CACCAGGCCCAGACGCAGCGGGG + Exonic
904672345 1:32175302-32175324 AGCCTGGCCCAGAGGCAGCTAGG - Exonic
905473889 1:38212434-38212456 AACCATATCCTGAGGCAGCTGGG + Intergenic
905890382 1:41515219-41515241 AACCATGCCCAGCTGCCCCGGGG + Intronic
906476711 1:46174340-46174362 CACCATGCCCAGACGGTGCTGGG - Intronic
907015756 1:51011307-51011329 TACCATGCCCAGATACAATTTGG + Intergenic
908100453 1:60785869-60785891 CACCATGCCCGGCTGCACCTGGG - Intergenic
908415193 1:63906588-63906610 AACCCCACCCAGATGCACCTGGG - Intronic
909853972 1:80505039-80505061 AAACACTCCCAGAAGCAGCTTGG + Intergenic
912522899 1:110258659-110258681 AACCCTGCCCAGAGTCACCTAGG + Intronic
914885038 1:151577732-151577754 CGCCATGCCCAGTTGGAGCTGGG - Intronic
915066349 1:153228205-153228227 CACCATTTCCAGAAGCAGCTGGG + Intergenic
916146093 1:161740743-161740765 TAGCAGGCCCAGATGCAGCTTGG + Intergenic
916512193 1:165482273-165482295 AACCATAGCCAGAGGCATCTTGG - Intergenic
917233705 1:172866351-172866373 CACGAAGCCCAGATGGAGCTGGG + Intergenic
917476408 1:175373065-175373087 AAACATGCACAGAAGCAGCATGG + Intronic
920777998 1:208959117-208959139 AAGGGGGCCCAGATGCAGCTTGG + Intergenic
921816027 1:219564363-219564385 AACCATGCACAATTACAGCTGGG + Intergenic
921925325 1:220706217-220706239 GAAGATGCCCAGATTCAGCTAGG - Intergenic
921975189 1:221194497-221194519 AACCATGCCCAGGGGCAGCATGG + Intergenic
923894924 1:238259575-238259597 AAGTGTGCCCAGGTGCAGCTTGG + Intergenic
1066975376 10:42363525-42363547 ATCCATAGGCAGATGCAGCTGGG - Intergenic
1074389568 10:113045506-113045528 CACCATGCCCAGGTGGGGCTGGG - Intronic
1075456377 10:122587650-122587672 AAACACCCCCAGATGCAGCAGGG + Intronic
1076498508 10:130915616-130915638 GGCCAAGCCCAGATGCTGCTGGG + Intergenic
1076532597 10:131154739-131154761 AACCATGGCCAGACACGGCTGGG - Intronic
1082765865 11:57167173-57167195 AACCTTGCTCAGGTGCTGCTGGG - Intergenic
1083431522 11:62615824-62615846 AGCCAGGCCCAGCTGCAGCCAGG + Intronic
1089768424 11:120785274-120785296 GAGCTTGCCCAGATGTAGCTGGG + Intronic
1090357789 11:126151510-126151532 AACCAGGCACAGATGCAGTAGGG + Intergenic
1090925521 11:131246734-131246756 CTCAATGCCCAGATGCAGATGGG + Intergenic
1090979096 11:131701444-131701466 TACCATGCCCAGTTGCTTCTAGG - Intronic
1091079763 11:132655308-132655330 AACCAAGCCCAGGTGCAGGCAGG + Intronic
1092141669 12:6188163-6188185 AACCCACCCCAGATACAGCTGGG + Intergenic
1099091011 12:78308118-78308140 AATCATGCCCAGAGGCAGGCTGG - Intergenic
1100086008 12:90912104-90912126 ATCCATGCCCAGATGCCGTTTGG + Intronic
1103199735 12:119077993-119078015 AACTATGCTCAAATGCATCTAGG + Intronic
1103919325 12:124391201-124391223 CAACATCCCCAGATGCAGGTGGG - Intronic
1104698750 12:130884881-130884903 CACCATGCCCAGCTGTAGATAGG + Intergenic
1106785074 13:33099397-33099419 ATATATGCCCAGATGCTGCTGGG + Intergenic
1109334090 13:60971006-60971028 AACCAGGCCAAGGTACAGCTTGG + Intergenic
1113526391 13:110981148-110981170 ATCCAAGCCCAGTGGCAGCTGGG - Intergenic
1113718474 13:112533016-112533038 AGCCAAGCCCAGAGGCAGCTGGG + Intronic
1115127471 14:30013563-30013585 AACCAGGCCCAGATTCACCTAGG - Intronic
1115223480 14:31080444-31080466 CACCAAGCCCAGAAGCAGGTAGG + Intronic
1118102257 14:62619921-62619943 AATAATGCCCTGATACAGCTTGG - Intergenic
1120162812 14:81163571-81163593 AATCAGGCCCAGATTCAGGTTGG - Intergenic
1123499959 15:20871941-20871963 AACCATACCCATATGCATCCAGG + Intergenic
1123557208 15:21445638-21445660 AACCATACCCATATGCATCCAGG + Intergenic
1123593432 15:21882906-21882928 AACCATACCCATATGCATCCAGG + Intergenic
1124347428 15:28931981-28932003 AGCCATGCCCAGACCCAGTTGGG - Intronic
1127693570 15:61421656-61421678 AAGCATGAACAGATACAGCTTGG + Intergenic
1131350973 15:91699369-91699391 AACCAGGCGCAGTTGTAGCTGGG + Intergenic
1131499357 15:92946774-92946796 CACCATGCCCAGTTGCATTTAGG + Intronic
1131897580 15:97050411-97050433 CCCCATTCCCAGATGCAGCCTGG + Intergenic
1202965553 15_KI270727v1_random:172826-172848 AACCATACCCATATGCATCCAGG + Intergenic
1133356865 16:5143164-5143186 AACCATGCACAGGTCCAGTTAGG - Intergenic
1134895255 16:17880617-17880639 AAACATGCCCTGATGAAGATAGG + Intergenic
1135089301 16:19500167-19500189 CACCATGCCCGGCTGCTGCTTGG + Intergenic
1136654133 16:31699670-31699692 AGCCCTGCCCAGAAGCAGGTGGG + Intergenic
1141569963 16:84928409-84928431 AGTCATGCCCAGATGAACCTGGG - Intergenic
1141668263 16:85477432-85477454 AAACATGCCCACAGCCAGCTGGG + Intergenic
1141912714 16:87070933-87070955 AACCCAGGCCAGTTGCAGCTTGG + Intergenic
1144056135 17:11542288-11542310 AACAATGGCCAGAGGCAGTTGGG + Intronic
1144495407 17:15742230-15742252 AGCCCTGCTCAGCTGCAGCTCGG - Intronic
1147269076 17:39254520-39254542 AACCATGCCCAGATGCAGCTGGG + Intergenic
1148627775 17:49083150-49083172 AAAAACACCCAGATGCAGCTGGG - Intergenic
1148635312 17:49144609-49144631 CACCATGCCCAACTGGAGCTAGG - Intronic
1149758156 17:59205308-59205330 AAACATAACCAGATGCACCTTGG - Intronic
1149758305 17:59206645-59206667 AAACATAACCAGATGCACCTTGG - Intronic
1151540990 17:74764415-74764437 TCCCATGCCCAGAGCCAGCTAGG - Intronic
1151805105 17:76400253-76400275 GACCATGCTCAGCGGCAGCTTGG - Exonic
1152198171 17:78929733-78929755 CACCCAGCCCAGATGCAGCCTGG + Intergenic
1152330930 17:79672654-79672676 CACCATGCTCAGAGGCAGCAAGG - Intergenic
1153597399 18:6741784-6741806 AACCCTGCCCACATCCAGTTTGG + Intronic
1154355981 18:13623592-13623614 CACGATGACCAGAGGCAGCTCGG + Intronic
1155097117 18:22567309-22567331 AACCATTTTCAGATGAAGCTAGG - Intergenic
1159100748 18:63955741-63955763 AACCATGTCGAGATCCATCTAGG + Intronic
1160006600 18:75073173-75073195 ACCCATGCCCAGGAGAAGCTGGG + Intergenic
1160062355 18:75544105-75544127 AACTCTGCCCAGAGGCAGCACGG + Intergenic
1160388917 18:78515544-78515566 AGCCAGGCCAAGATGCGGCTGGG + Intergenic
1161366162 19:3880940-3880962 AGCCCTGCCCGGGTGCAGCTGGG - Exonic
1161509443 19:4662458-4662480 GACCTTGCCCAGATCGAGCTGGG + Intronic
1163010554 19:14422919-14422941 CACCATGCCCAGACCCATCTAGG - Intergenic
925422084 2:3720541-3720563 TACCCTTCCCACATGCAGCTGGG + Intronic
925436366 2:3841680-3841702 AATCATGCCCAGGTGCAGGAGGG + Intronic
926040499 2:9668926-9668948 CACCATGACTGGATGCAGCTGGG - Intergenic
926247868 2:11133788-11133810 AGCCAAGACCAGATGCCGCTGGG + Intronic
926347762 2:11964191-11964213 AACCATGCCCAGAGGCACCTTGG + Intergenic
927864042 2:26577421-26577443 AACCCTGCCCAGGTGCAGCGAGG + Intronic
929869407 2:45745580-45745602 AACCACTCCCAAATGGAGCTGGG + Intronic
930034283 2:47075869-47075891 AGCAATGCCCAGAGGCAGCAGGG - Exonic
930118594 2:47741132-47741154 AATCTTGCCCAGATCCAGATAGG - Intronic
932658997 2:73636035-73636057 AACCCTGCTCAAATGCAACTAGG + Intergenic
934575133 2:95395453-95395475 AACCATGTGCAGAGGCAGCCAGG + Intergenic
935667494 2:105525384-105525406 AAGCACGCACACATGCAGCTTGG - Intergenic
936598652 2:113874048-113874070 AACCATGCCCAGAAGGAATTAGG - Intergenic
937098613 2:119251570-119251592 AGCCATGTGCAGATGTAGCTTGG - Intronic
939146761 2:138425025-138425047 AAGCAGGCTCAGAAGCAGCTGGG + Intergenic
941812097 2:169765392-169765414 AACAATGCCAACATGCAGTTTGG + Intronic
945344651 2:208698877-208698899 AAACATGCACAGATGAAGCAAGG - Intronic
948976414 2:241466372-241466394 AGCCATGACCAGGTGCAGGTGGG + Intronic
1169303183 20:4463982-4464004 AACCATGCCCAGGGCCAGCACGG + Intergenic
1170415347 20:16133521-16133543 AACCTTCTCCACATGCAGCTTGG + Intergenic
1174391299 20:50219956-50219978 AACCATTCCCAGAAGCCCCTTGG + Intergenic
1176112962 20:63418832-63418854 AAGCATGCACGGATGCAGATAGG + Intronic
1184268869 22:43366159-43366181 AACCTTCCTCAGCTGCAGCTTGG + Intergenic
949582573 3:5404588-5404610 AATTATGCCCAGAGGCAACTGGG + Intergenic
952626423 3:35409982-35410004 AACAATGCCCAGCTGAAACTAGG - Intergenic
955399584 3:58581844-58581866 AACCATGTCTAATTGCAGCTGGG - Intronic
955909875 3:63849097-63849119 CACCATGCCCAGGTGAAGCTAGG - Intronic
957998090 3:87716533-87716555 AACAAAGCCCAGATGCTCCTAGG + Intergenic
960387319 3:117035895-117035917 AGCCAAGGACAGATGCAGCTGGG + Intronic
960396332 3:117141964-117141986 AACCATGCCAAGAAGAAGCCAGG - Intergenic
962160258 3:132991654-132991676 AACCATTCTCAGATGTGGCTGGG + Intergenic
962354273 3:134680462-134680484 AACCATGTGCACATCCAGCTGGG + Intronic
964799595 3:160540559-160540581 AAACATGCCCAAATGCTGCCAGG - Intronic
968810614 4:2798117-2798139 GACCAGGCCCAGAAGCAGCTGGG - Intronic
968893416 4:3384875-3384897 AACCATGCCCCGACGCAGCCTGG - Intronic
969157358 4:5223109-5223131 AAGAAGGCCCAGGTGCAGCTTGG + Intronic
971003255 4:22346301-22346323 TATCAAGCCCAGATGCAGATGGG + Intronic
975727431 4:77305721-77305743 ACTGATGCCCAGGTGCAGCTGGG - Intronic
978247560 4:106592869-106592891 TACAATGCCCAGATTCAGTTGGG - Intergenic
981734588 4:147935808-147935830 AACCTTGCACAAAAGCAGCTTGG - Intronic
983081285 4:163387951-163387973 AACCCAGCCCAGATGGAGATAGG + Intergenic
986412744 5:7497700-7497722 AACCATGCCCAGGTGGAATTAGG + Intronic
988519293 5:31931507-31931529 ACTCCTGCCCAGCTGCAGCTGGG - Intronic
989966856 5:50475132-50475154 AAACAGGCCAAGGTGCAGCTTGG + Intergenic
990829930 5:59944664-59944686 AAGCATGCCCAGATACTGCTGGG - Intronic
992746972 5:79829704-79829726 AACCATGGGCAGAAGCAGATTGG + Intergenic
994755459 5:103789146-103789168 CACCATGCCCAGCTGAATCTGGG + Intergenic
1001549395 5:172592291-172592313 AACCATACCTGGATGCAGCTTGG + Intergenic
1001764462 5:174234500-174234522 GACCCAGCCCAGAGGCAGCTGGG - Intronic
1007148575 6:39663488-39663510 AAGCATGGCCAGTTGCAGGTGGG + Intronic
1007650333 6:43415966-43415988 CACCATGCCCAGCTGCTGCTGGG + Intergenic
1010355880 6:74932614-74932636 AACAGTGCCCAGTTGCAGCTTGG - Intergenic
1011259778 6:85458878-85458900 AACCAAACCCAGTTGCAGCTGGG + Intronic
1012072948 6:94646127-94646149 AACAATCCCCAGATGGATCTAGG + Intergenic
1013850270 6:114505191-114505213 AAGCATGCCCAGGTGCGGCTTGG - Intergenic
1015301977 6:131663396-131663418 AACCATGCCCAGCTGGTGATGGG - Intronic
1017976775 6:159365200-159365222 CAGCTTTCCCAGATGCAGCTGGG + Intergenic
1018043435 6:159945229-159945251 AAGCAGGCTCAGGTGCAGCTTGG + Intergenic
1018365622 6:163117051-163117073 GAGCATGCCCAGGTACAGCTAGG + Intronic
1018658300 6:166061695-166061717 AAGCAGGCCCAGATGTGGCTTGG - Intergenic
1018952035 6:168385536-168385558 AATTATGCCCAGATTCAGCGGGG - Intergenic
1019837070 7:3398580-3398602 AAGCATGCCAAAATGCATCTGGG - Intronic
1021896708 7:25243390-25243412 ACTCAGGCCAAGATGCAGCTTGG + Intergenic
1023131476 7:37007396-37007418 ATCCATGCCCAGGGGAAGCTGGG - Intronic
1025797820 7:64756354-64756376 AACCATGGCAAGCTGCAGCAGGG + Intergenic
1030533258 7:110736098-110736120 AAGTAGGCCCAGGTGCAGCTTGG + Intronic
1031649055 7:124263298-124263320 AGCCCTGGCCAGATGCAGTTAGG + Intergenic
1032313155 7:130807477-130807499 AAGCATGTCCTGATCCAGCTAGG - Intergenic
1035444353 7:158929645-158929667 GACCCTGCCCAGCTGCAGGTTGG + Intronic
1036553396 8:9835555-9835577 AACCATGCCCAGAAAAGGCTGGG + Intergenic
1037416788 8:18659882-18659904 AACCCTGCCCTCTTGCAGCTAGG - Intronic
1037484054 8:19330956-19330978 CACCATGCCCAAATGGGGCTGGG - Intronic
1038695860 8:29805680-29805702 CACCATGCCCAGCTTCAGCTTGG + Intergenic
1045262162 8:100585734-100585756 AACCCTGAGCAAATGCAGCTAGG + Intronic
1046644150 8:116766622-116766644 AAACATGCCAAGAAGCATCTTGG + Exonic
1049025867 8:139988444-139988466 AAAGATGCCCGGATGCTGCTGGG + Intronic
1049331968 8:142059427-142059449 ACGCATGCCCAGAGGCAGCGGGG + Intergenic
1052014243 9:23446647-23446669 AACTATGCCAGGATGCTGCTAGG + Intergenic
1052320879 9:27165930-27165952 AACCATGCTCAGAAGGACCTGGG - Intronic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053043153 9:34891661-34891683 GACCATGCCCAGAGGCTGCTAGG - Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053619210 9:39798816-39798838 AAGCATGCACACATGCAGCTGGG + Intergenic
1053877368 9:42558165-42558187 AAGCATGCACACATGCAGCTGGG + Intergenic
1053895295 9:42736523-42736545 AAGCATGCACACATGCAGCTGGG - Intergenic
1054234327 9:62543557-62543579 AAGCATGCACACATGCAGCTGGG - Intergenic
1054264947 9:62908613-62908635 AAGCATGCACACATGCAGCTGGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1056936806 9:90921305-90921327 AAACGTGCCCAGACACAGCTTGG - Intergenic
1057046927 9:91893206-91893228 CACCATGCCCAGCTTCAGCCTGG - Intronic
1057242382 9:93422993-93423015 AACCCTGCCCAGCTGAACCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058572816 9:106365816-106365838 AAGCAAGCCCAGGTGCAGGTTGG - Intergenic
1190333213 X:49248293-49248315 AACCTTGCCAAGCTGCAGGTGGG + Exonic
1191689618 X:63926391-63926413 AACCATACTCAGAAGCAGCTAGG - Intergenic
1191943118 X:66501082-66501104 AAGAATGCCCATATGGAGCTTGG + Intergenic
1193412689 X:81183465-81183487 AAAGGGGCCCAGATGCAGCTTGG + Intronic
1194762968 X:97816236-97816258 CACCATGCCAAGAAGCAGGTAGG + Intergenic
1197183130 X:123558375-123558397 AATCATGCTCAGATGCTTCTTGG - Intergenic
1197296371 X:124723885-124723907 AACCATGCCCGGCCGAAGCTGGG + Intronic
1199110117 X:143921899-143921921 AACCAGACCCAGATACAGCTGGG + Intergenic
1200834790 Y:7722774-7722796 ACCCATGCCCAGCTGCACATAGG - Intergenic
1201964874 Y:19721192-19721214 AACCATGCCCACGTACAGCCAGG + Exonic