ID: 1147285604

View in Genome Browser
Species Human (GRCh38)
Location 17:39401128-39401150
Sequence CCCACCAGCGGGCCCCCGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 116}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147285604_1147285624 19 Left 1147285604 17:39401128-39401150 CCCCGCGGGGGCCCGCTGGTGGG 0: 1
1: 0
2: 2
3: 6
4: 116
Right 1147285624 17:39401170-39401192 GGCGAGGGGACTGGGGGCACCGG 0: 1
1: 0
2: 2
3: 55
4: 682
1147285604_1147285626 29 Left 1147285604 17:39401128-39401150 CCCCGCGGGGGCCCGCTGGTGGG 0: 1
1: 0
2: 2
3: 6
4: 116
Right 1147285626 17:39401180-39401202 CTGGGGGCACCGGGCTGCGCTGG 0: 1
1: 0
2: 3
3: 33
4: 337
1147285604_1147285619 10 Left 1147285604 17:39401128-39401150 CCCCGCGGGGGCCCGCTGGTGGG 0: 1
1: 0
2: 2
3: 6
4: 116
Right 1147285619 17:39401161-39401183 GGGCGAACCGGCGAGGGGACTGG 0: 1
1: 0
2: 0
3: 9
4: 100
1147285604_1147285616 3 Left 1147285604 17:39401128-39401150 CCCCGCGGGGGCCCGCTGGTGGG 0: 1
1: 0
2: 2
3: 6
4: 116
Right 1147285616 17:39401154-39401176 AGACGGGGGGCGAACCGGCGAGG 0: 1
1: 0
2: 0
3: 2
4: 36
1147285604_1147285615 -2 Left 1147285604 17:39401128-39401150 CCCCGCGGGGGCCCGCTGGTGGG 0: 1
1: 0
2: 2
3: 6
4: 116
Right 1147285615 17:39401149-39401171 GGAAGAGACGGGGGGCGAACCGG 0: 1
1: 0
2: 1
3: 5
4: 161
1147285604_1147285621 12 Left 1147285604 17:39401128-39401150 CCCCGCGGGGGCCCGCTGGTGGG 0: 1
1: 0
2: 2
3: 6
4: 116
Right 1147285621 17:39401163-39401185 GCGAACCGGCGAGGGGACTGGGG 0: 1
1: 0
2: 0
3: 1
4: 73
1147285604_1147285625 20 Left 1147285604 17:39401128-39401150 CCCCGCGGGGGCCCGCTGGTGGG 0: 1
1: 0
2: 2
3: 6
4: 116
Right 1147285625 17:39401171-39401193 GCGAGGGGACTGGGGGCACCGGG 0: 1
1: 0
2: 3
3: 35
4: 380
1147285604_1147285627 30 Left 1147285604 17:39401128-39401150 CCCCGCGGGGGCCCGCTGGTGGG 0: 1
1: 0
2: 2
3: 6
4: 116
Right 1147285627 17:39401181-39401203 TGGGGGCACCGGGCTGCGCTGGG 0: 1
1: 0
2: 1
3: 29
4: 265
1147285604_1147285617 4 Left 1147285604 17:39401128-39401150 CCCCGCGGGGGCCCGCTGGTGGG 0: 1
1: 0
2: 2
3: 6
4: 116
Right 1147285617 17:39401155-39401177 GACGGGGGGCGAACCGGCGAGGG 0: 1
1: 0
2: 0
3: 0
4: 34
1147285604_1147285622 13 Left 1147285604 17:39401128-39401150 CCCCGCGGGGGCCCGCTGGTGGG 0: 1
1: 0
2: 2
3: 6
4: 116
Right 1147285622 17:39401164-39401186 CGAACCGGCGAGGGGACTGGGGG 0: 1
1: 0
2: 0
3: 3
4: 79
1147285604_1147285620 11 Left 1147285604 17:39401128-39401150 CCCCGCGGGGGCCCGCTGGTGGG 0: 1
1: 0
2: 2
3: 6
4: 116
Right 1147285620 17:39401162-39401184 GGCGAACCGGCGAGGGGACTGGG 0: 1
1: 0
2: 0
3: 3
4: 47
1147285604_1147285618 5 Left 1147285604 17:39401128-39401150 CCCCGCGGGGGCCCGCTGGTGGG 0: 1
1: 0
2: 2
3: 6
4: 116
Right 1147285618 17:39401156-39401178 ACGGGGGGCGAACCGGCGAGGGG 0: 1
1: 0
2: 0
3: 2
4: 30
1147285604_1147285614 -10 Left 1147285604 17:39401128-39401150 CCCCGCGGGGGCCCGCTGGTGGG 0: 1
1: 0
2: 2
3: 6
4: 116
Right 1147285614 17:39401141-39401163 CGCTGGTGGGAAGAGACGGGGGG 0: 1
1: 0
2: 1
3: 16
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147285604 Original CRISPR CCCACCAGCGGGCCCCCGCG GGG (reversed) Intronic
900298325 1:1964105-1964127 CCCACCTGCGGGCCCCAGCAAGG - Intronic
903907323 1:26696266-26696288 CGCAGCAGCGGAGCCCCGCGAGG + Exonic
904252962 1:29237776-29237798 CGGGCCAGCGGGCCCCAGCGAGG + Intronic
905862743 1:41361834-41361856 CCCTCCCGCGGGCCTCCCCGGGG + Intergenic
907332014 1:53677679-53677701 CCCAGCCGCGGGCACCCGCGAGG + Intronic
908446598 1:64203599-64203621 CCAACCAACAGGCCCCCGTGGGG - Intergenic
912174525 1:107140408-107140430 CCCACCAGCGGCTCCCGGCCGGG - Intronic
914940682 1:152020349-152020371 CCCACCTGCCTGCCCCCACGGGG - Intergenic
915355267 1:155251891-155251913 CCCAGCAGCTGGCCCCTGAGCGG - Exonic
922702493 1:227770009-227770031 CCCACCATCAGGCACCAGCGAGG - Intronic
1063200391 10:3781600-3781622 CCCACCAGCGGCCGCCCTCCGGG + Intronic
1073042251 10:100615623-100615645 CCCCCCAGGGTGCCCCAGCGGGG - Intergenic
1074756487 10:116627707-116627729 CAGACCAGCGGGTCCCCACGCGG + Intronic
1077187964 11:1243866-1243888 CCCGCCAGAGGGCCCCGGCATGG - Exonic
1077188390 11:1245537-1245559 CCCGCCAGAGGGCCCCGGCATGG - Exonic
1077188921 11:1247637-1247659 CCCGCCAGAGGGCCCCGGCATGG - Exonic
1077189346 11:1249308-1249330 CCCGCCAGAGGGCCCCGGCATGG - Exonic
1077334654 11:1997931-1997953 CCCTCCCGAGGGCCCCCGCAGGG + Intergenic
1084361914 11:68674196-68674218 CCCAGCAGCTGGCCACCGAGTGG - Intergenic
1085011252 11:73142727-73142749 CCCACGTGCGCGCCCCCGAGCGG - Intergenic
1090029511 11:123195134-123195156 CCCACCAGCTGGCGCCCGGACGG + Exonic
1090554825 11:127862935-127862957 CCCCCCAGCAGGCCCCAGTGTGG + Intergenic
1202817637 11_KI270721v1_random:53113-53135 CCCTCCCGAGGGCCCCCGCAGGG + Intergenic
1096298178 12:50401411-50401433 CCTCCCAGAGGGGCCCCGCGAGG - Intronic
1103800500 12:123534153-123534175 CCCACCACCCGGCCGCCGGGAGG + Intergenic
1104929327 12:132329698-132329720 CCCCCCACCGCGCCCCCCCGGGG + Intergenic
1105472249 13:20704309-20704331 CCCACCTGCCGGGCCCCGCCAGG - Intronic
1105606708 13:21932100-21932122 CCCACCACTGGGTCCCCGGGGGG - Intergenic
1110860877 13:80343024-80343046 GCCACCAGGGGGCGCCCGCCCGG + Intergenic
1112331432 13:98479734-98479756 CACAGCACCGGGCCCCCTCGAGG - Intronic
1117805191 14:59483926-59483948 GCCCCCTGCGGGCACCCGCGAGG - Exonic
1119330073 14:73787054-73787076 CCCGCCACCGGGCGCCGGCGTGG - Intronic
1119440275 14:74623612-74623634 GCCACCAGCTGGCCCCAGAGTGG + Intergenic
1121916163 14:97838531-97838553 CCCACCCCCAGGCCCCCGGGAGG + Intergenic
1122230925 14:100306101-100306123 CCCGCCAGCGGGAAGCCGCGAGG + Intronic
1122270870 14:100568034-100568056 CCCACGGACGGGGCCCCGCGGGG - Exonic
1122779552 14:104137956-104137978 CCCACTTGCGGGCACACGCGCGG + Intergenic
1124251279 15:28107644-28107666 CCCACCAGCAGGCCCTGGCGCGG - Intergenic
1125678133 15:41513287-41513309 CCTATCAGCGCGCACCCGCGGGG - Intronic
1136578919 16:31140522-31140544 CCCAGCAGCTGGCCCCCGGGGGG + Exonic
1136895333 16:33993001-33993023 CCCACCAGCCTGCCCCCGACTGG + Intergenic
1137300464 16:47143783-47143805 CCCCACAGTGGGCTCCCGCGCGG + Exonic
1137665393 16:50246344-50246366 GCCACCGCCGGGCACCCGCGAGG - Intronic
1140857900 16:78993844-78993866 CCGACCAGCGGGCTCCGCCGTGG - Intronic
1142416894 16:89948165-89948187 GCCACCTGCAGGGCCCCGCGGGG - Intronic
1142742990 17:1941587-1941609 CCCACCGCCTGGCCCCCGAGGGG - Intronic
1143362446 17:6382927-6382949 CCCACCACCAGGCCTCCGTGTGG + Intergenic
1146922377 17:36722397-36722419 CCCACCCGCGCACCCCCGCCCGG + Intergenic
1147285604 17:39401128-39401150 CCCACCAGCGGGCCCCCGCGGGG - Intronic
1148108497 17:45132011-45132033 CCCACCAGGGGGCGCTCGCGGGG - Intronic
1151337006 17:73445934-73445956 CCCTCCAGCTGGCCCCAGGGAGG - Intronic
1152797885 17:82316897-82316919 TCCACCAGCGGGGGCCTGCGTGG - Exonic
1152882886 17:82830465-82830487 CCCACCCACAGGCCCCGGCGAGG - Exonic
1154133008 18:11752021-11752043 CCGCCCAGCGGGTCCCCGAGGGG - Intronic
1160527252 18:79544925-79544947 GCCACCGGGGGGCCCCCGTGAGG - Intergenic
1160826230 19:1081803-1081825 CCCACCCCCGGGCTCCCGCAGGG + Exonic
1161195581 19:2984349-2984371 CCCTCCATCGGAGCCCCGCGGGG - Intronic
1161477027 19:4491800-4491822 CCCCCCAGAGGGCCCCTCCGTGG - Exonic
1163550181 19:17962179-17962201 CCCACCAGCGGCCCCACCCTGGG - Intronic
1163666957 19:18607701-18607723 CCCACCCGCGGGCCGCTGAGTGG - Intronic
1167001239 19:46746612-46746634 CCCACCCGCCGGCCCCCGCGCGG - Exonic
1167125451 19:47545553-47545575 CACCCCAGCCGGCCCCCACGCGG - Exonic
926980150 2:18560150-18560172 CCCACCAGCCCGGCCCCCCGAGG + Intronic
933667096 2:84971971-84971993 CCCGCCTGCGGGCGACCGCGGGG + Intronic
935275657 2:101473901-101473923 CCAACCAACGGGTCCCCGCGGGG + Intronic
936451512 2:112637010-112637032 CCCACCAGCTGGGCCCTGTGGGG + Intergenic
936526098 2:113242422-113242444 CCCACCAGGAGGCCCCCTGGAGG - Intronic
941583769 2:167331697-167331719 ACCACCAGGGGGCCCCAGCCTGG - Intergenic
947624932 2:231613385-231613407 CCCACCCCAGGGACCCCGCGGGG + Intergenic
947669496 2:231927275-231927297 CCCAGCAGCGGATCCTCGCGTGG - Intergenic
1171972548 20:31573219-31573241 CCCATCTGGCGGCCCCCGCGGGG - Intronic
1173251514 20:41366385-41366407 CCCACCTGCCCGCACCCGCGGGG - Intronic
1174869968 20:54173377-54173399 CCCACCAGCTGGCCACTGCTGGG - Exonic
1178535109 21:33404020-33404042 CCCACCCGCGCGCCCGCGCCGGG + Intronic
1184784585 22:46665519-46665541 CCCACCAGGCGGCCCCAGTGGGG - Intronic
1185188952 22:49420823-49420845 CCCACCATAGGGCCGCCCCGGGG - Intronic
949351216 3:3126762-3126784 CGCCCCAGCGGGCCTCGGCGGGG + Intergenic
949552438 3:5122383-5122405 CACACGAGCGGGCCTCCGCCCGG - Exonic
950964128 3:17134372-17134394 CACACCAGCGGGCACCCACAGGG + Intergenic
954894402 3:53963598-53963620 CCCACGGGCAGGCCCCCTCGAGG + Intergenic
956311733 3:67888379-67888401 CCCAGCAGCGGGAACCCGCTTGG + Intergenic
956659524 3:71583919-71583941 CACTCCAGCGGCCCCCCGAGCGG + Intronic
961551257 3:127671824-127671846 CCCACCAGGGGGCCCCTCCCTGG + Intronic
962367467 3:134795862-134795884 CCCACCAGAGCGCCCCCGGCTGG + Intronic
965590833 3:170358315-170358337 CCCAACACCGCCCCCCCGCGGGG - Intronic
969440528 4:7214132-7214154 CCCACCAGCTGTCCCCAGTGGGG - Intronic
969674412 4:8607102-8607124 CCCATCACTGGGCCCCTGCGGGG - Intronic
980865963 4:138553432-138553454 CCCACCAGTGGGCTCCCGCGGGG + Intergenic
981429793 4:144645866-144645888 CCCACCCGGGGGCCGCGGCGAGG + Intergenic
984735107 4:183100143-183100165 CCCACTAGCAGGGCCCGGCGGGG - Intronic
996738224 5:126776793-126776815 CCCTCCAAGGGGTCCCCGCGGGG + Intronic
1001133220 5:169081200-169081222 CCCTCCAGGGGGCCCCAGAGCGG - Intronic
1001831613 5:174793871-174793893 GGCACCGGCGCGCCCCCGCGCGG + Intergenic
1002103752 5:176869849-176869871 CCCACCAGCCTGCCCCCCCATGG + Intronic
1002252723 5:177939529-177939551 CCCAGCAGCCGGCACCCGCCTGG + Intergenic
1002663097 5:180804058-180804080 CGCACCCGCAGGCCCCTGCGTGG + Intronic
1002832617 6:836622-836644 CCCACCATGGGGCCCACGCTGGG + Intergenic
1003178513 6:3771876-3771898 CCCCGCCGCGGGCTCCCGCGTGG + Intergenic
1011054776 6:83193451-83193473 CCAACCCCCGGGCCACCGCGGGG - Intronic
1013170555 6:107634138-107634160 CCCGGCATCGGGCCCCCGCCCGG + Exonic
1015786580 6:136924544-136924566 GCCACCAGCGGGACTCCTCGGGG - Exonic
1019422935 7:959407-959429 CCCTCCACCGGCCCCCCGCCAGG - Intronic
1020204748 7:6105465-6105487 CCCGCCCGCCGCCCCCCGCGTGG + Intronic
1020224977 7:6272647-6272669 CCGACCAGCGAGGCCCCGCCCGG - Intergenic
1021315584 7:19144383-19144405 CGCTCCAGCGGGCGCCTGCGTGG - Intergenic
1026899634 7:74029659-74029681 CCCACAGGCGGGCCCCAGCAGGG + Intronic
1028138573 7:87247183-87247205 CCCACCAGTAGGCCCCCTTGAGG + Intergenic
1043388270 8:79768380-79768402 CCCGCCGGCGCGCCCTCGCGCGG - Intergenic
1049211133 8:141386944-141386966 CCCACGAGGGGGCGCCCGTGTGG + Intergenic
1049936410 9:504909-504931 CGCACGAGCGGGAGCCCGCGGGG - Intronic
1053013187 9:34647004-34647026 CCCACCAGCAGGCCCAAGCTCGG - Intronic
1053050455 9:34957734-34957756 CCTACCAGCCGTCCCCCGCAGGG - Intronic
1057230377 9:93317959-93317981 CCCACCCGCTGTCCCCCTCGCGG - Exonic
1059483792 9:114611780-114611802 CCCAACCGCGGGCCCCCAGGAGG - Intronic
1060087351 9:120714485-120714507 CCCGCGGGCGGGCCCCAGCGCGG + Intergenic
1060106474 9:120876427-120876449 GCCACCCGGGGGCCCCCGCCCGG - Intronic
1060282035 9:122221336-122221358 CCCAACAGCTGGCCGCCGCTGGG + Intronic
1060358424 9:122931766-122931788 CCGAGCAGCGGGTCCCTGCGAGG - Intergenic
1060481520 9:124018972-124018994 CCCTCCACCGAGCCCCCGCCTGG - Intronic
1062647365 9:137555536-137555558 CTCTGCAGCGGGCCCCCTCGTGG - Exonic
1062718680 9:138023626-138023648 CCCCCGAGCGGGGCCCCGGGAGG + Exonic
1185464506 X:346529-346551 CCCAACACCGGGCTCCCGGGCGG + Intronic
1199305181 X:146259066-146259088 TCCACCAGCAGGGCCCGGCGCGG - Intergenic
1200064273 X:153497225-153497247 CCCACCACCGAGCCCCCGACAGG + Intronic
1200126221 X:153816196-153816218 CCCACCACCGAGCCCCCGACAGG - Intronic