ID: 1147292014

View in Genome Browser
Species Human (GRCh38)
Location 17:39451148-39451170
Sequence ACTGCTGGTGCCCTGCGTCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 144}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147292014_1147292023 16 Left 1147292014 17:39451148-39451170 CCGGGACGCAGGGCACCAGCAGT 0: 1
1: 0
2: 0
3: 19
4: 144
Right 1147292023 17:39451187-39451209 AAGGATCAATCTGAAGTCCCCGG 0: 1
1: 1
2: 1
3: 9
4: 117
1147292014_1147292024 19 Left 1147292014 17:39451148-39451170 CCGGGACGCAGGGCACCAGCAGT 0: 1
1: 0
2: 0
3: 19
4: 144
Right 1147292024 17:39451190-39451212 GATCAATCTGAAGTCCCCGGCGG 0: 1
1: 0
2: 0
3: 5
4: 44
1147292014_1147292017 -7 Left 1147292014 17:39451148-39451170 CCGGGACGCAGGGCACCAGCAGT 0: 1
1: 0
2: 0
3: 19
4: 144
Right 1147292017 17:39451164-39451186 CAGCAGTCCCTACTCTTCCCGGG 0: 1
1: 0
2: 2
3: 23
4: 226
1147292014_1147292016 -8 Left 1147292014 17:39451148-39451170 CCGGGACGCAGGGCACCAGCAGT 0: 1
1: 0
2: 0
3: 19
4: 144
Right 1147292016 17:39451163-39451185 CCAGCAGTCCCTACTCTTCCCGG 0: 1
1: 1
2: 1
3: 24
4: 260
1147292014_1147292018 -3 Left 1147292014 17:39451148-39451170 CCGGGACGCAGGGCACCAGCAGT 0: 1
1: 0
2: 0
3: 19
4: 144
Right 1147292018 17:39451168-39451190 AGTCCCTACTCTTCCCGGGAAGG 0: 1
1: 0
2: 0
3: 9
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147292014 Original CRISPR ACTGCTGGTGCCCTGCGTCC CGG (reversed) Exonic
901052053 1:6430149-6430171 CCTGATGGGGCCCTGTGTCCTGG - Intronic
901654281 1:10760491-10760513 AATGCAGGTGCCCTGCTCCCAGG + Intronic
901825562 1:11858882-11858904 GCTGCTGCTGCGATGCGTCCGGG + Exonic
902616494 1:17626268-17626290 ACTGCTGGTGGCCTGAGTCTGGG + Intronic
902744842 1:18466911-18466933 ACTGCAGCTGCACTGGGTCCAGG + Intergenic
904857621 1:33510947-33510969 CCTGCTGATTCCCTGTGTCCAGG + Intergenic
907077902 1:51594918-51594940 GCTGCTGGTGACCTGCACCCTGG - Intronic
907451331 1:54547696-54547718 ACTGCTGGATGCCTGCGGCCTGG + Intronic
907523968 1:55043077-55043099 GATGCTGGTGCCATGCTTCCTGG + Intronic
907765693 1:57408560-57408582 ACTGCTGCTGCCCTACTCCCTGG + Intronic
908358934 1:63348746-63348768 ACTGCGGGTGCCCTTCATCTGGG + Intergenic
911534482 1:99083727-99083749 ACTGCTGGTGCCCTGGCACATGG + Intergenic
911784620 1:101930831-101930853 AATGCTGGAGCCCTGGCTCCTGG - Intronic
913326090 1:117630136-117630158 TGTGCTGGTGCCCAGCTTCCTGG + Intergenic
916242303 1:162652346-162652368 ACTGTTGGTGCCCATCTTCCTGG + Intronic
919914918 1:202133305-202133327 TCTGTTGGTGCCCAGCGTGCGGG + Exonic
1064253943 10:13728365-13728387 AATGCTGGTATCCTGCCTCCTGG + Intronic
1067225535 10:44373695-44373717 GATGCTGCTGCCCTGCATCCTGG + Intronic
1075677305 10:124304365-124304387 ACTGCAGGTGCCCAGGCTCCTGG - Intergenic
1076335847 10:129706026-129706048 ACTGCTGCAGCCCTGCGTCAGGG + Intronic
1078059052 11:8031853-8031875 TCTGCTCGGGCCCTGGGTCCCGG + Intronic
1079559632 11:21805743-21805765 ACTGCTGCTGCCCTCCAGCCTGG + Intergenic
1080451122 11:32379831-32379853 ACTGCTGGTGCCTGGGGTCATGG - Intergenic
1081989596 11:47330644-47330666 CTTTCTGGTGCCCAGCGTCCTGG + Intergenic
1083580006 11:63818733-63818755 GCTGCAGGCGCCCTGCGCCCAGG - Intronic
1084067384 11:66712850-66712872 CCTGCTGGTCCCCTGCTCCCAGG + Intronic
1084802807 11:71555792-71555814 AGTGCTGGGGCCCTGCTTCCAGG + Intronic
1086781837 11:90916588-90916610 ATTGCTGGAGCCCTGAGACCAGG + Intergenic
1089559207 11:119335200-119335222 CCTGCTGGTGTCCTCCCTCCTGG + Exonic
1089598726 11:119599584-119599606 ACTGATGCTGCCCTGTGGCCTGG + Intergenic
1090398166 11:126432662-126432684 ACTGCTGCTGCTCCGAGTCCTGG + Intronic
1091250471 11:134140054-134140076 CCTGCTGATGCCATGCTTCCAGG - Intronic
1094203662 12:27817931-27817953 GCTGCTGTTGCCCTGTCTCCCGG - Intergenic
1096676216 12:53227496-53227518 GCGGCTGGTGCCCTGGGGCCTGG - Exonic
1097057068 12:56256768-56256790 ACTGCGGGGGCCCTGCTGCCAGG - Intronic
1101324022 12:103698627-103698649 ACTGCTGGTGAGCTGCCTCTTGG - Intronic
1105895089 13:24710596-24710618 ACTGCCTGTGCCCGGCCTCCTGG + Intronic
1108642463 13:52395524-52395546 CCTGCTCGTTCCCTGCCTCCAGG - Intronic
1113943406 13:114030040-114030062 ACAGCTGGGACCCTGCGTCCCGG - Intronic
1115522659 14:34248457-34248479 ACTGCTGGTTCCATTAGTCCTGG - Intronic
1116922362 14:50592834-50592856 ACTGCAAGTGCTCTGCCTCCTGG - Intronic
1121098576 14:91234288-91234310 GCTGCTGGTGCGCAGCGTCTGGG - Exonic
1121131789 14:91453994-91454016 ACTGCTGCTGGCCTGTGGCCCGG + Intergenic
1122170461 14:99869924-99869946 AATGCCGGTGCCATGCTTCCTGG + Intronic
1122269152 14:100560596-100560618 ACTGCTGGTTCTCTGTGTCCTGG - Intronic
1122367201 14:101201177-101201199 ACTGCTGGAACCCTGCTTGCTGG + Intergenic
1125606747 15:40943793-40943815 GCTTCTTGGGCCCTGCGTCCTGG - Intergenic
1126592397 15:50354224-50354246 ACTGCGGGTGCACTGCCTCAGGG - Intronic
1130551932 15:84894953-84894975 CCTGCTGGTGGCCTGCCTCCTGG + Exonic
1130983112 15:88826494-88826516 CCTGCTGGGGCTCTGAGTCCTGG - Intronic
1135271168 16:21071084-21071106 TCTGCTGGTGCCCTCCAGCCTGG - Intronic
1136400698 16:30016476-30016498 ACTGCAGGCCCCCTGCGCCCAGG - Intronic
1138599243 16:58045335-58045357 GCTGCTGCTGCTCTGCGTCCTGG + Exonic
1141961925 16:87414484-87414506 ACTGCTGGTGACCAGCGGCGGGG + Exonic
1142239038 16:88936660-88936682 GCTGCTGGTGCCTTGGCTCCGGG + Intronic
1144311412 17:14017463-14017485 ATTTCTGGTGCCCTGGATCCAGG - Intergenic
1144997105 17:19277662-19277684 ACTGCTGGAGTCCTGCTTCATGG + Intronic
1146472007 17:33132051-33132073 ATTGATGGTGCCCAGCATCCAGG - Intronic
1147292014 17:39451148-39451170 ACTGCTGGTGCCCTGCGTCCCGG - Exonic
1147743106 17:42679747-42679769 ACTGCTGGTGACCAGCGGCTTGG - Exonic
1148123673 17:45226140-45226162 ACTGCTGGTGACCTGCATAACGG - Intronic
1148218940 17:45849128-45849150 CCTGCTGCTGGCCTGCGTCACGG + Intergenic
1149569089 17:57659692-57659714 CCTGCTTGTGCCCGGTGTCCTGG - Intronic
1151455698 17:74224600-74224622 ACTGCTGGTGCCCTCTTGCCTGG - Intronic
1151757107 17:76081375-76081397 GCAGCTGGTGCCCTGCTTCCAGG + Exonic
1156384689 18:36594498-36594520 AGTTCTGGAGCCATGCGTCCTGG + Intronic
1158732856 18:60044913-60044935 GCTGCTGCTCCCCTGTGTCCTGG - Intergenic
1163723857 19:18911373-18911395 ACTGCTGCTGCCCTGCCCCCAGG - Intronic
1164082932 19:21876156-21876178 GCTGCTTGTGCCCTGCTTTCAGG + Intergenic
1164118482 19:22244570-22244592 TCTGCCTGTGCCCTGCTTCCTGG - Intergenic
1164190915 19:22916275-22916297 GCTGCTTGTGCCCTGCTTTCAGG + Intergenic
1164686506 19:30169666-30169688 CCTGCTGGTGCCCAGTGGCCAGG - Intergenic
1166512175 19:43416300-43416322 AATGCTTGTTCCCTTCGTCCAGG + Intronic
1167696017 19:51015963-51015985 AGTGCTGGGGCCCCGCGTCCGGG - Exonic
925719963 2:6817519-6817541 CCAGCTTGTGCCCTGCCTCCTGG - Intergenic
926712162 2:15890401-15890423 ACTCCTGGTGCCGTGGCTCCCGG - Intergenic
927109966 2:19857674-19857696 ACTACTGCTGCCCAGTGTCCAGG + Intergenic
928169193 2:28992449-28992471 ACTGCTGGTGTCCTGGGACCAGG + Intronic
928402616 2:30990260-30990282 GCTGCTGGTGACCTGTGTTCTGG - Intronic
930020264 2:46997629-46997651 AGTCCAGGAGCCCTGCGTCCTGG - Intronic
932216349 2:69968782-69968804 ACTGCTTGTCCCCAGCGACCAGG - Intergenic
933177403 2:79191109-79191131 ACTGCTGGAGCCCAGGGTCCAGG + Intronic
933900566 2:86846723-86846745 CCTGCTGGTGGCTGGCGTCCTGG - Exonic
935779982 2:106502502-106502524 CCTGCTGGTGGCTGGCGTCCTGG + Intergenic
936266770 2:111016884-111016906 CTTGCTGGGGCCCTGCTTCCAGG - Intronic
937332290 2:121039035-121039057 TCTGCTGGCTCCCTGGGTCCTGG + Intergenic
938692276 2:133802576-133802598 TCTGCAGGAGCCCTGCGGCCTGG + Intergenic
945326980 2:208493367-208493389 GCTGCTGGTGCTGTGCGTCACGG - Exonic
946847779 2:223875290-223875312 ACTGTTATTGCCCTACGTCCAGG + Intronic
947337168 2:229099421-229099443 GCTGTTGGTGCCCTGCCTTCTGG - Intronic
947753095 2:232542946-232542968 CCTTCTGGTGGCCTGCTTCCTGG - Exonic
948735249 2:239999452-239999474 TCTGCTGGTTCCCTGCATGCGGG + Intronic
948868361 2:240786405-240786427 ACTGCTGGGGCCCTACGTGGAGG - Exonic
1172894688 20:38292261-38292283 TCTGCTGGAGCCCTGCCTGCTGG - Intronic
1175764377 20:61582495-61582517 ACTGCTGGTGCCCAGAAACCAGG - Intronic
1176028681 20:62999670-62999692 ACTCCTGGGGCATTGCGTCCCGG - Intergenic
1178242839 21:30922442-30922464 ACTGAGGGTGCTCTGCTTCCAGG + Intergenic
1179624096 21:42638573-42638595 ACTGCTGGGGCTCAGCCTCCTGG + Intergenic
1179924440 21:44526601-44526623 ACTGCTTTAGCCCTGTGTCCAGG + Intronic
1180039048 21:45266407-45266429 ACTGAAGCTGCCCTGCCTCCGGG - Intronic
1181086045 22:20439838-20439860 ACTGCTGGAGCCCGGAGCCCTGG + Intronic
1185280909 22:49969489-49969511 TTTGCAGGTGCCCTGGGTCCTGG + Intergenic
949608190 3:5676991-5677013 AATGCTGGTGTCATGCTTCCTGG + Intergenic
950123274 3:10495869-10495891 ACTGCGGGTGCCCTGCCTGGGGG - Intronic
950212497 3:11134251-11134273 TCTACTGGTGCCCTTCATCCAGG - Intergenic
960182350 3:114595550-114595572 ACTGCTGGTTCAATGAGTCCAGG + Intronic
961045356 3:123704191-123704213 ACTGCTATTGCCCTGCCACCAGG - Intronic
961196941 3:125010461-125010483 ACTGCAGGTGCCCGCCTTCCTGG - Exonic
961359893 3:126360476-126360498 GCTGCTGGTGCCCAGGGGCCAGG + Intergenic
961785832 3:129346119-129346141 ACTGCTGGTGCTCTGGGTAGAGG - Intergenic
968914678 4:3492283-3492305 ACAGCTGGTGCCTCGTGTCCAGG + Intronic
969462495 4:7336171-7336193 GCTGCCCCTGCCCTGCGTCCTGG + Intronic
970370079 4:15397295-15397317 ACTGCTGTTGCCCTGCTCCAGGG - Intronic
974245996 4:59318597-59318619 ACTACTGGATCCCTGCTTCCTGG - Intergenic
974295451 4:59993503-59993525 ACTGCTTGTGCCCAGCATCATGG + Intergenic
976878869 4:89893425-89893447 AATCCTGGTGCACTGTGTCCAGG + Intronic
978409836 4:108415312-108415334 TCAGCTGGTGCCCTGCTTCCAGG + Intergenic
982134763 4:152264281-152264303 CATGCTGGTGCCCTGCTCCCAGG + Intergenic
983180808 4:164646292-164646314 TCTGCTGGTGCCTTGCTTCCAGG + Intergenic
983888483 4:173006965-173006987 ACTGCTGGGGCTCTGCTTTCAGG - Intronic
985146200 4:186896433-186896455 CCTGCTGGAGCCCCGCGTGCTGG - Intergenic
988894264 5:35655167-35655189 AATGCTGGTGCTGTTCGTCCAGG - Intronic
989443769 5:41504474-41504496 ACTGCTGAAGCCCTGAGTGCTGG - Intronic
995372842 5:111439168-111439190 ATTGCTGCTGCCCTGCATGCTGG + Intronic
997302258 5:132814275-132814297 GCTGCCGGTGCGCTGCGTCCCGG + Exonic
997374102 5:133384653-133384675 CCTGCTGGGCCCCTGCCTCCAGG + Intronic
997377781 5:133409573-133409595 GCTGCTGGGGCCCTGCCTCGGGG - Intronic
998468920 5:142367903-142367925 AGTGCTGGTGTTCTGCTTCCTGG + Intergenic
999897783 5:156053313-156053335 ACAGCTGCTGCCCTCTGTCCAGG - Intronic
1000484420 5:161822724-161822746 ACTTCTGTTGTCCTGAGTCCAGG - Intergenic
1001550094 5:172596400-172596422 ACTGAAGGTGCCCTCCCTCCTGG - Intergenic
1002188964 5:177469076-177469098 ACTGCTGGAGGCCTGGGTCAGGG + Intronic
1002318993 5:178364041-178364063 ACCACTGGTGCCTTGAGTCCTGG - Intronic
1002843751 6:927475-927497 CCAGCGGGTGCCCTGTGTCCTGG - Intergenic
1002906186 6:1451084-1451106 ACTGCTGCTCCCCTTCTTCCAGG + Intergenic
1004537668 6:16518456-16518478 CCTGCAGGTGGCCTGCGACCAGG + Intronic
1006300154 6:33189644-33189666 GCTGATGCTGCCCTGCCTCCAGG - Intronic
1006883658 6:37361327-37361349 ACTGGTGGTCCCCTGCTCCCAGG - Intronic
1007943087 6:45800389-45800411 ACAGCTGCTGCCCTACATCCTGG + Intergenic
1011073228 6:83408843-83408865 ACTGCTGTTCCTCTGGGTCCAGG + Intronic
1015829960 6:137358251-137358273 ACTGCTGTTGCCTTGCTTCCTGG + Intergenic
1016035049 6:139375575-139375597 TCTGCTGTTGCCCTGGATCCGGG + Intergenic
1016164219 6:140920005-140920027 ACTGCTGCTGCCCGGCATCCTGG + Intergenic
1016254507 6:142088364-142088386 GCTGCTGCTCACCTGCGTCCCGG - Exonic
1017889539 6:158627257-158627279 ACTTCTGGTGGCCTCCGTCTCGG + Intronic
1024541058 7:50475487-50475509 ACTGCTGCCCCCCTGCCTCCTGG + Intronic
1024913365 7:54470912-54470934 ACTTCTGCTGTCCTGAGTCCAGG + Intergenic
1033670549 7:143488764-143488786 GCTGCTGGTGCCCTGCTGCCTGG - Intergenic
1034107743 7:148505188-148505210 ACTGCTGTGGCCCAGCATCCAGG + Intergenic
1035586674 8:780792-780814 AAGGCTGGTGCCCTGTGGCCAGG + Intergenic
1036579001 8:10055052-10055074 GCTGCAGGTGCCCTGGGTCCCGG - Intronic
1039457088 8:37714659-37714681 ACTGCTAGAGCTCAGCGTCCAGG - Intergenic
1047627097 8:126667320-126667342 ACTGCTGTTGCTGTGCCTCCTGG + Intergenic
1048620482 8:136127560-136127582 ATTGTTGGTGCCCTGCTTCTTGG + Intergenic
1049194482 8:141308020-141308042 GCTGCAGGTGCCCGGCGCCCAGG + Intronic
1059427690 9:114231380-114231402 ACTTCCGGTGCCCTGAGGCCTGG - Intronic
1060568336 9:124614139-124614161 ACTCCAGCTGCCCTGCCTCCTGG - Intronic
1061071579 9:128314033-128314055 AGAGCTGGTGCCCTTCCTCCTGG - Intronic
1061870383 9:133517195-133517217 CGTGCTGGGGCCCTGGGTCCTGG - Intronic
1062572885 9:137193727-137193749 GCTGCTGGTGTCCTGTGCCCAGG - Intronic
1062600418 9:137316560-137316582 AGTACTGGGGCCCTGCCTCCCGG - Intronic
1185808294 X:3080617-3080639 TCTGCTGGGGACCTGCTTCCTGG + Intronic
1189899330 X:45689740-45689762 GATGCTGGTGCCATGCTTCCTGG + Intergenic
1201543792 Y:15138349-15138371 ACTGCTGATGCACAGCCTCCGGG - Intergenic