ID: 1147293418

View in Genome Browser
Species Human (GRCh38)
Location 17:39461774-39461796
Sequence CCTGAGGACTGGCTCGGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 154}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147293402_1147293418 17 Left 1147293402 17:39461734-39461756 CCGTCGGCTTCTCACTTCCTGGA 0: 1
1: 0
2: 0
3: 19
4: 166
Right 1147293418 17:39461774-39461796 CCTGAGGACTGGCTCGGCGGAGG 0: 1
1: 0
2: 0
3: 16
4: 154
1147293397_1147293418 30 Left 1147293397 17:39461721-39461743 CCACAGCCCCGGGCCGTCGGCTT 0: 1
1: 0
2: 0
3: 17
4: 132
Right 1147293418 17:39461774-39461796 CCTGAGGACTGGCTCGGCGGAGG 0: 1
1: 0
2: 0
3: 16
4: 154
1147293398_1147293418 24 Left 1147293398 17:39461727-39461749 CCCCGGGCCGTCGGCTTCTCACT 0: 1
1: 0
2: 1
3: 3
4: 55
Right 1147293418 17:39461774-39461796 CCTGAGGACTGGCTCGGCGGAGG 0: 1
1: 0
2: 0
3: 16
4: 154
1147293407_1147293418 -6 Left 1147293407 17:39461757-39461779 CCTCCCCGGCGCCCGGGCCTGAG 0: 1
1: 0
2: 0
3: 26
4: 315
Right 1147293418 17:39461774-39461796 CCTGAGGACTGGCTCGGCGGAGG 0: 1
1: 0
2: 0
3: 16
4: 154
1147293410_1147293418 -10 Left 1147293410 17:39461761-39461783 CCCGGCGCCCGGGCCTGAGGACT 0: 1
1: 0
2: 2
3: 13
4: 178
Right 1147293418 17:39461774-39461796 CCTGAGGACTGGCTCGGCGGAGG 0: 1
1: 0
2: 0
3: 16
4: 154
1147293405_1147293418 0 Left 1147293405 17:39461751-39461773 CCTGGACCTCCCCGGCGCCCGGG 0: 1
1: 0
2: 7
3: 28
4: 320
Right 1147293418 17:39461774-39461796 CCTGAGGACTGGCTCGGCGGAGG 0: 1
1: 0
2: 0
3: 16
4: 154
1147293409_1147293418 -9 Left 1147293409 17:39461760-39461782 CCCCGGCGCCCGGGCCTGAGGAC 0: 1
1: 0
2: 3
3: 19
4: 349
Right 1147293418 17:39461774-39461796 CCTGAGGACTGGCTCGGCGGAGG 0: 1
1: 0
2: 0
3: 16
4: 154
1147293399_1147293418 23 Left 1147293399 17:39461728-39461750 CCCGGGCCGTCGGCTTCTCACTT 0: 1
1: 0
2: 0
3: 8
4: 81
Right 1147293418 17:39461774-39461796 CCTGAGGACTGGCTCGGCGGAGG 0: 1
1: 0
2: 0
3: 16
4: 154
1147293400_1147293418 22 Left 1147293400 17:39461729-39461751 CCGGGCCGTCGGCTTCTCACTTC 0: 1
1: 0
2: 1
3: 7
4: 97
Right 1147293418 17:39461774-39461796 CCTGAGGACTGGCTCGGCGGAGG 0: 1
1: 0
2: 0
3: 16
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147293418 Original CRISPR CCTGAGGACTGGCTCGGCGG AGG Intronic
900038833 1:440108-440130 CTTGAGGGCTGGCTTGGCTGTGG - Intergenic
900060266 1:675084-675106 CTTGAGGGCTGGCTTGGCTGTGG - Intergenic
900075937 1:817881-817903 CCTGAGGACTGCCTTGGCATGGG + Intergenic
900396962 1:2457045-2457067 CCTGAGGACTGGAGCCCCGGGGG - Intronic
901929145 1:12585796-12585818 CATGAGGACTGGGCGGGCGGAGG + Intronic
902385546 1:16073535-16073557 CCAGAGGACGGGCGGGGCGGGGG + Exonic
905361686 1:37425221-37425243 CCTGAGAACTGGCTCTCGGGAGG - Intergenic
911133923 1:94418841-94418863 CCTGAGTGCTGGCTGGGCGCCGG - Intronic
912524464 1:110270847-110270869 CCTGCAGACTGGCTCTGCGGTGG + Intronic
914923164 1:151860922-151860944 CCTGAGGACTGACTGGGGAGAGG - Intergenic
915368743 1:155330494-155330516 GATGAGGACTGGCTCCGCTGTGG + Exonic
917471976 1:175333802-175333824 GGTGAGGACTGGCTCTGTGGAGG + Intronic
921159586 1:212463655-212463677 GCTGAGGACTGGCTCCCAGGAGG + Intergenic
921955993 1:220983759-220983781 CCTGTGCACAGGCTCGGCTGAGG - Intergenic
922584859 1:226725881-226725903 CCTCAGAACTGGCTCTGCTGTGG + Intronic
923323270 1:232857526-232857548 CCTGAGGACTGGCTAGATAGAGG - Intergenic
924777272 1:247119067-247119089 CCTAAGGACTGGTTTGGGGGCGG - Intergenic
1062922669 10:1291877-1291899 CCCGAGGCCTGGCTGGGCAGAGG + Intronic
1062971778 10:1654009-1654031 CCTGGGGGCTGGCTCTGTGGAGG + Intronic
1063154964 10:3370627-3370649 CCTGAGGACTGGCAGTGGGGCGG - Intergenic
1065497758 10:26347564-26347586 CATGAGGACTGCCTGGGAGGAGG - Intergenic
1070140594 10:73734635-73734657 CCTGGGGACTTGCTAGGTGGGGG - Intergenic
1070677459 10:78421875-78421897 CCTGAGGGCTGGGTGGGCTGGGG + Intergenic
1071895434 10:90061343-90061365 ACTGAGGACTAGCTCTGCAGTGG + Intergenic
1072718205 10:97765464-97765486 CCTGAGGTCTGGCTAGCAGGTGG - Intergenic
1074592068 10:114822302-114822324 CCTCGGGCCTGGCTCTGCGGGGG + Intronic
1076924518 10:133475726-133475748 GCTGAGGACTGCCTGGGCTGAGG + Intergenic
1076924542 10:133475793-133475815 GCTGAGGACTGCCTGGGCTGGGG + Intergenic
1076924565 10:133475861-133475883 GCTGAGGACTGCCTGGGCTGAGG + Intergenic
1076924582 10:133475912-133475934 GCTGAGGACTGCCTGGGCTGAGG + Intergenic
1076924586 10:133475928-133475950 GCTGAGGACTGCCTGGGCTGAGG + Intergenic
1076965042 11:76019-76041 CTTGAGGGCTGGCTTGGCTGTGG - Intergenic
1077225994 11:1439402-1439424 CCAGAGGACTGGGGGGGCGGGGG + Intronic
1081279095 11:41186611-41186633 CCTGAACACTGGGTCGGAGGTGG + Intronic
1084600461 11:70142524-70142546 CCTGGGGAGTGGCGGGGCGGGGG - Intronic
1084659472 11:70538493-70538515 CCTTAGCACTGGCTCAGGGGAGG - Intronic
1085284411 11:75350689-75350711 CCTGAGGAGTGGCTGGCCAGGGG - Intronic
1085475069 11:76784098-76784120 CCTGGGGACTGGCTGGGCAGGGG + Intronic
1085748720 11:79140197-79140219 GCTGAGGACTGGCTAGCAGGTGG - Intronic
1100854239 12:98744916-98744938 CAAGAGGACTGGCTCAGTGGTGG - Intronic
1105029368 12:132872077-132872099 CCTGAGGAATGGCTGGGCTCAGG + Intronic
1112050715 13:95642075-95642097 CCTGAGGGCTGTGGCGGCGGCGG - Exonic
1112374075 13:98822494-98822516 CCAGAGGTCTGACTCGGCAGAGG + Intronic
1113890259 13:113731770-113731792 CCTGGGGACTGGCGAGGCTGAGG + Intronic
1118019398 14:61695602-61695624 CCTGAGGAGAGGCTCGGAGCCGG + Intronic
1119730562 14:76948411-76948433 GCTGAGCACTGGCTCGGTGCCGG - Intergenic
1119776544 14:77252699-77252721 CCTGAGGAGGGACTCGGAGGAGG + Intronic
1124157077 15:27235340-27235362 CCTGAGGATTTGCTGGGCTGTGG - Intronic
1124808598 15:32911085-32911107 CCTGAAGACTGGCTCATGGGAGG - Intronic
1125739474 15:41952132-41952154 GCTGTGCACTGGCTCGGCTGAGG - Intronic
1126849123 15:52786960-52786982 CCTGAAGCCTGGCTCTGGGGTGG + Intronic
1127331325 15:57942950-57942972 AGTGAGGATTGGTTCGGCGGGGG + Intergenic
1129266574 15:74396555-74396577 CCTGAGGCCTGGCTGGCAGGAGG + Intergenic
1129408929 15:75338281-75338303 CCTGGGGACTGGCTCAGAGCAGG - Intronic
1129733015 15:77942505-77942527 CCTGGGGACTGGCTCAGAGCAGG + Intergenic
1132374877 15:101322480-101322502 CCTGAGGAATGTCAGGGCGGTGG - Intronic
1132443082 15:101887497-101887519 CTTGAGGGCTGGCTTGGCTGTGG + Intergenic
1132766949 16:1539211-1539233 CCTGAGGCTTGGGTCGGCGTTGG - Intronic
1133170595 16:3980489-3980511 CCTCAGGAGAGGCTGGGCGGGGG + Intronic
1135775868 16:25257449-25257471 GCTGAGGAAAGGCTGGGCGGAGG + Exonic
1136337937 16:29622890-29622912 CCTGAGGACTGACACGGCCTTGG - Intergenic
1144672880 17:17142790-17142812 CCTCAGGGGTGGCTCGGGGGCGG + Intronic
1145214871 17:21043410-21043432 CCAGAGGACTGGGGAGGCGGGGG + Intronic
1145254471 17:21315070-21315092 CCTGAGGACTGGCTTGACAGGGG + Exonic
1145322125 17:21772890-21772912 CCTGAGGACTGGCTTGACAGGGG - Intergenic
1146059047 17:29594924-29594946 CCTGGGGGCTGGCTCAGCGTGGG - Intronic
1147134555 17:38427703-38427725 CCCCAGGACTGGCTGGGTGGGGG + Intergenic
1147168742 17:38606230-38606252 ACCGAGGACCGGCTCGGAGGAGG + Intergenic
1147293418 17:39461774-39461796 CCTGAGGACTGGCTCGGCGGAGG + Intronic
1148650830 17:49249181-49249203 CCTGGGGACTGGGTCAGCCGGGG - Intergenic
1149430818 17:56594473-56594495 CCCGAGGACCGGCCCGGCGGGGG + Exonic
1151264998 17:72947983-72948005 CCGGAGGACTGGCTCAGCTGTGG - Intronic
1151763837 17:76122094-76122116 CCTGAGGCCTGGCTCCCCTGGGG + Intergenic
1152743132 17:82027213-82027235 CCTGAGGCCTCGCTCTGCAGGGG + Intronic
1154026999 18:10717337-10717359 TTTGAGGACTGGCACGGTGGAGG + Intronic
1154505867 18:15040376-15040398 CCTGACGACTGCCTCAGGGGAGG - Intergenic
1159076546 18:63687849-63687871 CATCAGGATTGGCTAGGCGGTGG + Intronic
1160040466 18:75340346-75340368 CCTGCAGCCTGGCGCGGCGGTGG - Intergenic
1160431313 18:78814661-78814683 CCTGAGGCTTGGCCCGTCGGAGG + Intergenic
1160580841 18:79883997-79884019 CGTGGGGACTGGCTAGACGGGGG - Intronic
1160641847 19:145649-145671 CTTGAGGGCTGGCTTGGCTGTGG - Intergenic
1160923912 19:1533909-1533931 CCTGTGGACAGACTCGGCTGAGG - Exonic
1161086409 19:2337642-2337664 CCTGAGAGCTGGCCCAGCGGGGG - Intronic
1161265329 19:3361004-3361026 ACTGGGGACTGCCTGGGCGGCGG + Intronic
1161410157 19:4112595-4112617 CCTGAGGAGCGGCCGGGCGGGGG - Intronic
1161736569 19:5995404-5995426 ACTGCAGACTGGCTCGGCTGGGG - Intronic
1162490374 19:10987785-10987807 CCGGGGGACTGGGTCTGCGGTGG - Exonic
1163593149 19:18205346-18205368 GCTGGGGACTGGGTTGGCGGCGG - Intergenic
1163831793 19:19550549-19550571 CCTGGGGGCTGGCTAGGCTGGGG + Intergenic
1164533716 19:29068061-29068083 CCTGAGGACTGGCTCTCAGCTGG + Intergenic
1165068299 19:33241386-33241408 CGTGAGGCCTGGCTGGGAGGAGG + Intergenic
1167262953 19:48469372-48469394 GCTGAGGACTGGCGCTGAGGAGG + Exonic
1167340772 19:48914525-48914547 CCTGATCACTGGCTCTGAGGGGG - Intronic
1167529873 19:50008567-50008589 CCTGGGCACTGGCTGGGCAGAGG + Intronic
1167587266 19:50382268-50382290 CCTGAGGAAAGACTCTGCGGAGG - Intronic
926139365 2:10359260-10359282 GCTGCGGGCTGGCTCGGCGAGGG + Intronic
926367464 2:12146236-12146258 CCTGAGGAGGGGGTCGGTGGTGG - Intergenic
929587450 2:43125449-43125471 CCTGGGGACTGACTGGGTGGGGG - Intergenic
932564311 2:72896047-72896069 TCTGAGGACTTGGTCGGCAGAGG + Intergenic
937814688 2:126238137-126238159 CCTGAGGACTGGCAGGGAGGGGG - Intergenic
938766233 2:134462118-134462140 CCTGGGAACAGGCTCGGGGGCGG + Intronic
942462481 2:176178014-176178036 CCTGAGGACACGCTCGGGAGCGG + Intergenic
943155085 2:184165761-184165783 TCTGAGGACTGCCTTGGAGGTGG - Intergenic
945048542 2:205802292-205802314 CCTGAGGCTTGGCAAGGCGGAGG - Intergenic
946836298 2:223776098-223776120 GATGAGGAGAGGCTCGGCGGGGG - Intronic
948460898 2:238129429-238129451 CCTGAGGCCGGGCTGGCCGGGGG + Intronic
1170646700 20:18203020-18203042 CCTGAGGACTGGCTCACCAGGGG - Intergenic
1171790141 20:29515346-29515368 CCTGAGGACTGGCTCTGCCTGGG + Intergenic
1176791996 21:13328650-13328672 CCTGACGACTGCCTCAGGGGAGG + Intergenic
1177991393 21:28039656-28039678 CCTGACGACTGCCTCAGGGGAGG + Intergenic
1179255840 21:39714555-39714577 CCTGAGGGCTGGCTCCTCTGAGG + Intergenic
1179540623 21:42081285-42081307 GCTGAGGACTGGGTGGGCTGAGG - Intronic
1180390845 22:12280467-12280489 CCTGAGGACTGGCTCTGCCTGGG + Intergenic
1180408898 22:12584290-12584312 CCTGAGGACTGGCTCTGCCTGGG - Intergenic
1181681475 22:24498606-24498628 CCTCAGGGCTGGCTAGGCGGAGG + Intronic
1184655908 22:45941969-45941991 CCTGAGGCCTGGCTGGGGAGGGG + Intronic
1184755742 22:46514870-46514892 CCTGAGGGCTGGATTGACGGCGG - Intronic
1184962758 22:47943599-47943621 CCTGAAGACTGGCTCTGGAGAGG + Intergenic
949966761 3:9363218-9363240 CCTGAAGTCCGGCTCGGCGCCGG - Exonic
951269121 3:20603357-20603379 CCTGAGCACTGGCTCTGCCCAGG + Intergenic
953913492 3:46904392-46904414 CCAGAGGGCTGGCTGGGCAGGGG + Intergenic
961219754 3:125190374-125190396 CCTGAGGACTGGCTGGCTGGTGG - Exonic
961411677 3:126726803-126726825 CCTGAGGACTGGGTGTGTGGAGG + Intronic
962169238 3:133083182-133083204 GCTGAGGAGTGGGGCGGCGGGGG - Intronic
962413954 3:135166002-135166024 CCTGATTGCTGGCTCGGCAGCGG + Exonic
968893394 4:3384791-3384813 CCAGAGGACAGACTCTGCGGGGG + Intronic
969558229 4:7928291-7928313 CTTGAGAACTAGCTCAGCGGAGG - Intronic
969651311 4:8469818-8469840 CCTGAGGACAGGCTGGGTGGGGG - Intronic
973806087 4:54527487-54527509 CGTGAGGAGTGGGGCGGCGGGGG - Intergenic
975875502 4:78831142-78831164 CCTGAGGAACGGCTAGCCGGTGG + Intronic
979517971 4:121632934-121632956 CCTGATGAGTGGCTCAGCGCAGG - Intergenic
987290722 5:16505750-16505772 CCAGAGGCCTGGCTCTGCAGTGG - Intronic
988929943 5:36027928-36027950 CCTCAGGCCTGGCTCGGTGCAGG - Intergenic
990236324 5:53771733-53771755 CCTGAGGCCTGGCTATGCAGGGG - Intergenic
992413647 5:76532469-76532491 CCTGAGGATTGGGTGGGTGGGGG + Intronic
994647251 5:102485315-102485337 CTTCAGGACTGGCTCTTCGGTGG + Intronic
999301357 5:150492641-150492663 CCTGAGGTCTGGCTCCACGAGGG + Intronic
1001515922 5:172355270-172355292 CCTGCTGACCTGCTCGGCGGGGG + Intronic
1002735014 5:181378835-181378857 CTTGAGGGCTGGCTTGGCTGTGG + Intergenic
1002749513 6:95287-95309 CTTGAGGGCTGGCTTGGCTGTGG - Intergenic
1007100046 6:39239820-39239842 CCTGAGGATTGGTTGGGAGGCGG + Intergenic
1013289429 6:108707898-108707920 TCTGAGGACTGGCGGGGCGAGGG - Intergenic
1013479906 6:110544369-110544391 CCTCAGGTCTGGCTTGGAGGAGG + Intergenic
1014090116 6:117395049-117395071 CATGAGAATTGGCTCGGTGGAGG + Intronic
1019239272 6:170651152-170651174 CTTGAGGGCTGGCTTGGCTGTGG + Intergenic
1019723839 7:2589662-2589684 CCTGCGCCCTGGCTTGGCGGGGG + Intronic
1023872803 7:44271910-44271932 GCTGAGGACTGGCTCTGGGCAGG + Intronic
1031765583 7:125773059-125773081 CCTGAGCACAGGCCCGGGGGTGG - Intergenic
1032084181 7:128874896-128874918 CCTGAGCCCTGGCTGGACGGCGG + Intronic
1032091827 7:128915162-128915184 CCTGGGGACTGGGTCCACGGGGG + Intergenic
1032540260 7:132697236-132697258 CCTGAGGTCTGGCTATGGGGCGG + Intronic
1034225035 7:149475192-149475214 CCTGGGGACTGGCTCTTCGGAGG - Exonic
1035508498 8:155456-155478 CTTGAGGGCTGGCTTGGCTGTGG - Intergenic
1038326633 8:26577325-26577347 GCTGAGGACTGGAACGGCGGCGG - Intronic
1040572077 8:48620119-48620141 CTGGAGGACTGGCTGGGCTGTGG + Intergenic
1044878000 8:96691763-96691785 CCTGAGGACTAGCTGGGCTTTGG - Intronic
1045335946 8:101205069-101205091 CGTGAGGACTGGCTAGATGGGGG - Exonic
1049054199 8:140222123-140222145 CCTGAGGAGCGGCTCAGCAGAGG - Intronic
1049237513 8:141519445-141519467 CCAGAGGCCTGGCTCTGCTGTGG + Intergenic
1057646251 9:96877572-96877594 CCTGAGGACGCGCTCGGACGCGG - Intergenic
1061518417 9:131103043-131103065 TCTGAGGACAGGCACGGCAGGGG + Intronic
1061797898 9:133098923-133098945 CCTGAGGACAGACTCTGCTGAGG + Intronic
1062339213 9:136086462-136086484 CCTGAGGTCTGGCTTGGTGTGGG + Intronic
1062759480 9:138331443-138331465 CTTGAGGGCTGGCTTGGCTGTGG + Intergenic
1203451490 Un_GL000219v1:120991-121013 CATGAGGACTGGCTCTGCCTGGG + Intergenic
1203599927 Un_KI270748v1:2215-2237 CTTGAGGGCTGGCTTGGCTGTGG + Intergenic
1187173321 X:16871317-16871339 CCTGAGGAGTGTGTCGGGGGAGG + Intergenic
1189332285 X:40151582-40151604 CCTGAGGCCAGGGTCAGCGGGGG + Intronic
1189532605 X:41901951-41901973 CCTGAAGACTGGGTCTGCAGGGG + Intronic
1189688106 X:43586956-43586978 CCTGAGGGCTGGCAAGGCTGGGG - Intergenic
1199182376 X:144873408-144873430 CCTTAGGACTGGTTGGGCAGAGG + Intergenic