ID: 1147301872

View in Genome Browser
Species Human (GRCh38)
Location 17:39535869-39535891
Sequence AGGGCTAAGTGGAATGGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 411
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 376}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147301867_1147301872 -9 Left 1147301867 17:39535855-39535877 CCTAATCATCCATAAGGGCTAAG 0: 1
1: 0
2: 0
3: 9
4: 78
Right 1147301872 17:39535869-39535891 AGGGCTAAGTGGAATGGGAATGG 0: 1
1: 0
2: 3
3: 31
4: 376

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147301872 Original CRISPR AGGGCTAAGTGGAATGGGAA TGG Intronic
903185699 1:21627722-21627744 TGGGCTGAGTGGAATTAGAAGGG - Intronic
903216172 1:21844410-21844432 AGGCCTCAATGGAACGGGAAGGG - Intronic
903257406 1:22112108-22112130 AGTGCTATATGGACTGGGAAGGG - Intergenic
903545402 1:24120790-24120812 AGTCCTGAGGGGAATGGGAAAGG - Exonic
904014335 1:27408433-27408455 ATGGGTAAGTGGTATTGGAAAGG + Intronic
904352438 1:29917412-29917434 AGGGGGAAGGGGAAGGGGAAGGG - Intergenic
905212583 1:36385105-36385127 GGGGCCAAGTGGCGTGGGAATGG + Intronic
906071368 1:43019067-43019089 TGGGCTAAGGGGCATGGGCAGGG + Intergenic
906416085 1:45622200-45622222 AGAGATAAGTGGGATGGGATAGG + Intronic
906643948 1:47459545-47459567 AGGGCTAAGTGAGATGGGGAGGG + Intergenic
907621288 1:55983449-55983471 AAGGCGAAGGGGAAGGGGAAGGG + Intergenic
907793077 1:57687007-57687029 AGGACTATGTTGAATGGGAGTGG - Intronic
908089445 1:60670774-60670796 AGGGCCAAGTGGAGTGGGTTAGG + Intergenic
908276682 1:62480567-62480589 ACGGCCAAGTGGACAGGGAAGGG + Intronic
908528249 1:65008628-65008650 AAGGCGAAGGGGAAGGGGAAGGG - Intergenic
908544393 1:65148891-65148913 AGGGCTAAGGGGTACGGGGACGG - Intronic
908682007 1:66672573-66672595 AGGTCTATGTGGTATGGTAACGG - Intronic
909337619 1:74493946-74493968 ATGGGTAACTGGAGTGGGAATGG + Intronic
909980296 1:82091785-82091807 AGTGCTGAGGGGATTGGGAATGG - Intergenic
911437215 1:97876658-97876680 ATTTCTAGGTGGAATGGGAAGGG - Intronic
911890097 1:103357602-103357624 AGTGCTATGTTGAATGGGACTGG - Intergenic
913248113 1:116888125-116888147 AGGGATAAGGGGAAGGGGAGGGG + Intergenic
913457748 1:119050873-119050895 AGGGGTAAAGGGAATAGGAAGGG + Intronic
916291371 1:163170146-163170168 AGTGCTAAGGTGACTGGGAAAGG - Intronic
916475185 1:165162336-165162358 AGGGCAAAGAGGAGTAGGAAGGG + Intergenic
916862459 1:168820770-168820792 GGGGCTGAGGGGAGTGGGAATGG + Intergenic
918030436 1:180802680-180802702 TGGGCTGAGTGGAAGGTGAATGG - Intronic
919565930 1:199187909-199187931 AGGGCTTAGTGGAATAAGAATGG + Intergenic
919840503 1:201605781-201605803 AGGGCTAAGGAGAGGGGGAATGG + Intergenic
920230190 1:204465165-204465187 AGGGCTATGGGGGATGGGGAGGG - Intronic
920445029 1:206009816-206009838 AGGGCTGAGTGGAGTTGCAAAGG + Exonic
921823548 1:219645245-219645267 AGGGCTACGTTGAATGGCAGTGG - Intergenic
922043907 1:221924827-221924849 AGAGCTAACTGGACTGAGAATGG - Intergenic
923929377 1:238676410-238676432 AGAGCTAAGTGGAATGTGATTGG + Intergenic
924880887 1:248161329-248161351 AGGGATAGATGGAATGTGAAGGG - Intergenic
1063251990 10:4283879-4283901 AGGGATGAGAGGAAGGGGAAGGG - Intergenic
1063453463 10:6166791-6166813 AGGGCTAGGAGAAGTGGGAAAGG - Intronic
1063685776 10:8235873-8235895 AGGGCTAAGTGGGGAGGGCAGGG + Intergenic
1064233103 10:13547339-13547361 TGGACTAAGGGGAATGAGAATGG + Intergenic
1064595717 10:16942838-16942860 AGGGGGAAGGGGAAGGGGAAGGG + Intronic
1065696831 10:28388121-28388143 AGGGGAAGGTGGAAGGGGAAAGG + Intergenic
1066004255 10:31132939-31132961 AGGAATAAGTGGGAGGGGAATGG + Intergenic
1067013618 10:42738314-42738336 AGAGTTAAGGGAAATGGGAAGGG - Intergenic
1067310159 10:45105426-45105448 AGAGTTAAGGGAAATGGGAAGGG + Intergenic
1067858322 10:49817440-49817462 AGGCCCCAGTGGAATGGGGATGG + Intergenic
1069000392 10:63256841-63256863 AAGGCAAAGTGAAATGGAAAAGG + Intronic
1069851580 10:71408800-71408822 AGGGCAGAGGGGAATGGGAAAGG + Intronic
1070636833 10:78135230-78135252 AGGGCTAAGAGGAATAGGAAGGG + Intergenic
1070988356 10:80708228-80708250 TGGGATAAGCGGAATGGGGAAGG + Intergenic
1071953191 10:90728372-90728394 AGGGCTAGGTAGGATGGGAATGG - Intergenic
1072938628 10:99737472-99737494 AGGGCTGAGAGGCATGAGAAGGG + Intronic
1073821793 10:107272689-107272711 AGGGGTTTGTGGACTGGGAAAGG - Intergenic
1074126237 10:110530708-110530730 AGGGGTGAGTGGAAGGGGAAAGG - Intergenic
1074166132 10:110876502-110876524 AGGAATATGTGGAATGTGAAAGG - Intronic
1074792078 10:116899463-116899485 AGGCCAAAGTGGAGGGGGAAGGG + Intronic
1075284506 10:121171845-121171867 AGGGAGAAGGGGAAGGGGAAAGG + Intergenic
1076622202 10:131797803-131797825 AGGGCTAAGTCAGATTGGAATGG + Intergenic
1077860752 11:6177153-6177175 GGGGCTTAGGGGAAAGGGAATGG + Intergenic
1078000452 11:7490520-7490542 AGCTCTAGCTGGAATGGGAAAGG - Intronic
1078175539 11:8967055-8967077 AGGGAAAAGGGGAATGGGAGAGG + Intergenic
1078384114 11:10872763-10872785 AGGGGTAAGGGGAAGGGGAAGGG - Intergenic
1080438543 11:32268928-32268950 AAGGGGAAGGGGAATGGGAAGGG + Intergenic
1081875203 11:46403833-46403855 AGGGCCAAGGGGAGTGGGGAGGG + Intronic
1081933137 11:46886332-46886354 AGGGCCAAGTGGGATGGAACAGG - Exonic
1082106010 11:48222626-48222648 GGGGCAAGGTGGACTGGGAATGG - Intergenic
1082196804 11:49316264-49316286 AGGGGTAAGGGGAAGGGGAAGGG + Intergenic
1082954801 11:58858497-58858519 AGAGACAAGTGGAAAGGGAAGGG - Intronic
1082971859 11:59031198-59031220 AGAGACAAGTGGAAGGGGAAGGG - Intronic
1082975902 11:59071408-59071430 AGAGTCAAGTGGAAAGGGAAGGG - Intergenic
1083047272 11:59748293-59748315 AGGGCTTTGTGGTCTGGGAATGG + Intronic
1083524865 11:63353703-63353725 AGTGCTAAGTTGAATGGGAGTGG - Intronic
1085014112 11:73161297-73161319 AGGGGTAGGAGGAAGGGGAATGG - Intergenic
1085068634 11:73521420-73521442 TGGGCTCAGTGGAATGGAAGAGG - Intronic
1085262091 11:75212063-75212085 AGGGAAGAGTGGAATGGGAAAGG + Intergenic
1085879402 11:80448208-80448230 AGGGAGAAGGGGAATGGGAAAGG - Intergenic
1089173873 11:116534741-116534763 AGGGTAAGGAGGAATGGGAAGGG + Intergenic
1089322502 11:117635934-117635956 AGGGCTGAGGGGTGTGGGAATGG - Intronic
1090265952 11:125353055-125353077 CTGGCTGAGTGGAATGGGAATGG - Intronic
1090505390 11:127306929-127306951 AGGGGGAAGGGGAAGGGGAAAGG - Intergenic
1091493568 12:952958-952980 AGGGAAAAGGGGAAGGGGAAGGG + Intronic
1091599738 12:1910835-1910857 AGAGCTAAGAGGAAGGGGATAGG + Intronic
1092944734 12:13442176-13442198 AGGGAGAAGTGGAAAGAGAAGGG - Intergenic
1095953752 12:47795344-47795366 TGGGCAAAGTGGAAGGGCAAGGG + Exonic
1095981386 12:47976659-47976681 AGGAGGAAGTGGAAAGGGAATGG - Intronic
1096187161 12:49588723-49588745 AGGGCTGAGTGGAGAGGGTAAGG + Intronic
1096197698 12:49659106-49659128 AGGACTAAATGGAAGGGAAAGGG + Intronic
1096925520 12:55140328-55140350 AGTGCTATGTTGAATAGGAATGG - Intergenic
1097220712 12:57449383-57449405 AGGTCCAAGTGGTATTGGAAGGG - Exonic
1098772513 12:74571325-74571347 ATTGCTAAGTGGAATTGAAATGG - Intergenic
1101835296 12:108290930-108290952 AGAGCTGAGTGGATTAGGAAAGG + Exonic
1102396512 12:112590527-112590549 AGGGCTCAGTGTCATGGAAATGG + Intronic
1102625633 12:114233259-114233281 AGGGAGAAGGGGAAGGGGAAGGG - Intergenic
1103586905 12:121962921-121962943 AGGCCAGAGTGGAATGGGCAAGG + Intronic
1104160197 12:126171525-126171547 AGGGCAGGGTGGAATGGGAGAGG + Intergenic
1104304176 12:127594340-127594362 TGGGCTAACTTGAATGGGGAGGG + Intergenic
1104616402 12:130273496-130273518 AGGAGGAAGGGGAATGGGAAGGG - Intergenic
1105411389 13:20174474-20174496 TTGCTTAAGTGGAATGGGAAGGG + Intergenic
1105534929 13:21257156-21257178 AGGGCTGCCTGGACTGGGAAGGG + Intergenic
1106198126 13:27511315-27511337 AGGGCTGAGGGGAAAGGGAGTGG - Intergenic
1106675894 13:31957653-31957675 AGGGGGAAGGGGAAGGGGAAGGG + Intergenic
1107149814 13:37098247-37098269 AGGGCTAAGGGGACCGTGAAAGG + Intergenic
1107417170 13:40211520-40211542 GGGGGTCAGGGGAATGGGAAAGG - Intergenic
1107504236 13:41015357-41015379 AGGGATAACTGGGATGGGAAAGG + Intronic
1107828616 13:44353615-44353637 AGGAAGAAGTGGAATGGGACTGG + Intergenic
1107976700 13:45695260-45695282 AGGGCTGAGGGGAGTGGAAAGGG + Intergenic
1108178695 13:47820217-47820239 AGGGCTAAGTAGAAAATGAAGGG - Intergenic
1108865244 13:54915264-54915286 AGGACTATGTTGAATAGGAATGG - Intergenic
1109478632 13:62918788-62918810 AGGTTTAAGTCGAATGGGAACGG - Intergenic
1111296423 13:86284712-86284734 AGGGCAAAGTGGTATGTGATAGG - Intergenic
1111353784 13:87070300-87070322 AAGGGGAAGTGGAAGGGGAAGGG - Intergenic
1111711746 13:91824464-91824486 ATGGCAAAGTGAAATGTGAAAGG + Intronic
1112072718 13:95872881-95872903 AGGGATAAGTGGAGAGGAAATGG + Intronic
1114201238 14:20522618-20522640 AAGGGGAAGTGGAAGGGGAAGGG + Intergenic
1115102477 14:29719526-29719548 AGGGCTAAATGGTATTGAAATGG + Intronic
1117080614 14:52148420-52148442 AGGACTATGTTGAATAGGAATGG + Intergenic
1117323601 14:54648103-54648125 AGGATTAAGTGGGAGGGGAATGG + Intronic
1118745613 14:68770904-68770926 AGGGCTAAGTAGACAGGGAGGGG - Intergenic
1119008495 14:70957607-70957629 AGGGCTAAGGAGGATGGAAAGGG + Intronic
1119443125 14:74642268-74642290 GGGGCTAAGTGTAAAGGGACAGG - Intergenic
1120930056 14:89839343-89839365 AGAGCAAAGTAGAATGGGGATGG + Intronic
1121210786 14:92206887-92206909 AGTGCTAAGTGCAAGGGGCAAGG + Intergenic
1121780799 14:96620948-96620970 GGGGAGAAGTGGAATGGGCATGG - Intergenic
1121931794 14:97978869-97978891 GGGGCTGAGTGCAAGGGGAAAGG - Intergenic
1122042338 14:98997753-98997775 AGGGCAAAGTGTAAAGGGATTGG + Intergenic
1124013885 15:25860652-25860674 AGGGCAGAGTGGAAGGGGAGGGG + Intronic
1124372314 15:29110756-29110778 GGGGCTAACATGAATGGGAAAGG + Intronic
1124657608 15:31521889-31521911 AGGGCTAAGTGGAAGCTGAGAGG - Intronic
1124866118 15:33493001-33493023 GGGTGTAAGTGGAATGGGAAAGG + Intronic
1124921054 15:34027191-34027213 AGAGTAGAGTGGAATGGGAATGG - Intronic
1125452067 15:39819305-39819327 AAGCCTAAGTGCAATGTGAATGG - Intronic
1125679645 15:41522817-41522839 AGGGCAGTGAGGAATGGGAAGGG + Exonic
1125684663 15:41556814-41556836 AAGGGGAAGTGGAAGGGGAAGGG + Intergenic
1126778449 15:52119071-52119093 TGGGGGAAGGGGAATGGGAAGGG + Exonic
1127293400 15:57590229-57590251 AGGGCTTCGTGGAAGTGGAATGG + Intergenic
1127470163 15:59282982-59283004 AGGGGAAAGGGGAAAGGGAAAGG + Intronic
1128559688 15:68656328-68656350 TTGGCTGAGTGGAATGGAAAGGG - Intronic
1129060477 15:72856854-72856876 AGGGCAGAGTGGGGTGGGAAGGG - Intergenic
1130746257 15:86657144-86657166 AAGGCTTAGTGGAAGGGGCATGG - Intronic
1130959887 15:88652529-88652551 AGGGCAAAGGGGGAGGGGAAGGG - Intronic
1131089853 15:89615424-89615446 AGGGCTAGGGGGAAGGGGCAGGG + Intronic
1131378267 15:91943234-91943256 AGGGCTGAGGGGAGGGGGAATGG - Intronic
1131943918 15:97598212-97598234 ATGGCGATGTGAAATGGGAATGG + Intergenic
1132294548 15:100725822-100725844 TGGGTTAAGGGGAATGGGATCGG + Intergenic
1132582452 16:691226-691248 AGGGCTTGGTGGGCTGGGAATGG - Intronic
1133303224 16:4795575-4795597 AGGGAGAAGTGGAGTGGGAGGGG + Intronic
1133574074 16:7070779-7070801 ATGGCTAAGGGGAAGGGGGATGG - Intronic
1135063764 16:19292074-19292096 GGGGCTGAGTGGAGTGAGAAGGG - Intronic
1135501370 16:22998886-22998908 AGTGATAAGTGGAAAGAGAAAGG + Intergenic
1135706057 16:24676008-24676030 AGGGCTAAATGGAAAAGGAAGGG + Intergenic
1135741197 16:24976567-24976589 AGGGGAAAGGGGAAAGGGAAGGG + Intronic
1135846549 16:25924094-25924116 TGGGCTCAGTTGTATGGGAAAGG - Intronic
1136294462 16:29293630-29293652 AGGGCTGAGTGGAAATGGAGGGG + Intergenic
1136777155 16:32878039-32878061 AGGGCTCACAGGAATGGGAGTGG + Intergenic
1136893466 16:33983474-33983496 AGGGCTCACAGGAATGGGAGTGG - Intergenic
1137301852 16:47156947-47156969 TGTGCTAAATGGAATGGAAAGGG + Intronic
1137374201 16:47938382-47938404 AGGGCTATGTGGAATATGAGTGG - Intergenic
1137780718 16:51095721-51095743 CGGGCTGGGTGGAATGGGCAGGG - Intergenic
1138108531 16:54305124-54305146 AGGGCGAAGGGGAAGGGGCAGGG - Intergenic
1138519889 16:57564992-57565014 AGGGCTGAGTGGAGGGGAAATGG - Intronic
1139478882 16:67217327-67217349 AGGACTAGGAGGAAGGGGAACGG - Intronic
1139663490 16:68438693-68438715 AGGGGTGAGTGGGATGGGGAAGG - Intronic
1139745629 16:69072356-69072378 AGGGCAAGGTGGAGTGGGTATGG - Intronic
1140062537 16:71583293-71583315 AGGGCTAAGGGGAAATTGAAGGG - Intergenic
1140465356 16:75176792-75176814 AGGGAAAAGAGGAATAGGAAGGG + Intergenic
1140861510 16:79022564-79022586 AGGACAAAGAGGAATGGGGAAGG + Intronic
1142100364 16:88267674-88267696 AGGGCTGAGTGGAAATGGAGGGG + Intergenic
1203079570 16_KI270728v1_random:1140148-1140170 AGGGCTCACAGGAATGGGAGTGG + Intergenic
1142509153 17:383878-383900 AGGGCATCGTGGAGTGGGAAGGG + Intronic
1142864875 17:2784730-2784752 AGGGGGAACTTGAATGGGAAAGG + Intronic
1143231002 17:5355072-5355094 AGGACGCAGTGGAATGGGACAGG - Intronic
1143574129 17:7779976-7779998 AGACCAAAGTGGACTGGGAAGGG + Intronic
1143612918 17:8030296-8030318 AGGGCTAAGCAGAATGAGATAGG - Intergenic
1144389377 17:14779561-14779583 CTGGCTAAGTTGGATGGGAAAGG + Intergenic
1144564966 17:16352807-16352829 AGGGCTGTGTGGCCTGGGAATGG - Intronic
1145902414 17:28497308-28497330 CGGGCTCAGAGGAGTGGGAATGG - Exonic
1146008740 17:29178421-29178443 AGGGATTAGGGGAATGAGAAGGG - Intronic
1147301872 17:39535869-39535891 AGGGCTAAGTGGAATGGGAATGG + Intronic
1147317819 17:39629236-39629258 AGGGCTAAGTGGGCAGGGAGGGG - Intronic
1148164536 17:45473960-45473982 AGGGAGAACAGGAATGGGAAAGG + Intronic
1149510493 17:57237202-57237224 TGGGCAAAGTGGCAGGGGAAAGG - Intergenic
1150395757 17:64820614-64820636 AGGGAGAACAGGAATGGGAAAGG + Intergenic
1150640929 17:66948913-66948935 TGGCCTAAATGGAATCGGAAGGG - Intergenic
1154147962 18:11881581-11881603 TGGGCTAAGGCCAATGGGAAGGG - Exonic
1155126347 18:22880255-22880277 ATGGTTAAGTGTAATGGGACAGG + Intronic
1155450414 18:25957519-25957541 AGGGCAAAGAGAAATAGGAAGGG - Intergenic
1155994324 18:32313728-32313750 ATTGCGAAGTGGAATGGTAAAGG + Intronic
1157567095 18:48686664-48686686 CTGGCTATGTGGAAAGGGAAGGG + Intronic
1160491618 18:79341910-79341932 AGGGTTTAGGGGAAGGGGAATGG - Intronic
1160714783 19:571297-571319 AGGGCTAACTGGAAAGGGGCAGG - Intronic
1161816537 19:6502702-6502724 AGGTCTAAATAGAATGAGAAGGG - Intronic
1163363917 19:16865671-16865693 AGGGGGAAGGGGAAGGGGAAGGG - Intronic
1164429794 19:28177249-28177271 AGGCCTAAGGGGCAAGGGAAAGG - Intergenic
1164575746 19:29404438-29404460 AGGGCTGAGTGGAAAGGGCTTGG + Intergenic
1164976522 19:32576998-32577020 AAGGGGAAGGGGAATGGGAAAGG - Intergenic
1165802802 19:38563170-38563192 AGGGGAAAGTGGAATGGGAAGGG - Intronic
1166095294 19:40534651-40534673 AAGGCTCAGGGGTATGGGAATGG + Intronic
1167866803 19:52335527-52335549 ATGACTCAGTGGACTGGGAAAGG + Intergenic
1168332578 19:55578857-55578879 AGGGCGAACAGGAAGGGGAAGGG - Exonic
1168334462 19:55589805-55589827 GGGGGTGAGTGTAATGGGAAGGG - Intergenic
925173300 2:1765910-1765932 TGGGGTAAGGGGAGTGGGAAGGG + Intergenic
925896086 2:8473363-8473385 AGGGCTTATGGGAATTGGAAGGG - Intergenic
925921825 2:8643746-8643768 AAGGCCAGGTGGTATGGGAATGG - Intergenic
926311773 2:11680477-11680499 AGGTCAAGGTGGAATGGGAATGG + Intronic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
927292795 2:21421163-21421185 AGCGCTGAGTCCAATGGGAAGGG - Intergenic
929426675 2:41851145-41851167 AGGGCTGAGTGGAATGGCAGAGG - Intergenic
929481215 2:42310287-42310309 AAGGGAAAGGGGAATGGGAAGGG - Intronic
930084092 2:47480299-47480321 AGGGGAAAGGGGAAGGGGAAGGG - Intronic
930288561 2:49465446-49465468 AGGGGAAAGGGGAAAGGGAAAGG - Intergenic
930288568 2:49465465-49465487 AGGGGAAAGGGGAAAGGGAAGGG - Intergenic
931118561 2:59191348-59191370 AGTCCTAAAGGGAATGGGAAAGG + Intergenic
933250651 2:80025121-80025143 AGGGCAAAGTGGAGTGGCAGAGG - Intronic
933250870 2:80027201-80027223 AGGAGTTAGTGGTATGGGAATGG + Intronic
937792747 2:125979751-125979773 TGGGGCAAGTGGAAAGGGAAGGG + Intergenic
938657338 2:133447619-133447641 AGGGGGAAGGGGAAGGGGAAAGG - Intronic
938761946 2:134434031-134434053 AGGGCTAAGTGGTGTGTGAAGGG - Intronic
940093991 2:149952852-149952874 AGGGCTCAGGAGAAGGGGAAAGG - Intergenic
940503198 2:154520541-154520563 AGGGCTAGTTGGGGTGGGAAAGG - Intergenic
940759795 2:157725259-157725281 AGGGGTAAGAGGAGGGGGAATGG + Intergenic
941677555 2:168360103-168360125 AGGACTACATGGAATGGGAGAGG + Intergenic
942000265 2:171639506-171639528 TGGGTTAGGTGGAATGGGGATGG - Intergenic
942908167 2:181208259-181208281 AGGGGTAAGTGAAATAGGCATGG + Intergenic
946010493 2:216560143-216560165 AAGGGGAAGGGGAATGGGAAGGG - Intronic
946168724 2:217881011-217881033 ATGCCTAAGTGGGATGGGAAAGG + Exonic
947634419 2:231672897-231672919 AGGGCTGAATGGAATGAGATGGG + Intergenic
948576280 2:238952315-238952337 AGGGCTGGGTGGAACGGGATTGG - Intergenic
948856561 2:240732925-240732947 AGGGATAAGGGGATGGGGAAGGG + Intronic
1169876108 20:10298540-10298562 CAGGTTGAGTGGAATGGGAATGG - Intronic
1170709843 20:18780764-18780786 AGGGCAAACTGGAGTGGAAATGG - Intergenic
1172261772 20:33573301-33573323 AGCGCTAAGGAGAAAGGGAAAGG + Intronic
1172311587 20:33922454-33922476 GGAGTTAAGTGGAAAGGGAAGGG - Intergenic
1172762813 20:37333897-37333919 AAGGCCAAGGGGAAGGGGAAGGG + Intergenic
1172803557 20:37595440-37595462 GGGGGGATGTGGAATGGGAAGGG - Intergenic
1173646108 20:44634094-44634116 GGGGCTAAGAGAAAGGGGAAAGG - Intronic
1173687414 20:44933198-44933220 AGGGCCAAGGGGAATGGGGGTGG + Intronic
1174058194 20:47814071-47814093 AGGGCTGAGGGGAAGGAGAATGG + Intergenic
1174062711 20:47843945-47843967 AGGGGGAAGTGGAAGGGGAAGGG + Intergenic
1175084192 20:56445208-56445230 AGGGAGAGGTGGAGTGGGAAAGG - Intronic
1175625072 20:60483189-60483211 AGGGGTAAGTGGGATAGGATGGG + Intergenic
1175643875 20:60654618-60654640 AGGACTATGTGGAGTGGGCAGGG + Intergenic
1178055078 21:28789432-28789454 AGGCCTAAGGGGCATGGGAGAGG + Intergenic
1180042465 21:45287505-45287527 AGGGGTCAGGGGAATGGGATGGG - Intronic
1182151343 22:28029248-28029270 AGGGCTGAGTTGAGTGGGAAGGG - Intronic
1184407751 22:44309505-44309527 AGGGCTGGGTGGGAAGGGAACGG - Intronic
1184517495 22:44971652-44971674 AGGGCTAAGTTTTCTGGGAAGGG - Intronic
949493519 3:4610947-4610969 AGGGGGAAGGGGAAGGGGAAGGG - Intronic
949590547 3:5489973-5489995 AGGGCTAGGAGGAAGGGTAAAGG - Intergenic
950174488 3:10863238-10863260 AGGGCTAAGTAGAAGGAGGAAGG + Intronic
950811013 3:15649776-15649798 AGGGCTCTGTGAACTGGGAATGG - Intergenic
951261060 3:20509415-20509437 AGTGCTATGTTGAATAGGAATGG + Intergenic
951579228 3:24144252-24144274 AGGGCTAATTGGAATGTGGCTGG + Intronic
952338393 3:32424605-32424627 AGGGCTCAGTGGTCTGGGAGAGG - Intronic
955699442 3:61669469-61669491 AGGAGTAAGAGGGATGGGAATGG - Intronic
957136045 3:76290549-76290571 AGGACTAAGTGGAATAGGAGTGG + Intronic
957628535 3:82687280-82687302 GTGACTAAGTTGAATGGGAATGG + Intergenic
958885444 3:99721406-99721428 AGGGGAAAGGGGAAAGGGAAAGG + Intronic
958892672 3:99797752-99797774 AGGGCTATGTAGAATGTCAAAGG + Exonic
959083491 3:101827345-101827367 AGGAGTAAGGGGAATGGTAATGG - Exonic
959614935 3:108336652-108336674 AGATCTAAGAGGAATGTGAAAGG + Intronic
959795387 3:110421825-110421847 AGGGCTTAGGGGATGGGGAATGG - Intergenic
959799221 3:110471193-110471215 AGAGTTGAGTGGGATGGGAAGGG - Intergenic
960302277 3:116017935-116017957 AGGGGTAGGTGGCATGGGATTGG + Intronic
962882143 3:139588252-139588274 AGCGCTCAGTGTCATGGGAAAGG - Intronic
963213476 3:142719884-142719906 AGAGCTAAATGGAATTGAAATGG + Intergenic
963492934 3:146023611-146023633 ATAGCTGAGTGGAATGGGATGGG + Intergenic
964022688 3:152033065-152033087 AGGGCTAGGTGTAGTGGGGAAGG + Intergenic
964407206 3:156361373-156361395 AGGGGTATGTGGAGTAGGAATGG - Intronic
964486052 3:157186260-157186282 AGGGATGAGTTGAATGGGCAAGG + Intergenic
964762807 3:160150576-160150598 AGGGCAAACAGGAGTGGGAAAGG + Intergenic
964833329 3:160910244-160910266 AGGGGAAAGGGGAAGGGGAAAGG - Intronic
965005283 3:163014090-163014112 AGGGTTAAGAGAAAGGGGAAGGG + Intergenic
965199167 3:165634245-165634267 AGGGCTAATTGCAATAGCAAGGG + Intergenic
965622249 3:170653744-170653766 AGGGGAAAGGGGAAAGGGAAGGG - Intronic
965749904 3:171965210-171965232 GGGGCTGAGTGGAGGGGGAAGGG + Intergenic
966406925 3:179607739-179607761 GGGGCTACGTGGAAGGGGAATGG - Intronic
966891018 3:184407688-184407710 AGGGCCACGTGGACTGGGAGAGG - Intronic
967176442 3:186865321-186865343 AGGGTTAAGTGGATTGGGGGCGG + Intergenic
968761782 4:2446070-2446092 AGGGCTATATGGGAGGGGAAGGG + Intronic
969871199 4:10106306-10106328 AGGACTAATTGGAGTGGGAGAGG - Intronic
971174459 4:24267417-24267439 AGGGTGAAGGGGAAAGGGAAGGG - Intergenic
972463710 4:39331364-39331386 ACGGCTAAGTGTAGTGGAAATGG - Intronic
973783192 4:54309807-54309829 AGTACAAAGTGGAATGGAAATGG + Intergenic
976385725 4:84455695-84455717 AAGTCAAAGTGGAATGAGAAAGG + Intergenic
977182699 4:93897311-93897333 AGGGCTAAATGGAGAGAGAAGGG - Intergenic
977335050 4:95687215-95687237 ACCCCTAAGTGGCATGGGAAAGG + Intergenic
978349012 4:107801755-107801777 TGGGCTGGCTGGAATGGGAATGG - Intergenic
978617317 4:110610833-110610855 AGGGCTCAGTGGGTTGGGAGTGG - Intergenic
982475895 4:155850122-155850144 AGGGAGCAGGGGAATGGGAAAGG + Intronic
982804838 4:159750427-159750449 AGGGCTATGTTGAATAGAAATGG + Intergenic
983367792 4:166816868-166816890 AGGGCCCAGTGCAATGGGAGGGG + Intronic
984171455 4:176364559-176364581 AGGACTATGTTGAATGGGAGTGG + Intergenic
984858986 4:184219984-184220006 AAGGGTAAGGGGAAGGGGAAGGG + Intronic
986825063 5:11511500-11511522 AGGGGAAAATGGAATGGGAATGG - Intronic
986846248 5:11758491-11758513 AGGCCTGAGTGGATGGGGAAAGG - Intronic
988434231 5:31154605-31154627 ACTGGTGAGTGGAATGGGAATGG - Intergenic
988834023 5:35014019-35014041 ATGGCTAAAGGGATTGGGAATGG - Exonic
988975786 5:36514682-36514704 AGGGGAAAGAGGAATGGGAATGG + Intergenic
991115312 5:62947420-62947442 TGGGCATACTGGAATGGGAAAGG - Intergenic
991243870 5:64488944-64488966 AGGGGTAAGTGGAATTGTTAAGG + Intergenic
991266834 5:64729636-64729658 AGGGCTAAGGGGAAAAGGCAGGG + Intronic
991777467 5:70099142-70099164 AGCGGGAGGTGGAATGGGAAAGG - Intergenic
991856755 5:70974586-70974608 AGCGGGAGGTGGAATGGGAAAGG - Intronic
994803759 5:104416308-104416330 AGTGCTATGTTGAATTGGAATGG - Intergenic
995454374 5:112336088-112336110 TTGGATAAGTGGGATGGGAAGGG + Intronic
996552150 5:124742326-124742348 AAGGCTAAGGGGAATGCAAAAGG + Intronic
998537820 5:142951041-142951063 AGGGGGAAGGGGAAGGGGAAGGG - Intronic
999150744 5:149424394-149424416 TGGGGTAAGTGGAATGGGGCGGG + Intergenic
999467544 5:151822016-151822038 AGGGCTGTGTGGTATGGGAATGG - Intergenic
1000051123 5:157563678-157563700 ATGGCTAAGTAGATGGGGAATGG + Intronic
1000777852 5:165442072-165442094 AGGGCAATGTGGAAGGGAAATGG - Intergenic
1000864907 5:166501487-166501509 GGGACTGAGTGGAATGAGAACGG + Intergenic
1001609130 5:172985738-172985760 AGGGCTAAGTGGAAACAGGATGG - Intronic
1001964464 5:175900693-175900715 AGGGCGAAGGGGCATGGGACTGG - Intergenic
1003245138 6:4376690-4376712 AGGGCCAGGTGGAACAGGAAGGG - Intergenic
1003376296 6:5580776-5580798 AGGGCTGCCTGGACTGGGAAGGG - Intronic
1004128543 6:12897615-12897637 AGGGCTTAGTGGAATGGGAGAGG - Intronic
1004270309 6:14189358-14189380 ACTGCTTATTGGAATGGGAAGGG + Intergenic
1004435837 6:15592735-15592757 TGGGCCATGTGGAAAGGGAATGG - Intronic
1004682125 6:17906402-17906424 AGGGGGAAGGGGAAAGGGAAAGG - Intronic
1004953554 6:20702115-20702137 AGCACTCAGTGAAATGGGAAAGG + Intronic
1010192295 6:73206942-73206964 AGGTCTGAGTGGGATGGGAGTGG - Intergenic
1010312024 6:74398715-74398737 AGGGGAAAGTTTAATGGGAAGGG - Intergenic
1011223976 6:85086765-85086787 AGGGAGAAGAGTAATGGGAATGG + Intergenic
1011631056 6:89324852-89324874 GGGGCTGAAGGGAATGGGAAAGG - Intergenic
1012768301 6:103397231-103397253 AGGGCCACGTGGAAGGGAAATGG + Intergenic
1013282082 6:108647996-108648018 AGAGCTAAGTGGAAAGAGGAGGG + Intronic
1013551339 6:111210650-111210672 TGGGGAAAGTGGCATGGGAAGGG + Intronic
1016567265 6:145470036-145470058 AGGGGTAGGGGGAATGGGGATGG + Intergenic
1016616311 6:146052561-146052583 ATGGCTGAGTGGGATGGGATAGG - Intronic
1016648977 6:146442066-146442088 AGGGGAAAGGGGAAAGGGAAAGG + Intergenic
1016862208 6:148732175-148732197 AAGGCAGAGTGGAAAGGGAAAGG - Intergenic
1017970118 6:159304734-159304756 AGTGCTAAGTGAGAGGGGAAGGG + Intergenic
1018614509 6:165674140-165674162 AGGGAACTGTGGAATGGGAAAGG - Intronic
1020452378 7:8334957-8334979 AGGGGTATGTGGGATGGGGAAGG + Intergenic
1020745779 7:12076172-12076194 AGGGATGGGTGGAATGGGGAAGG + Intergenic
1021289383 7:18823995-18824017 AAGGAGAAGGGGAATGGGAAGGG + Intronic
1023815765 7:43948833-43948855 AGGGCTATGTGACCTGGGAAAGG - Intronic
1023870927 7:44262709-44262731 AGGACAGAGTGGGATGGGAAAGG + Intronic
1025231729 7:57207190-57207212 AGGGGGAAGTGGAAGGGGAAGGG - Intergenic
1026106683 7:67426926-67426948 AGGGGGAAGGGGAAGGGGAAGGG - Intergenic
1027848631 7:83419930-83419952 AGTGCTATGTGGAATAGGAGTGG - Intronic
1028352935 7:89871458-89871480 GGGGCTGAGAGGAGTGGGAATGG - Intergenic
1029925982 7:104317464-104317486 AGGGCTTAGGGGAGAGGGAAGGG + Intergenic
1029986991 7:104931419-104931441 GGGGTTAAGTGCCATGGGAAAGG - Intergenic
1031045078 7:116878655-116878677 AGGGTCAAGTGGAGGGGGAAGGG + Intronic
1031866123 7:127039971-127039993 AGGGGAAAGGGGAAGGGGAAGGG + Intronic
1031947226 7:127854793-127854815 AGTGTTAAGGGGAATAGGAATGG + Intronic
1032516630 7:132510997-132511019 AAGGCTAAATGGAAAGGGAGAGG - Intronic
1032719886 7:134542296-134542318 GGGGGTCAGTGGAATGGGGATGG - Intergenic
1033002235 7:137519166-137519188 GGGGCTAAGTGGAAGAGGAATGG + Intronic
1033804359 7:144937518-144937540 AGGGGGAAGGGGAAGGGGAAAGG - Intergenic
1033850793 7:145492181-145492203 AGCACTAGGTGGAATGGGAGTGG - Intergenic
1034923801 7:155104459-155104481 CAGGCTGAGTGGAATGTGAAGGG + Intergenic
1034944924 7:155255659-155255681 AGGGGAAAGGGGAAGGGGAAGGG + Intergenic
1036633425 8:10531252-10531274 AGGGGCAAGTGGAAGGGGAAGGG - Intronic
1036810177 8:11862588-11862610 AAGGCTGAGTGGGTTGGGAATGG + Intronic
1039456245 8:37709173-37709195 AGGGCTCAGTGGGTTTGGAAGGG - Intergenic
1039631501 8:39116765-39116787 AGCGCTATGTTGAATGGGAGTGG + Intronic
1039742685 8:40396766-40396788 AGGGCAGAGTGGAAGGGGTAGGG + Intergenic
1042793215 8:72631944-72631966 AGGGTTAAGTGGGCTGGGCATGG + Intronic
1044388994 8:91626563-91626585 TGGGCTAAATGGAATTTGAAAGG - Intergenic
1044885933 8:96777408-96777430 AGGGAGAAATGGAAGGGGAAAGG + Intronic
1047124576 8:121946692-121946714 GGGGAGAAGTGGAATGGAAAAGG + Intergenic
1047189384 8:122664068-122664090 AGGTCCAAGGGGAATGGAAAGGG - Intergenic
1047439975 8:124869081-124869103 AGGGCTAAGAGGAAGAGGATGGG + Intergenic
1047547950 8:125838543-125838565 AGAGCTATGTGGAATGTGATTGG + Intergenic
1048034533 8:130665010-130665032 AGGGGTGAGGGGAAGGGGAAAGG - Intergenic
1048246431 8:132807670-132807692 AGAGCTCCCTGGAATGGGAAAGG - Intronic
1050578111 9:7020938-7020960 GGGGGTGAGGGGAATGGGAATGG - Intronic
1054860268 9:69945017-69945039 AGAGCAAAGCCGAATGGGAAGGG - Intergenic
1055621099 9:78126005-78126027 GGGGCTTACGGGAATGGGAAAGG - Intergenic
1057817184 9:98304291-98304313 TGGGGTAAATGGAAGGGGAAGGG + Intronic
1058411077 9:104732142-104732164 AGAGCGAAATGGAAGGGGAAGGG + Intergenic
1059514554 9:114880861-114880883 AGGAAAAGGTGGAATGGGAATGG + Intergenic
1059635811 9:116169650-116169672 AGAGCTAGGTGGAATTGTAAGGG + Intronic
1061251578 9:129429358-129429380 GGGGCTGAGTGGAGAGGGAATGG + Intergenic
1061911761 9:133728767-133728789 AGGGTTCAATGGAATGTGAATGG + Intronic
1062018445 9:134304215-134304237 TGGGCCATGTGGATTGGGAAGGG - Intergenic
1062560276 9:137138605-137138627 CGGGCTAAGAGGAATAGGGAGGG - Intronic
1186292993 X:8120411-8120433 AGGGCAAAGTGAAAATGGAAAGG + Intergenic
1187671278 X:21668171-21668193 AGGGCGATGGGGAAAGGGAATGG - Intergenic
1187843801 X:23515468-23515490 AGGGGAAAGCGGAAGGGGAAGGG - Intergenic
1188353982 X:29167281-29167303 AAGGGGAAGCGGAATGGGAAGGG - Intronic
1188881086 X:35492867-35492889 AGGCATGAGTGGGATGGGAAAGG + Intergenic
1189469281 X:41301503-41301525 AGGGCGGAGTGGTAAGGGAATGG + Intergenic
1189758552 X:44297395-44297417 AGGGGAAAGGGGAAGGGGAAAGG + Intronic
1190154100 X:47973697-47973719 AGGGCTAAGTGGGGAGTGAATGG - Intronic
1190440167 X:50469248-50469270 AGGGCCAATTGGAATGGTACAGG - Intronic
1190595093 X:52044306-52044328 AAGACTAAGAGGAATGTGAATGG - Intergenic
1190613731 X:52209767-52209789 AAGACTAAGAGGAATGTGAATGG + Intergenic
1190618238 X:52260676-52260698 AGTGCTAAGTGGAAGGGTGAGGG + Intergenic
1192068514 X:67912093-67912115 ATGGTTAAGTGAAATGGTAATGG - Intergenic
1192319069 X:70074677-70074699 TGGGCTGAGGGGAGTGGGAATGG - Intergenic
1192545176 X:72006993-72007015 AGGGCAAAGAGGAAGTGGAATGG + Intergenic
1192550434 X:72049166-72049188 AGGGCAAAGTGGACTGGCAGGGG + Intergenic
1192699683 X:73455334-73455356 AAGTCTGACTGGAATGGGAATGG - Intergenic
1192794628 X:74416676-74416698 ATGGCTGAGTGGTATGAGAAAGG + Intergenic
1192936002 X:75859054-75859076 CAGGCTAAGGGGAAGGGGAATGG + Intergenic
1194054074 X:89109692-89109714 AGATCACAGTGGAATGGGAAAGG + Intergenic
1194534684 X:95091687-95091709 GGGGTTAAGGGGAATGGGGAAGG + Intergenic
1194552633 X:95320340-95320362 ATGGCTAAGTGGAATGCTGAGGG - Intergenic
1194931804 X:99897462-99897484 AGGGCTAATTGCACTGTGAAGGG + Intergenic
1195229243 X:102829590-102829612 AGGGCAAAGTAGAATGGCAAAGG - Intergenic
1195769023 X:108329049-108329071 GGGGCTAAGAAGAGTGGGAAGGG + Intronic
1197165129 X:123368643-123368665 AGGTAAAAGTGGAAAGGGAAAGG - Intronic
1197292170 X:124672141-124672163 ATGACTAAGGGGAATGGAAAAGG - Intronic
1199827887 X:151517242-151517264 AGGGGTGAGTGAAATGGGCATGG - Intergenic
1199844606 X:151681720-151681742 AGGGGCAAGTGGCATGGGATGGG - Intergenic
1199872743 X:151913268-151913290 AGTGCGAATGGGAATGGGAAGGG - Intronic
1199988572 X:152970374-152970396 AGGAATGAGTGGAGTGGGAAGGG - Intronic
1200939918 Y:8770560-8770582 AGGGCCAAATGGAAGTGGAAAGG - Intergenic