ID: 1147302505

View in Genome Browser
Species Human (GRCh38)
Location 17:39541149-39541171
Sequence CCATCTACACACAGTTGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 114}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147302502_1147302505 -8 Left 1147302502 17:39541134-39541156 CCTGCTTTCTTCTTCCCATCTAC 0: 1
1: 0
2: 2
3: 40
4: 448
Right 1147302505 17:39541149-39541171 CCATCTACACACAGTTGAGTTGG 0: 1
1: 0
2: 1
3: 5
4: 114
1147302501_1147302505 -7 Left 1147302501 17:39541133-39541155 CCCTGCTTTCTTCTTCCCATCTA 0: 1
1: 1
2: 6
3: 75
4: 905
Right 1147302505 17:39541149-39541171 CCATCTACACACAGTTGAGTTGG 0: 1
1: 0
2: 1
3: 5
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147302505 Original CRISPR CCATCTACACACAGTTGAGT TGG Intronic