ID: 1147306683

View in Genome Browser
Species Human (GRCh38)
Location 17:39569048-39569070
Sequence CTGTGGGTGTGGGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147306683_1147306703 29 Left 1147306683 17:39569048-39569070 CCTTCCTCCTCCCACACCCACAG No data
Right 1147306703 17:39569100-39569122 TTTGATTTGGACATTAGAGGAGG No data
1147306683_1147306694 16 Left 1147306683 17:39569048-39569070 CCTTCCTCCTCCCACACCCACAG No data
Right 1147306694 17:39569087-39569109 TCCCACCCCTCCCTTTGATTTGG No data
1147306683_1147306701 26 Left 1147306683 17:39569048-39569070 CCTTCCTCCTCCCACACCCACAG No data
Right 1147306701 17:39569097-39569119 CCCTTTGATTTGGACATTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147306683 Original CRISPR CTGTGGGTGTGGGAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr