ID: 1147307440

View in Genome Browser
Species Human (GRCh38)
Location 17:39573767-39573789
Sequence CCCCCATGGTGTCGGGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147307440_1147307449 -6 Left 1147307440 17:39573767-39573789 CCTGCTCCCCGACACCATGGGGG No data
Right 1147307449 17:39573784-39573806 TGGGGGCCCCGGACAAGGAAGGG No data
1147307440_1147307452 0 Left 1147307440 17:39573767-39573789 CCTGCTCCCCGACACCATGGGGG No data
Right 1147307452 17:39573790-39573812 CCCCGGACAAGGAAGGGAGGCGG No data
1147307440_1147307457 16 Left 1147307440 17:39573767-39573789 CCTGCTCCCCGACACCATGGGGG No data
Right 1147307457 17:39573806-39573828 GAGGCGGAGGCGGCATCTGCAGG No data
1147307440_1147307450 -3 Left 1147307440 17:39573767-39573789 CCTGCTCCCCGACACCATGGGGG No data
Right 1147307450 17:39573787-39573809 GGGCCCCGGACAAGGAAGGGAGG No data
1147307440_1147307455 3 Left 1147307440 17:39573767-39573789 CCTGCTCCCCGACACCATGGGGG No data
Right 1147307455 17:39573793-39573815 CGGACAAGGAAGGGAGGCGGAGG No data
1147307440_1147307458 28 Left 1147307440 17:39573767-39573789 CCTGCTCCCCGACACCATGGGGG No data
Right 1147307458 17:39573818-39573840 GCATCTGCAGGCCCCTTCCCCGG No data
1147307440_1147307448 -7 Left 1147307440 17:39573767-39573789 CCTGCTCCCCGACACCATGGGGG No data
Right 1147307448 17:39573783-39573805 ATGGGGGCCCCGGACAAGGAAGG No data
1147307440_1147307456 6 Left 1147307440 17:39573767-39573789 CCTGCTCCCCGACACCATGGGGG No data
Right 1147307456 17:39573796-39573818 ACAAGGAAGGGAGGCGGAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147307440 Original CRISPR CCCCCATGGTGTCGGGGAGC AGG (reversed) Intergenic
No off target data available for this crispr