ID: 1147307924

View in Genome Browser
Species Human (GRCh38)
Location 17:39576433-39576455
Sequence CGCTGTTTCCCAGGAGACGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147307924_1147307927 -6 Left 1147307924 17:39576433-39576455 CCGGCGTCTCCTGGGAAACAGCG No data
Right 1147307927 17:39576450-39576472 ACAGCGAGCTCCCCAGAGAAGGG No data
1147307924_1147307926 -7 Left 1147307924 17:39576433-39576455 CCGGCGTCTCCTGGGAAACAGCG No data
Right 1147307926 17:39576449-39576471 AACAGCGAGCTCCCCAGAGAAGG No data
1147307924_1147307928 2 Left 1147307924 17:39576433-39576455 CCGGCGTCTCCTGGGAAACAGCG No data
Right 1147307928 17:39576458-39576480 CTCCCCAGAGAAGGGACATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147307924 Original CRISPR CGCTGTTTCCCAGGAGACGC CGG (reversed) Intergenic
No off target data available for this crispr