ID: 1147310214

View in Genome Browser
Species Human (GRCh38)
Location 17:39591595-39591617
Sequence CCAGGGCCTGCCCTTTGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147310208_1147310214 -8 Left 1147310208 17:39591580-39591602 CCCCTGATGACAACTCCAGGGCC No data
Right 1147310214 17:39591595-39591617 CCAGGGCCTGCCCTTTGCTGGGG No data
1147310201_1147310214 22 Left 1147310201 17:39591550-39591572 CCAGACTTCCTTGGGTGCAGAGG No data
Right 1147310214 17:39591595-39591617 CCAGGGCCTGCCCTTTGCTGGGG No data
1147310205_1147310214 14 Left 1147310205 17:39591558-39591580 CCTTGGGTGCAGAGGGCAGGCAC No data
Right 1147310214 17:39591595-39591617 CCAGGGCCTGCCCTTTGCTGGGG No data
1147310210_1147310214 -10 Left 1147310210 17:39591582-39591604 CCTGATGACAACTCCAGGGCCTG No data
Right 1147310214 17:39591595-39591617 CCAGGGCCTGCCCTTTGCTGGGG No data
1147310209_1147310214 -9 Left 1147310209 17:39591581-39591603 CCCTGATGACAACTCCAGGGCCT No data
Right 1147310214 17:39591595-39591617 CCAGGGCCTGCCCTTTGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147310214 Original CRISPR CCAGGGCCTGCCCTTTGCTG GGG Intergenic
No off target data available for this crispr