ID: 1147310888

View in Genome Browser
Species Human (GRCh38)
Location 17:39595662-39595684
Sequence CAGGGCTGGGCTCACAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147310878_1147310888 7 Left 1147310878 17:39595632-39595654 CCTCTCTCTTCCCAGCAGAAGAG No data
Right 1147310888 17:39595662-39595684 CAGGGCTGGGCTCACAAGCTGGG No data
1147310877_1147310888 16 Left 1147310877 17:39595623-39595645 CCTTTTATGCCTCTCTCTTCCCA No data
Right 1147310888 17:39595662-39595684 CAGGGCTGGGCTCACAAGCTGGG No data
1147310881_1147310888 -4 Left 1147310881 17:39595643-39595665 CCAGCAGAAGAGCAGAGGCCAGG No data
Right 1147310888 17:39595662-39595684 CAGGGCTGGGCTCACAAGCTGGG No data
1147310880_1147310888 -3 Left 1147310880 17:39595642-39595664 CCCAGCAGAAGAGCAGAGGCCAG No data
Right 1147310888 17:39595662-39595684 CAGGGCTGGGCTCACAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147310888 Original CRISPR CAGGGCTGGGCTCACAAGCT GGG Intergenic