ID: 1147311187

View in Genome Browser
Species Human (GRCh38)
Location 17:39596937-39596959
Sequence GGCCCGCGGCGTGGCAGTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147311181_1147311187 -8 Left 1147311181 17:39596922-39596944 CCAGGAGGCCCGGGAGGCCCGCG No data
Right 1147311187 17:39596937-39596959 GGCCCGCGGCGTGGCAGTGGCGG No data
1147311169_1147311187 30 Left 1147311169 17:39596884-39596906 CCGGGTGATGGATCCGGGAGCAC No data
Right 1147311187 17:39596937-39596959 GGCCCGCGGCGTGGCAGTGGCGG No data
1147311173_1147311187 17 Left 1147311173 17:39596897-39596919 CCGGGAGCACGGCTGGAGGCTTG No data
Right 1147311187 17:39596937-39596959 GGCCCGCGGCGTGGCAGTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147311187 Original CRISPR GGCCCGCGGCGTGGCAGTGG CGG Intergenic
No off target data available for this crispr