ID: 1147312463

View in Genome Browser
Species Human (GRCh38)
Location 17:39603647-39603669
Sequence ATGTCCAGGGTCCCTCTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 153}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147312456_1147312463 23 Left 1147312456 17:39603601-39603623 CCAGTGGGTGTATGGGGGGTGGT 0: 1
1: 0
2: 1
3: 29
4: 188
Right 1147312463 17:39603647-39603669 ATGTCCAGGGTCCCTCTGTTTGG 0: 1
1: 0
2: 1
3: 10
4: 153
1147312454_1147312463 24 Left 1147312454 17:39603600-39603622 CCCAGTGGGTGTATGGGGGGTGG 0: 1
1: 0
2: 3
3: 23
4: 222
Right 1147312463 17:39603647-39603669 ATGTCCAGGGTCCCTCTGTTTGG 0: 1
1: 0
2: 1
3: 10
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147312463 Original CRISPR ATGTCCAGGGTCCCTCTGTT TGG Intronic
900339747 1:2182421-2182443 ATGGGCAGGGTGCATCTGTTTGG + Intronic
901862683 1:12084957-12084979 ATGACCAGGGTCACACAGTTGGG + Intronic
903268946 1:22175887-22175909 TTGTCCAGCGTCCCTCAGCTTGG - Intergenic
906019254 1:42613044-42613066 ATTTCCAAGAACCCTCTGTTGGG - Intronic
906459411 1:46025838-46025860 TTGTCCAGGGTCTCCCTCTTGGG + Intronic
908289873 1:62654635-62654657 ATGTACAGGGCCCATGTGTTAGG - Intronic
908320372 1:62972659-62972681 AGGGCCAGGGTCACTCTGTTGGG - Intergenic
908816952 1:68044167-68044189 ATTTCCAGGGACCCTGTGGTAGG + Intergenic
909519884 1:76555509-76555531 ATGACCAGGTTCACTTTGTTTGG - Intronic
915021591 1:152784939-152784961 ATTTCCAAGGACCCTTTGTTGGG - Intronic
916045076 1:160993820-160993842 CTGTCCAGAGTCTGTCTGTTGGG + Intergenic
920382202 1:205541686-205541708 CTGTCCACGTTCCCTCTGTTTGG + Intergenic
922864416 1:228847346-228847368 AGGTCCAGGAACCCTCTCTTAGG - Intergenic
923790373 1:237106349-237106371 ATATCCAGGGTCCTGCTGCTCGG - Intronic
924445670 1:244128097-244128119 ATGTGCAGGGTCCTTTTGTGTGG + Intergenic
924660801 1:246015026-246015048 ATGGCCTGGGACCATCTGTTGGG - Intronic
1062771761 10:106677-106699 AGGTCCAAGGACCCTCTCTTGGG - Intergenic
1062802851 10:392932-392954 GTGTGCAGGGTCCATCTGTCTGG - Intronic
1064321246 10:14306997-14307019 ATGTCCCTGGTTCCTATGTTAGG - Intronic
1064555300 10:16541637-16541659 CTGTTCAGGGTCTCTCTGTAGGG - Intergenic
1065326569 10:24555076-24555098 CTGCCCAGGGTTCCTCTGCTGGG - Intergenic
1071876046 10:89844520-89844542 ATGAACAGGGTACCTCAGTTAGG + Intergenic
1074710757 10:116175628-116175650 ATCGTCAGGGTCCCTTTGTTTGG + Intronic
1074948308 10:118302957-118302979 AACTCCAGGGTCCCTCTCTGGGG - Exonic
1076132054 10:128019950-128019972 ATGCCCAGAGTCCCTCAGGTTGG + Intronic
1076761656 10:132608842-132608864 AGGCCCAGGGGCCCTCTGTGAGG + Intronic
1076816486 10:132917498-132917520 ATGTCCAGGGTCCCTGTGATGGG - Intronic
1076940250 10:133600625-133600647 GAGTCCAGGGTCTCACTGTTGGG - Intergenic
1077022221 11:422465-422487 ATCACAAGGGTCCCTCTGTGGGG + Intronic
1077231457 11:1459758-1459780 ATGTCCCGGGTCCCTGGGATGGG - Intronic
1080658029 11:34273363-34273385 AGGCCCGGGGTCTCTCTGTTGGG + Intronic
1082733486 11:56828385-56828407 AAGTCCAGGGTTTCTTTGTTAGG - Intergenic
1083899426 11:65636530-65636552 AGGTCCGGGGACCCTCTGTGGGG - Exonic
1085015322 11:73170076-73170098 AGGTCCAGGGGCCCACTGCTTGG - Intergenic
1086267198 11:85014785-85014807 CTGTCCAGGGTACCTGTCTTGGG + Intronic
1087531202 11:99384475-99384497 GTGTCCTGAGTCCCTCGGTTGGG - Intronic
1089493275 11:118896559-118896581 ATGGCCAGGGCCTCTGTGTTTGG - Exonic
1090399137 11:126437040-126437062 GTGTCCTGGGCCCCTCTGGTGGG - Intronic
1092174029 12:6390795-6390817 AGGGCCAGGGTCCCCCTCTTCGG - Exonic
1092218470 12:6698012-6698034 GTCTCCAGGCTCCCTCTGCTGGG + Intronic
1094035773 12:26068843-26068865 CTGTCCTTGGTACCTCTGTTGGG - Exonic
1095608014 12:44093458-44093480 GTGTCCAGGATCCCTCTCTGGGG + Intronic
1095702517 12:45204974-45204996 ATCTCCAGAGTCACTCTGTATGG - Intergenic
1097522778 12:60689396-60689418 GGGCCCAGGGTCCCTCTGCTGGG - Intergenic
1101039686 12:100742141-100742163 ATGTCCAGGCTTACTTTGTTAGG - Intronic
1102211041 12:111127444-111127466 TTGTCCAGTGACCCTCTGATAGG + Intronic
1106022433 13:25928190-25928212 ATGGCCAGGGGGCCTGTGTTAGG + Intronic
1117186253 14:53243728-53243750 AGACCCAGGGTCCCTCTGCTGGG + Intergenic
1117292798 14:54349835-54349857 ATTGCCAGAGTCCCACTGTTTGG + Intergenic
1118088830 14:62449609-62449631 AGGTCCAGGAACCCTCTCTTGGG - Intergenic
1118500913 14:66361924-66361946 ATGTCCAGGGACTCTCTGTGAGG - Intergenic
1121956538 14:98218534-98218556 ATGTCCAGGGGTCATCTCTTAGG - Intergenic
1122093520 14:99354883-99354905 ATGTCCAGGGCCCCCTTCTTGGG - Intergenic
1123758662 15:23416321-23416343 AGGTGCAGGGTGCCTGTGTTGGG + Intergenic
1127530337 15:59837517-59837539 AGGTCCTCGGTCCCTCTGCTTGG + Intergenic
1135547426 16:23375497-23375519 CTGGCCTGGGTCCCTCTGTGGGG + Intronic
1136278192 16:29191848-29191870 ATGACCAGGGATCCTGTGTTGGG + Intergenic
1138704745 16:58903656-58903678 ATGCCCAGGGTCCCACAGCTAGG - Intergenic
1141883527 16:86875608-86875630 ATGACCACGATCCCTCTGTTTGG - Intergenic
1141909354 16:87047975-87047997 GTGTGCAGGGCCCCTCTGTTTGG - Intergenic
1142082570 16:88157888-88157910 ATGACCAGGGATCCTGTGTTGGG + Intergenic
1143501898 17:7344002-7344024 ATGTCCAAGGCCCCCCAGTTAGG - Intronic
1145011262 17:19369582-19369604 TTTTACAGGGTCCCTCTGTGTGG + Intronic
1145870679 17:28270782-28270804 CTGACCTGGGTCCCCCTGTTGGG + Intergenic
1146667310 17:34713764-34713786 AGGGACAGGGTCCCTCTGTCTGG - Intergenic
1147057668 17:37846729-37846751 AGGTTGAAGGTCCCTCTGTTGGG + Intergenic
1147312463 17:39603647-39603669 ATGTCCAGGGTCCCTCTGTTTGG + Intronic
1150687351 17:67331495-67331517 AGACCCAGGGTCCCTCTGCTGGG + Intergenic
1151820908 17:76496353-76496375 CTGTCCAAGGTCCCACAGTTAGG + Intronic
1153378290 18:4406560-4406582 ATGTCCAAGGTCACACTGCTAGG + Intronic
1158558272 18:58492865-58492887 ATGTCCTGGCTGGCTCTGTTGGG + Intronic
1160629307 18:80234259-80234281 ATCTCTGGGGTCCCTCTGGTGGG - Intronic
1162022080 19:7872622-7872644 ATTTCCGGGGGCCCTCTGTCGGG + Exonic
1165083250 19:33323628-33323650 ATGTTCAAGGTCCATCTGTGTGG - Intergenic
1166016484 19:39984024-39984046 ATTTGCAGGGTGCCTCTGATTGG - Intergenic
1166120302 19:40682478-40682500 ATGCCCAGGGTCCCTAAGCTGGG + Intronic
1167717628 19:51154163-51154185 GGGTCCAGGGTCCCTCTGGAGGG - Intergenic
929261280 2:39869226-39869248 ATGTGCTGGTTCCCTCTGTCTGG + Intergenic
930001567 2:46865267-46865289 CTGTCCAGGGTCTCACTGCTAGG + Intergenic
930157418 2:48119584-48119606 AGATCCAAGGACCCTCTGTTGGG + Intergenic
934112648 2:88757181-88757203 CTGCCCAGGGCCTCTCTGTTAGG + Intergenic
935596945 2:104886169-104886191 ATGTCCAAGAACCCTCTCTTGGG + Intergenic
936021480 2:108998294-108998316 GTTTCCAGGGTCCCACTGCTAGG + Intergenic
936528694 2:113259884-113259906 AGGTCCAGGGTCTCTGCGTTTGG + Intronic
939694969 2:145312448-145312470 AGGCCCAGGGTCCCTGTGCTAGG - Intergenic
940040926 2:149359825-149359847 AGGTCCAGGAACCCTCTCTTGGG - Intronic
944499405 2:200342695-200342717 ATACCCAGGGTCACCCTGTTTGG + Intronic
948756337 2:240161641-240161663 CTGTCCCGGGTCCCTCTCCTTGG + Intergenic
1168976260 20:1968402-1968424 AGGTCCAGGGTCCCCCTTTAGGG + Intergenic
1170211681 20:13851628-13851650 TTGTCTACGGTCACTCTGTTTGG - Intronic
1171817495 20:29801248-29801270 CAGTCCAGGGTCCCTCTGGCTGG - Intergenic
1173174032 20:40750848-40750870 AAGTCCAGGCTTCCTCTCTTGGG - Intergenic
1174460646 20:50680050-50680072 TTGTCCTGGGTCCCTCTGCCAGG + Intronic
1175255622 20:57645178-57645200 AGCCCCAGGGTCCCTCTGTTGGG + Intergenic
1175281358 20:57806233-57806255 ATATCCAGGGTCCCTTTGCCAGG + Intergenic
1176158904 20:63638593-63638615 GTGCCCAGGGGCCCCCTGTTAGG - Intergenic
1176269855 20:64230664-64230686 ATGTCCAGCCCCCCTCTGATGGG - Intronic
1176416572 21:6478906-6478928 ATGCCCAGGGTCCCTCCCTCTGG + Intergenic
1179692072 21:43087241-43087263 ATGCCCAGGGTCCCTCCCTCTGG + Intergenic
1180320830 22:11319907-11319929 CAGTCCAGGGTCCCTCTGGCTGG - Intergenic
1180334219 22:11560836-11560858 CAGTCCAGGGTCCCTCTGGCTGG + Intergenic
1180948030 22:19707568-19707590 CTGCCCAGGGCCCCTCTGCTGGG + Intergenic
1182806081 22:33071790-33071812 ATGTCCAGGGGCCCACGTTTGGG + Intergenic
1183383388 22:37501675-37501697 TTGCCCAGGGTCCCACAGTTGGG - Intronic
1184108245 22:42381112-42381134 AAGTCCATGGGCCCTCTGCTAGG + Exonic
1184485687 22:44777517-44777539 CTGAGCAGGGTCACTCTGTTGGG + Intronic
1185341108 22:50291544-50291566 ATGTCCTGGGTCCACCTGTGGGG - Intronic
951901036 3:27657752-27657774 ATGACCAGGGTACCTCTTTGCGG + Intergenic
952463176 3:33551336-33551358 ATCTCCTGGATCCATCTGTTTGG + Exonic
956116808 3:65927240-65927262 AGATCCAGGGACCCTCTCTTGGG + Intronic
960496704 3:118383935-118383957 AGGCCCAGGGTCCCTGTGCTGGG + Intergenic
962752062 3:138440795-138440817 ATGCCTAAGATCCCTCTGTTGGG - Intronic
963486568 3:145941374-145941396 ATGATCAGGGTCCTTCTGGTGGG + Intergenic
966106948 3:176347403-176347425 AGGTCCAAGAACCCTCTGTTGGG - Intergenic
969544146 4:7812940-7812962 AGGTCCTGGGACCTTCTGTTTGG - Intronic
971943291 4:33241928-33241950 ATGAACAGGGTACCTCAGTTGGG + Intergenic
972667122 4:41177052-41177074 ATGTCCTGGGTCCTGCTCTTTGG + Intronic
973533114 4:51852823-51852845 ATGTACAGGGTCACTCAGTTGGG + Intronic
973653852 4:53025041-53025063 ATCTCCACGGCCCCTCTGTGTGG + Intronic
980166569 4:129235200-129235222 ATGTCCTGGATGCCTCTGCTGGG + Intergenic
980794518 4:137663458-137663480 CTGCCCAGGGCCCCTCTGCTGGG + Intergenic
983718450 4:170816013-170816035 AGGTACAGGGTCCCCCTGCTGGG + Intergenic
984839486 4:184054801-184054823 ATGTACTTGGTCCCTCTGTGGGG + Intergenic
991634254 5:68687576-68687598 ATATCCAGGGTACCTTTCTTTGG + Intergenic
995031829 5:107490002-107490024 ATCTCCAGGGTCCCTCAGCTGGG + Intronic
998802812 5:145887851-145887873 ATGTCTAGGATCCCTGTGATTGG - Intergenic
1001092591 5:168752265-168752287 ATGTCCAAGGGCCCTGTGGTTGG - Intronic
1002371522 5:178758809-178758831 AGGTCCAAGAACCCTCTGTTGGG - Intergenic
1004083957 6:12425687-12425709 ATGACCAGGGTCTACCTGTTGGG + Intergenic
1004909848 6:20272422-20272444 ATATCCAAGATCCCTCTCTTGGG - Intergenic
1005451050 6:25972742-25972764 TTGTCCATGCTCCCTCTGTAAGG - Intronic
1011152550 6:84290241-84290263 AGGTCCAGGGTCTCTGTGATGGG - Intergenic
1016427317 6:143948438-143948460 ATGTCCTGGGTCCCCCGGATTGG + Exonic
1016808335 6:148235585-148235607 ATGTCCAGGAGCCCTATGGTTGG + Intergenic
1017048619 6:150370134-150370156 ATGTCCAGGTGGCCTCTGTTTGG - Intronic
1018131642 6:160737548-160737570 ATGTCCAGGTTCCCTGGGATTGG - Intronic
1019059898 6:169249357-169249379 ATGTCCCAGGTCACTCTGTCTGG + Intronic
1020802370 7:12747735-12747757 ATATCCAAGGACCCTCTCTTGGG - Intergenic
1024333712 7:48181990-48182012 AACTCCAGGGTCCCTGTGTATGG + Intronic
1034124909 7:148662758-148662780 ATGTCCAAGGGCCCTGTGGTGGG + Intergenic
1034861699 7:154600632-154600654 ATGTCCAGGGTCACTCGGCTGGG + Intronic
1035035312 7:155890795-155890817 ATGGCCAGCGCCCCTCTCTTGGG - Intergenic
1036612194 8:10360028-10360050 ATGTCCAGGGCCTCACTGCTGGG - Intronic
1041691653 8:60693507-60693529 GTGTCCAGGCTCCCTGTCTTGGG + Intronic
1041870653 8:62631031-62631053 ATGGCAAGGGTCCCTTTCTTTGG - Intronic
1041974819 8:63785648-63785670 AGGTACAGAGTCCTTCTGTTGGG - Intergenic
1042309618 8:67367238-67367260 AGATCCAGGAGCCCTCTGTTGGG + Intergenic
1047536226 8:125722356-125722378 TTGTCCAGTGTACCTCTGATGGG + Intergenic
1049770384 8:144377711-144377733 ATGTACAGGGTCCCTGTCTGTGG + Intronic
1052064877 9:24005820-24005842 TTGTCCAGGGTTCATCTGTCAGG + Intergenic
1055562195 9:77532168-77532190 TTGTCCAAGGTCACTCAGTTTGG + Intronic
1055977308 9:81967929-81967951 ATGTCCAGACCCCCTCTGTGAGG + Intergenic
1056013444 9:82356743-82356765 ATGTCCAGAGGCACTCTTTTTGG + Intergenic
1056094072 9:83232999-83233021 ATGTCCATTCTGCCTCTGTTAGG + Intergenic
1057094686 9:92295093-92295115 TTGTCCAGGAGCCCTCTGTCTGG - Intergenic
1057147734 9:92769722-92769744 AAGTCCAGGAACCCTCTTTTGGG + Intergenic
1057197202 9:93121721-93121743 CTGTGCAGGGTCCCTGGGTTAGG + Exonic
1057493087 9:95537877-95537899 ATTCCCAGGGCCCCTCTTTTTGG + Intergenic
1057943161 9:99302484-99302506 TTGTCCAAGAACCCTCTGTTGGG + Intergenic
1060673312 9:125489901-125489923 TTGCCCAGGGTTCCACTGTTAGG + Intronic
1061124021 9:128662336-128662358 ATGTCCAGTATCCATCTGTAGGG - Intergenic
1203369046 Un_KI270442v1:285681-285703 CAGTCCAGGGTCCCTCTGGCTGG - Intergenic
1190886740 X:54536995-54537017 ATGTCCAGGGTATGTCTTTTTGG + Intronic
1195423112 X:104697580-104697602 TTGTCCAGTGTCACTATGTTAGG + Intronic
1196193451 X:112817148-112817170 GTCTCCAGACTCCCTCTGTTGGG - Intronic