ID: 1147312576

View in Genome Browser
Species Human (GRCh38)
Location 17:39604185-39604207
Sequence CACCCCAGGAGGGGACAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 5, 3: 44, 4: 290}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147312565_1147312576 -9 Left 1147312565 17:39604171-39604193 CCATCCCCACCCCTCACCCCAGG 0: 2
1: 4
2: 44
3: 387
4: 2585
Right 1147312576 17:39604185-39604207 CACCCCAGGAGGGGACAGAATGG 0: 1
1: 0
2: 5
3: 44
4: 290
1147312563_1147312576 0 Left 1147312563 17:39604162-39604184 CCCAGGTCTCCATCCCCACCCCT 0: 1
1: 1
2: 8
3: 72
4: 628
Right 1147312576 17:39604185-39604207 CACCCCAGGAGGGGACAGAATGG 0: 1
1: 0
2: 5
3: 44
4: 290
1147312564_1147312576 -1 Left 1147312564 17:39604163-39604185 CCAGGTCTCCATCCCCACCCCTC 0: 1
1: 1
2: 11
3: 121
4: 976
Right 1147312576 17:39604185-39604207 CACCCCAGGAGGGGACAGAATGG 0: 1
1: 0
2: 5
3: 44
4: 290
1147312561_1147312576 2 Left 1147312561 17:39604160-39604182 CCCCCAGGTCTCCATCCCCACCC 0: 1
1: 0
2: 10
3: 94
4: 751
Right 1147312576 17:39604185-39604207 CACCCCAGGAGGGGACAGAATGG 0: 1
1: 0
2: 5
3: 44
4: 290
1147312559_1147312576 21 Left 1147312559 17:39604141-39604163 CCGGGCAGGGGTGGGGCTGCCCC 0: 1
1: 3
2: 8
3: 79
4: 612
Right 1147312576 17:39604185-39604207 CACCCCAGGAGGGGACAGAATGG 0: 1
1: 0
2: 5
3: 44
4: 290
1147312562_1147312576 1 Left 1147312562 17:39604161-39604183 CCCCAGGTCTCCATCCCCACCCC 0: 1
1: 0
2: 7
3: 111
4: 942
Right 1147312576 17:39604185-39604207 CACCCCAGGAGGGGACAGAATGG 0: 1
1: 0
2: 5
3: 44
4: 290

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147312576 Original CRISPR CACCCCAGGAGGGGACAGAA TGG Intronic
900121917 1:1051881-1051903 CACACCAGGAGGGCCCAGGAGGG + Intronic
900808102 1:4781158-4781180 CATCCCAGGAGTGGACAGCGAGG - Intronic
900989725 1:6092783-6092805 ACCCCCAGGAGGGGACAGAGAGG + Intronic
901035326 1:6332923-6332945 GACCCCAGCAGGGGACAAGAAGG + Intronic
901208219 1:7509480-7509502 TAAACCAGGAGGGGAAAGAATGG - Intronic
901514721 1:9737306-9737328 CACTCCAGCTGGGGTCAGAATGG + Intronic
902078002 1:13802858-13802880 CTCCACAGGAGAGGAAAGAAGGG + Intronic
902079770 1:13813024-13813046 CACCCCAGGAGGATGCAGTATGG - Intronic
902836827 1:19052898-19052920 CACCCATGGAGGGGTTAGAAAGG - Intergenic
902880159 1:19366820-19366842 TACCCTAGGAGGGAACAAAAAGG - Intronic
903132509 1:21289432-21289454 CTCCCCAGGAGTGGGCAGATGGG + Intronic
903280083 1:22245341-22245363 CACCCCAGGAGGGGCCCTGAAGG - Intergenic
903300358 1:22374485-22374507 AACCCCAGGAGGGGGCAGGGTGG - Intergenic
904384684 1:30133529-30133551 CACCCCAGGAGCTGACACCATGG + Intergenic
904397340 1:30230707-30230729 TAGACCAGGAGAGGACAGAAAGG + Intergenic
907470148 1:54668566-54668588 CAGCTAAGGAGGGGACAGAAAGG - Intronic
908188018 1:61671164-61671186 CACCCAAGGAAGGGAGAAAATGG + Intergenic
911278593 1:95895249-95895271 GATCCCAGGAAGGCACAGAAAGG + Intergenic
912516156 1:110217757-110217779 CACCCATGGAGGGGAGAGGAGGG + Intronic
913230192 1:116735127-116735149 CTCCCAAGGCGGGGTCAGAAGGG + Intergenic
913430805 1:118788867-118788889 CAAACCAACAGGGGACAGAAGGG + Intergenic
914323205 1:146585043-146585065 CAGCCCAGGGGTGGTCAGAAAGG + Intergenic
915936091 1:160091170-160091192 CACCCCAGGAGGGGACACCTGGG - Intergenic
917155571 1:171994947-171994969 AACCCCTGGAGGGGACAGAATGG - Intronic
917499652 1:175574684-175574706 CACCATAGGAGAGGAAAGAAAGG - Intronic
918266637 1:182848256-182848278 CATCCCTTGAGGGGACAAAATGG - Intronic
919762016 1:201103943-201103965 CAGCCCAGGAGGGGCCAAATGGG + Intronic
920377907 1:205519144-205519166 ACCCCCAAGTGGGGACAGAAGGG - Intronic
921007371 1:211107852-211107874 CATCTCAGGAAGGCACAGAAAGG + Intronic
922894362 1:229088873-229088895 CACCCCAGGTGGGGAACGACAGG + Intergenic
922952826 1:229573536-229573558 CACCCCAGGAGTGGAAACATAGG - Intergenic
1067153981 10:43759542-43759564 CTCCCTAGGAGGGTCCAGAAGGG - Intergenic
1067523624 10:47025899-47025921 ATCCCCAGGAGGGGCCAGAGTGG - Intergenic
1067569288 10:47359919-47359941 CTGCCCTGGAGGGGAAAGAAAGG - Intergenic
1068225083 10:54097846-54097868 CACCTCAGGAGGGGAGGGCATGG + Intronic
1068878303 10:62021634-62021656 CACCCCAGAAAGGGCCAGAATGG - Intronic
1069375666 10:67789913-67789935 CCCCCCAGGAGAAGAGAGAAGGG - Intergenic
1070544716 10:77443138-77443160 CATCCCACGAGGGGCCAGACTGG + Intronic
1071646770 10:87364672-87364694 CACCCCCGGAGGAGGCAGGAGGG - Intronic
1072662001 10:97368993-97369015 CAGCCCAGCAGGGGACCCAAAGG + Intronic
1072743730 10:97925891-97925913 CCACCCAGGAGAGGACAAAAGGG + Intronic
1073327563 10:102651344-102651366 CCCCCCAGGACTGGACAGGAAGG + Intronic
1074814367 10:117133686-117133708 CAGCCCAGGAGGGAAAAGACTGG - Exonic
1076739447 10:132476133-132476155 CACTCCGGGAGGAGACAGACGGG - Intergenic
1077178612 11:1202566-1202588 CATCCCAGGAGTGGGCAGAGGGG + Intergenic
1077217868 11:1402571-1402593 CCCCCCAGGAGGAGTCAGGAGGG - Intronic
1077407500 11:2389169-2389191 AACCCCAGGAGAGGTCTGAAGGG + Intronic
1078606841 11:12784698-12784720 CACCCTAGGGGGCCACAGAAAGG - Intronic
1079083145 11:17427962-17427984 CCGCCCAGGAGAGAACAGAAAGG + Intronic
1080142435 11:28938622-28938644 CACAACTTGAGGGGACAGAAAGG + Intergenic
1080696326 11:34606037-34606059 CAACTCAGGTGGGGACTGAATGG + Intergenic
1081775239 11:45671752-45671774 CATCCCAGGAGGGGAGAGAAGGG + Intergenic
1081931050 11:46871703-46871725 CAGCTCAGGAGGGGACAAACAGG - Intronic
1082769021 11:57191428-57191450 CACCCCAGGAAGAGGCAAAAGGG + Exonic
1082794805 11:57371209-57371231 CACTGTAGGAGAGGACAGAAAGG - Intergenic
1083282901 11:61638433-61638455 GACCCCAGGGGAGGACAGGAGGG + Intergenic
1083796936 11:65022239-65022261 CAATCTAGCAGGGGACAGAAAGG + Intronic
1083945825 11:65922032-65922054 CACCACAGCTGCGGACAGAAGGG + Intergenic
1084672529 11:70615759-70615781 AACCCCAGGATTGGACTGAATGG - Intronic
1084904738 11:72336878-72336900 GACCACAGGTGGGGACAGAGTGG - Intronic
1084968471 11:72756569-72756591 CACCCCTGGAGGGGCGAGGAGGG + Intronic
1085034625 11:73292614-73292636 TACCCCAGCAGGGGAAAGAGGGG - Intronic
1085127077 11:74009026-74009048 CATCCCAGGAGGTGGCAGCAGGG + Exonic
1085764618 11:79271851-79271873 CACTCCAGGAAAGGAGAGAAGGG + Intronic
1088532968 11:110830543-110830565 CACCCCAGGAGGTGACAGCCAGG - Intergenic
1089365657 11:117919481-117919503 CACCCCAGGAGGGAAGGGCAGGG - Intronic
1089613877 11:119684505-119684527 CACCCCAGGAACTGGCAGAAGGG + Intronic
1089640637 11:119845142-119845164 CACAGCAGGAGGGGAGAGAAGGG + Intergenic
1091634881 12:2189445-2189467 CTCCCCAGGACGTGTCAGAAGGG + Intronic
1091650717 12:2307112-2307134 CAACCCAGGAGCTGACAGGAGGG - Intronic
1091993887 12:4977762-4977784 CATCCCAAGAGTGAACAGAAGGG - Intergenic
1092277533 12:7073109-7073131 CAGCCCAGAAGGGGCTAGAAGGG + Intergenic
1093001239 12:13998858-13998880 CACCTCATGAAGGGACAGAGGGG - Intergenic
1093855782 12:24100448-24100470 AAGCCCAGGAGAGGAGAGAATGG - Intergenic
1094800077 12:34022792-34022814 CACCCCAGGAGAGGCCTGAGAGG + Intronic
1095112867 12:38317086-38317108 CACCCCAGGAGAGGCCTGAAAGG + Intronic
1095774440 12:45996681-45996703 CACATCCTGAGGGGACAGAAGGG - Intergenic
1096183278 12:49562974-49562996 CGCCCCAGGAGCTGGCAGAATGG - Intronic
1096257967 12:50074300-50074322 AACCCCAGGAGGTGACAGTCAGG - Intronic
1096540578 12:52304779-52304801 CACCCCGGGAAGGGCCAGAAGGG + Intronic
1096843597 12:54393208-54393230 CCACCCAGGAGGAGAAAGAATGG - Intergenic
1100256257 12:92886441-92886463 AACGCCAGGAGGGGACTGGAGGG + Intronic
1100663100 12:96722047-96722069 CACCAAAGGAGGGAACAGATGGG - Intronic
1101039362 12:100738197-100738219 CTCCCCAAGAGGGGACATGATGG + Intronic
1101241372 12:102842945-102842967 CACCCAAGCAGGAGACAGACTGG - Intronic
1101269696 12:103130606-103130628 CACCCATGGAGGGGAGAGGAAGG + Intergenic
1104807535 12:131599062-131599084 CATCCCAGGAGGGGAGTGGAGGG - Intergenic
1104919629 12:132283753-132283775 CCCCCCAGGAGGGGACACCTGGG + Intronic
1104935024 12:132359899-132359921 CACCCCAGGATGGGTCAGGATGG + Intergenic
1105337373 13:19486583-19486605 CACTCCAGGAGTGGCCTGAAGGG + Intronic
1106668953 13:31884489-31884511 GACTGCAGGAGGGGAAAGAAAGG - Intergenic
1107014115 13:35695249-35695271 CAGCCCGGGAGGGGCCAGAGAGG - Intergenic
1107731688 13:43355595-43355617 CACTGAATGAGGGGACAGAAAGG - Intronic
1108632645 13:52301986-52302008 CACTCCAGGAGTGGCCTGAAGGG + Intergenic
1108654054 13:52510607-52510629 CACTCCAGGAGTGGCCTGAAGGG - Intergenic
1111739799 13:92189391-92189413 CAACTAAGGTGGGGACAGAACGG - Intronic
1112225038 13:97531531-97531553 CAGACCTGGAGAGGACAGAAGGG - Intergenic
1112243151 13:97702095-97702117 TAACCCTGGAGGGGCCAGAAAGG + Intergenic
1112577980 13:100653822-100653844 GACACCATGAGGGGACAGGAAGG + Intronic
1112678666 13:101735704-101735726 CTCCCCAGGAAGGGGTAGAATGG + Intronic
1113130436 13:107030778-107030800 AACCCAAGGAAGGGACAGTAAGG - Intergenic
1115395911 14:32908119-32908141 TCCTCCAGGAGGGCACAGAAGGG - Intergenic
1115814700 14:37151232-37151254 CAACCCAAGAGTGGACAGGAGGG - Intronic
1115914716 14:38299171-38299193 CCCTCCAGGAGAGGACAGATAGG + Intergenic
1117342758 14:54805934-54805956 CAGCCCAGGAGGTTCCAGAAGGG + Intergenic
1118824090 14:69364781-69364803 CACCCCAGGAGTGGGCAGGAGGG + Intergenic
1119951644 14:78751693-78751715 CTGCCCTGGAGGGGACGGAAGGG + Intronic
1121274055 14:92656052-92656074 CAGACCAGGAGGACACAGAAGGG + Intronic
1121615542 14:95311351-95311373 CCCCCCAGGAGAGGAAAGCAGGG + Intronic
1121640261 14:95480560-95480582 CTCCCCAGGAATGGACAGTAAGG + Intergenic
1121940472 14:98065573-98065595 CACCCCAGGAGGGTACAAGATGG - Intergenic
1122211763 14:100178282-100178304 CCTCCCAGGTGGGGACAGATGGG - Intergenic
1122409761 14:101519853-101519875 CACCCCGGTAGTGGACAGAGGGG - Intergenic
1123122148 14:105921677-105921699 CACCTCAGGTGGGATCAGAAGGG + Intronic
1123404813 15:20013242-20013264 CACCTCAGGTGGGATCAGAAGGG + Intergenic
1124833437 15:33172517-33172539 CACCAAGGGATGGGACAGAAAGG + Intronic
1125612237 15:40979401-40979423 CAGCCAAGCAGGGGACTGAAGGG + Exonic
1127277433 15:57459671-57459693 TACCCAGGGAGGTGACAGAAAGG + Intronic
1128349315 15:66878327-66878349 CACCCAAGCAGAGGACAGCAGGG + Intergenic
1128717669 15:69920475-69920497 CACCCCAGGAGGCCTTAGAAGGG - Intergenic
1129208295 15:74050420-74050442 CAACTCAGGAGAGCACAGAAAGG - Intergenic
1130014199 15:80174726-80174748 AGCCACAGGAGGGGAGAGAAAGG - Intronic
1131037071 15:89229837-89229859 GAGCCCAGGAGGTCACAGAAGGG + Intergenic
1131067495 15:89443509-89443531 CACCCCAGGAGGTGGCAATAGGG + Intergenic
1131328879 15:91477493-91477515 CACACCAAGTGTGGACAGAAAGG - Intergenic
1131338784 15:91576244-91576266 CTCCGAAGGAGGGGGCAGAAGGG - Intergenic
1131369108 15:91865029-91865051 CAACCACGGAGGGGGCAGAAAGG - Intronic
1131987845 15:98063221-98063243 GACCCCTGGAGGGGAGAAAAAGG + Intergenic
1132508412 16:324312-324334 CCTCCCAGGAGGGCTCAGAAAGG - Intronic
1132578819 16:675975-675997 GACCCCAGGAGAGGACTGACTGG + Intronic
1132587078 16:710250-710272 CACCCAGGGAGGGGGCAGCAGGG + Intronic
1132715193 16:1286567-1286589 CCCCCTAGGAGGGGAGAGACAGG + Intergenic
1132974578 16:2705004-2705026 CACGCCACGAGGGGACACACAGG - Intronic
1133033581 16:3022871-3022893 AACCCCAGCTGGGGACATAATGG - Exonic
1133168349 16:3964721-3964743 CACCCCAAGAGGGGTCTGAGTGG - Exonic
1135170456 16:20179044-20179066 GACCCCAGGAAGGGATGGAAAGG - Intergenic
1135712144 16:24726963-24726985 CAGCCCAGGAGGGCTCAGATGGG + Intergenic
1135781035 16:25300808-25300830 CAGCCCACGATGGGAAAGAAGGG + Intergenic
1138576846 16:57913090-57913112 GCCCCCAGGAGGGAACAGGACGG + Intronic
1138604555 16:58080259-58080281 CAGGACAGGAGGGGACAGGAAGG - Intergenic
1140010356 16:71125807-71125829 CAGCCCAGGGGTGGTCAGAAAGG - Intronic
1140243877 16:73230978-73231000 CAGGCCAGGAGGAGACAGATAGG + Intergenic
1141503849 16:84462206-84462228 CAGCCCAGGAGGGGTCAGTGCGG + Intronic
1141551683 16:84810576-84810598 CACACCAGGCCGGAACAGAATGG - Intergenic
1141687324 16:85577780-85577802 CACCCCAGCAGGGCAGATAAAGG + Intergenic
1141807417 16:86351204-86351226 CACCCCAGGAGTTGGCAGATTGG - Intergenic
1142596629 17:1032857-1032879 GACCCCAGCACGGCACAGAAAGG + Intronic
1144600167 17:16606052-16606074 CACCCCAGGAAGGGATAGACTGG + Intergenic
1144633869 17:16891362-16891384 CACCCAAGGAAGGCACAGAGGGG - Intergenic
1145200677 17:20942000-20942022 CACCCCAGGAGAGTAGAGATGGG - Intergenic
1146124405 17:30220500-30220522 CATCCCAGGAGGAGATAGGAGGG + Intronic
1147312576 17:39604185-39604207 CACCCCAGGAGGGGACAGAATGG + Intronic
1148203977 17:45768134-45768156 CTGCCCAGGAGGGGGCAGAGAGG - Intergenic
1149664487 17:58356330-58356352 CAACCCAGGAGGTGACACAAAGG - Intronic
1150606515 17:66696032-66696054 CTCCCCAGGAAGGGACAGGATGG - Intronic
1150712567 17:67544385-67544407 AAGCCCAGGAGGGGAGGGAATGG + Intronic
1151431483 17:74066467-74066489 AGCCCCAGGTGGGGACAGAGGGG - Intergenic
1152287567 17:79421747-79421769 CACCACAGGAGGAGAGAGCATGG - Intronic
1152506842 17:80755058-80755080 CACCCTGGGAGGGGCCAGAGGGG + Intronic
1156097355 18:33551538-33551560 CACACCAGTAGGGAAAAGAAAGG + Intergenic
1160582843 18:79897172-79897194 TACCCAAGGAGAGGAGAGAAGGG - Intronic
1161343025 19:3753074-3753096 CACCCCAGGTGGGGACAGGAGGG - Intronic
1161375293 19:3936784-3936806 GACCCCAGGAGGGGTCAGGCAGG - Intronic
1161713242 19:5861783-5861805 CAGCCCAGCAGGGGAAAGAAGGG - Intergenic
1162014910 19:7840153-7840175 CTCCGCATGAGGGGCCAGAAGGG + Intronic
1162461166 19:10815245-10815267 CAGCCCAAGAAGGGAAAGAAGGG + Intronic
1162647080 19:12057640-12057662 CAGCCCAGGAGGAGAAGGAAGGG + Intergenic
1162659576 19:12158402-12158424 AAACTGAGGAGGGGACAGAAGGG + Intergenic
1163154791 19:15433770-15433792 CACCTCAGGAAGGGGCAGAGTGG - Intronic
1163689493 19:18730831-18730853 CACACCAGGAGGAGACAGCCAGG - Intronic
1164424608 19:28130141-28130163 CACCTCAAGAGGGGTCATAAAGG + Intergenic
1164775562 19:30850877-30850899 AACCCCAGGAGCAGACAGAGGGG + Intergenic
1165764688 19:38343386-38343408 CAGCCTAGGAGGGGGCAGAGGGG - Intronic
1166327439 19:42059760-42059782 CACCCAATGAGGGGTCAGGAAGG - Intronic
1166377378 19:42335177-42335199 CAGCCCTGGTGGGGACAGGAAGG - Exonic
1166830753 19:45638447-45638469 CCCCCCAGGAGGAAATAGAAAGG - Intronic
1168490411 19:56804105-56804127 CACCCCACGTGGGGATAGCAGGG + Intronic
1168690361 19:58373071-58373093 CAGGCCTGGAGGGGACAGGAGGG - Intronic
925024088 2:594434-594456 CGCCCCAGGAGAAGATAGAATGG + Intergenic
925404833 2:3599324-3599346 CACCACAGGACGGCACTGAATGG + Intronic
926117779 2:10224281-10224303 CCCACCAGGAGGGGAGAGAACGG + Intergenic
926702934 2:15816077-15816099 GTCCCCAGCAGGGGACAGAATGG - Intergenic
928858163 2:35825051-35825073 CACCTCAGGAGGAGATGGAAGGG + Intergenic
929116231 2:38446647-38446669 TACCCCAGGAGGCCACAGAGAGG - Intergenic
932195223 2:69777303-69777325 CACCTCAGGGGAGGAGAGAAGGG - Intronic
932786027 2:74604588-74604610 CACAGCAGGAGGGGAGGGAAGGG - Intronic
932884907 2:75540896-75540918 CAACCAAGGTAGGGACAGAAGGG + Intronic
934474995 2:94587817-94587839 CCCCTCAGGAGGGGACTGCATGG - Intergenic
935342262 2:102068711-102068733 CACCCCAGCAAGCTACAGAAGGG - Intronic
935761638 2:106325901-106325923 TACCCCAGGATTGGATAGAAGGG - Intergenic
936318231 2:111443914-111443936 CTCCCAAGGAGGGGAGAGCAGGG + Intergenic
938208626 2:129445088-129445110 GACTCCAGCAGGGGAAAGAATGG - Intergenic
938384505 2:130854672-130854694 CACACCAGGAGGGGCGAGACAGG + Intronic
939432566 2:142130391-142130413 CACTCCCGGAGGGGACAAAATGG + Intronic
940088850 2:149894155-149894177 CAACACAGGAGGGGACAACAGGG - Intergenic
947530631 2:230906802-230906824 CACCACAGGAGGTCAGAGAAGGG + Intergenic
948337121 2:237218210-237218232 CACTCCAGCAGGGGAGGGAATGG - Intergenic
948454081 2:238096730-238096752 GACCCCGGGAAGGGACAGAAGGG + Intronic
948601583 2:239110805-239110827 CACCCCTGCAGGGGAGAGGAGGG - Intronic
948655374 2:239473607-239473629 CACCCCGGGGAGGGGCAGAAGGG + Intergenic
948721905 2:239905865-239905887 CAGCCTGGGAGGGGACAGGAGGG + Intronic
1168865141 20:1079947-1079969 CATCCCAAGAGGTGACAGGATGG + Intergenic
1170960304 20:21019866-21019888 CTCCCCAGGAGGGCAGAGAAAGG - Intergenic
1171193840 20:23181191-23181213 CTGGCAAGGAGGGGACAGAAGGG - Intergenic
1171958687 20:31477966-31477988 GTCCCCAGGAGGGGACAGGAAGG - Intronic
1172604650 20:36206519-36206541 CACCCCTGGAGGAGAGAAAAGGG + Intronic
1173253004 20:41374538-41374560 AGCCCCAGGAGGGGCCAGAAAGG + Intergenic
1173557674 20:43978196-43978218 GAACCCAGGAGAGGATAGAAGGG + Intronic
1173809207 20:45946142-45946164 CTCCCCAGGAGGGAACAGGGAGG + Intronic
1173827198 20:46055602-46055624 TACCCCAGCTGGGGACAGAAGGG + Intronic
1174283178 20:49454011-49454033 CTCCCCAGGGGAAGACAGAATGG + Intronic
1174379861 20:50149535-50149557 CAGCCCAGAACAGGACAGAACGG + Intronic
1174453334 20:50632921-50632943 CAGCACAGGAGGGGACTGTAGGG - Intronic
1175063918 20:56269272-56269294 GACCCCAGCAGGAAACAGAAGGG + Intergenic
1175864687 20:62168991-62169013 CAAGCCAGGAGGGGACAGCGGGG + Intronic
1176515328 21:7779545-7779567 CACCCCAGCAGGGGACAGCCTGG + Intergenic
1176736195 21:10548792-10548814 CACTCCAGGAGTGGCCTGAAGGG - Intronic
1177628408 21:23695825-23695847 CACACCAGAATGGGAAAGAATGG - Intergenic
1178649356 21:34409557-34409579 CACCCCAGCAGGGGACAGCCTGG + Intergenic
1178828302 21:36033813-36033835 CACCCTAGATGGGGACAGATGGG + Intergenic
1178840284 21:36133034-36133056 CAGCCCAGGAGGGGACAAGCAGG - Intergenic
1179784112 21:43719933-43719955 CACGCCAGGAGGTGGCCGAAGGG + Intronic
1180186930 21:46144759-46144781 CAGCCCAGGAGAGGACAGGAGGG - Intronic
1180902862 22:19387117-19387139 CACCCCAGCAGAGCACAGAGGGG + Intronic
1181004754 22:20007721-20007743 TCCCCCAGGAGGTGGCAGAAGGG - Intronic
1181404280 22:22671313-22671335 CACCCAAGGAGGGAACCGAAAGG + Intergenic
1182255975 22:29038764-29038786 CACACCAGGACTGGACAGGAGGG - Intronic
1182527032 22:30926936-30926958 CATCCCAGGAGCTGAGAGAAGGG - Intronic
1183243491 22:36675624-36675646 CACCCCACCAGGGGACGGCATGG + Intronic
1183315771 22:37136139-37136161 CACCCCAGGCAGGGAGAGAATGG + Intronic
1183520179 22:38292400-38292422 CTCACCAGGAGGGCAGAGAAGGG - Intronic
1183520684 22:38294595-38294617 CAGCCCTGCAGGGCACAGAAGGG + Intronic
1183532950 22:38374062-38374084 CACTCCAGGAGTGGCCTGAAGGG + Intronic
1183579624 22:38716170-38716192 CGCCTCAGGAGGGGAAAGGATGG - Intronic
1184506901 22:44909326-44909348 AACCCCAAGAGAGGACAGAAGGG + Intronic
1185039498 22:48497176-48497198 CACCGCAGGCGGGGGCGGAACGG - Intronic
949954171 3:9253828-9253850 AACCCTGGGAGGGGACGGAATGG + Intronic
953048212 3:39314874-39314896 CAGCCCAGGAGGGTAGAGAAAGG + Intergenic
953663657 3:44909607-44909629 CACCTCTGGAGGGGACAGAATGG - Intronic
955327390 3:58019890-58019912 CACCGCAGGTGTGGACAGTAGGG + Intronic
955919408 3:63939803-63939825 AGCCACTGGAGGGGACAGAATGG + Intronic
956286872 3:67619906-67619928 CTCTCCAGGAGGGAACAGACAGG - Intronic
958925764 3:100155582-100155604 CAGCCCAGGAGGGTGCTGAAGGG - Intronic
959628920 3:108485731-108485753 CACCCCAGGAGGGAAAAAATTGG + Intronic
960967305 3:123114286-123114308 CTCCCCAGGAGGGAAAATAAGGG - Intronic
961375437 3:126462401-126462423 CACCCCAGGAAGGGACAGGAAGG + Intronic
961459543 3:127041586-127041608 CACCCCAGGCAGGGCCAGGACGG + Intergenic
961466891 3:127087615-127087637 CACACCAAGAGGGGAGAGATGGG - Intergenic
963850477 3:150206091-150206113 CACCCCAGGAGCTGACAAGAAGG + Intergenic
967857216 3:194127353-194127375 CATCCCAGGAAGGGAGAGATTGG - Intergenic
967892573 3:194373311-194373333 CGCTCCAGCAGGGGACACAATGG - Intergenic
967915366 3:194574399-194574421 CACTCCCAGAGGGGAGAGAATGG - Intergenic
968316263 3:197728281-197728303 GAACCCAGGAGGGGACTGCAAGG - Intronic
968466111 4:752198-752220 GACCTCAGGAGGGAACAGCAAGG - Intronic
968915936 4:3497107-3497129 CAGCCCAGGTGTGGACAGCAGGG + Intronic
976610049 4:87021093-87021115 CACCTCAGAAGGGTAAAGAAGGG - Intronic
979907763 4:126317776-126317798 TGCCCCAGGAGGAGACAGTAGGG - Intergenic
981042334 4:140234580-140234602 CTCCCCAGCAGGGGTCAGAAAGG + Intergenic
985625569 5:983430-983452 CAGCCCAAGTGGGGACAGAGGGG + Intergenic
986896485 5:12376823-12376845 CACACAAGGAGGGGGCAGAAGGG + Intergenic
987024752 5:13914330-13914352 CTCCCAAGGAGGGTACAAAAAGG + Intronic
987137975 5:14917552-14917574 CACCCCAGGAGTGGAGAAGAAGG - Intergenic
987235737 5:15939535-15939557 CACCCCAAGGGAGAACAGAATGG - Exonic
990172641 5:53071274-53071296 CAGCACAGGATGGGAGAGAAGGG - Intronic
996790708 5:127290505-127290527 CACCGCAGGGGGTGACCGAAGGG - Intergenic
998093538 5:139384304-139384326 CAGCCCAGAGGGGAACAGAATGG - Intronic
998881789 5:146652591-146652613 CAGGCCAGGAGGGGAGTGAAAGG + Intronic
1000509378 5:162163519-162163541 CACTCATGGAGGGGAAAGAAAGG + Intergenic
1001254397 5:170172249-170172271 CAGTCCAGGTGGGGAAAGAAGGG + Intergenic
1002086749 5:176780638-176780660 CAACCCAGGTGGGGACAGAGTGG - Intergenic
1002655076 5:180739608-180739630 CACCCCAGGAGGCGATAGCCAGG + Exonic
1002706552 5:181164525-181164547 CAACCCATGGGGGGACAAAATGG + Intergenic
1003637623 6:7847462-7847484 CACCCCAAGATGGTACAGATGGG - Intronic
1003667901 6:8128653-8128675 CACCCCATGGAGGGACAGAGTGG - Intergenic
1003904609 6:10687851-10687873 AACCCCAGGGAGGGACAGAAGGG + Intronic
1005882766 6:30073541-30073563 CACCTGAGGAGGGGAGAGATAGG - Intronic
1006945951 6:37784622-37784644 CATCCCAGGAGGAGAGGGAAAGG + Intergenic
1007226006 6:40315159-40315181 CACCCCACCAGGTGACATAATGG + Intergenic
1007350675 6:41271456-41271478 CACTCTAGCAGGGCACAGAAGGG - Intronic
1009854741 6:69247417-69247439 GTCCCTAGGAGGGAACAGAAAGG - Intronic
1013405612 6:109840071-109840093 CACCCCAGCAGTGGACAAAAGGG - Intergenic
1013420133 6:109959937-109959959 CACCCCAGCAGTGGACAAAAGGG + Intergenic
1016889038 6:148987361-148987383 CAACCCAGGAAGGGTCAGGATGG + Intronic
1017225223 6:152013697-152013719 CACCACTGGAGTGTACAGAAAGG - Intronic
1017603419 6:156107802-156107824 CGATTCAGGAGGGGACAGAAGGG + Intergenic
1019137062 6:169916107-169916129 CACAGCAGGAGGGGCCAGGAAGG - Intergenic
1019393759 7:805373-805395 AACCCCAGGCGGGGGCAGAGCGG - Intergenic
1019441105 7:1047436-1047458 CAGCCCAGGAAGGCACAGATAGG + Intronic
1020683019 7:11259923-11259945 CAGCCAAGGAGGGGCCAGACTGG - Intergenic
1022045270 7:26617735-26617757 CACCCTAGCAGGGGACAGTAGGG - Intergenic
1022960784 7:35424336-35424358 CACCCAAGGATGAGACAGAAAGG - Intergenic
1023739051 7:43261638-43261660 CACACCAGCAGGGGACAAACTGG + Intronic
1023892571 7:44403802-44403824 CACCCCAGTAGGAGAAAAAAAGG + Intronic
1024473862 7:49790638-49790660 CAATCCAGGAAGGCACAGAAAGG - Intronic
1025020077 7:55473625-55473647 CACCACAGAAGGTGACAGGAGGG + Intronic
1025172714 7:56775100-56775122 CAACCCAGAAGGGGAAAAAATGG + Intergenic
1025608298 7:63054938-63054960 GACTCCAGGAGGGGGCAGAATGG + Intergenic
1025699403 7:63803068-63803090 CAACCCAGAAGGGGAAAAAATGG - Intergenic
1026529770 7:71186636-71186658 CAACTCTGGAGGTGACAGAAAGG + Intronic
1026907064 7:74068803-74068825 CACCCCAGGAGGGAACGGGCAGG + Intronic
1027615437 7:80417543-80417565 GACATCAGGAGGGGACAGACTGG + Intronic
1029112755 7:98222181-98222203 CACCCCAGGAAGGGCCAGGCAGG + Intronic
1029538878 7:101171677-101171699 CCACCCACGAGGGGGCAGAAGGG + Exonic
1029563927 7:101322254-101322276 GACTCCAGGAGGGGGCGGAATGG + Intergenic
1032709822 7:134451739-134451761 CTGCCCTGGAGGGGACTGAAAGG + Exonic
1035172678 7:157027616-157027638 GATCCCAGGAAGGGACAGAGGGG + Intergenic
1035683195 8:1503855-1503877 CACCCCAAGAGGGGAAAGCCAGG - Intronic
1036929654 8:12942710-12942732 CAGCCCAGGAGGGGACATTGAGG + Intergenic
1037317569 8:17613396-17613418 GACCCCAGCAGGTGACAGAGGGG + Intronic
1037487901 8:19365789-19365811 CACCCCAGGAAAAGACAGACCGG + Intronic
1037817570 8:22120172-22120194 AACTACAGGAGGAGACAGAACGG + Exonic
1038304069 8:26383412-26383434 GACCCCAGGAGGCAACAGAGAGG - Intronic
1038828608 8:31033323-31033345 CCCGCCAGGAGGGGAGGGAAGGG + Exonic
1043739489 8:83792426-83792448 AGCCCCTGGAGGGAACAGAATGG - Intergenic
1044494398 8:92859667-92859689 CTCTCCAGGAAGGGACAAAATGG - Intergenic
1046513749 8:115232172-115232194 CACCAAAGGAGGGAACAGAATGG + Intergenic
1047927146 8:129693092-129693114 CACCCCAGGAATGGCTAGAAAGG + Intergenic
1049282243 8:141755629-141755651 CACACCAGGAGGAGTCAGCATGG - Intergenic
1049437883 8:142596024-142596046 TTCCCCAGGAGGGGTCAGGAGGG - Intergenic
1049471410 8:142776572-142776594 CACCCCAGGAGCAGAGAGGAGGG - Intronic
1049610377 8:143552485-143552507 GACCCCAGAAGGGGACAGGATGG + Intergenic
1053437332 9:38084791-38084813 CACCCCTGCAAGGGAGAGAAAGG - Intergenic
1057457354 9:95226748-95226770 CTCCCCAGGAGGGCAAAGCAGGG + Intronic
1058161815 9:101578492-101578514 CACCACAGGAGAGGCCAGGATGG + Intronic
1061300820 9:129703974-129703996 GACCCCAAGAGGGGGCAGAGGGG + Intronic
1061433182 9:130544158-130544180 CACCCAAGGAAGGGGGAGAATGG - Intergenic
1061877315 9:133550851-133550873 CACCCCAGTAGAAGACAGAATGG - Intronic
1062627033 9:137448045-137448067 CAGCACAGGAGGGGACGGAGAGG - Exonic
1062673272 9:137724064-137724086 CACTCCAGGAGGCGTCAGCATGG + Intronic
1188101581 X:26094602-26094624 AACCCAAGGATGGGACAGAAAGG - Intergenic
1189326917 X:40118187-40118209 CACCTGAGGGGAGGACAGAAAGG - Intronic
1193699225 X:84742462-84742484 AATCTCAGGAGGGAACAGAAAGG + Intergenic
1195354520 X:104026323-104026345 CATCCCAGGAGGAGAAAGGAGGG + Intergenic
1196393392 X:115233681-115233703 CACCCAAGCAGGTGACAGGACGG - Exonic
1198522098 X:137463378-137463400 CACAGCAGGAAGGGTCAGAATGG - Intergenic
1198627344 X:138591805-138591827 AGCCACTGGAGGGGACAGAATGG - Intergenic
1199233495 X:145466363-145466385 TACCCCAAGAGGGAACACAACGG + Intergenic
1200039253 X:153353904-153353926 CAAGGCAGGAGGGGACAGCATGG + Intronic
1200052480 X:153442342-153442364 AACCCCAGGATGGGACAGACAGG - Intergenic
1202594490 Y:26521956-26521978 CACTCCAGGAGTGGCCTGAAGGG - Intergenic