ID: 1147312592

View in Genome Browser
Species Human (GRCh38)
Location 17:39604244-39604266
Sequence TGCCCCCCGGACGCCGGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147312586_1147312592 13 Left 1147312586 17:39604208-39604230 CCGCGGGGAGGAGGAGCCGGCGA 0: 1
1: 1
2: 2
3: 29
4: 200
Right 1147312592 17:39604244-39604266 TGCCCCCCGGACGCCGGCGCCGG 0: 1
1: 0
2: 1
3: 9
4: 127
1147312587_1147312592 -3 Left 1147312587 17:39604224-39604246 CCGGCGAGCTCACCTCCTTCTGC 0: 1
1: 1
2: 0
3: 18
4: 208
Right 1147312592 17:39604244-39604266 TGCCCCCCGGACGCCGGCGCCGG 0: 1
1: 0
2: 1
3: 9
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147312592 Original CRISPR TGCCCCCCGGACGCCGGCGC CGG Intronic
900269170 1:1778413-1778435 GGCCGCCCGGACCCCGGCGCCGG + Intronic
900297315 1:1958308-1958330 TGCCCCGCTGACGCAGGCTCAGG + Intronic
901007651 1:6179691-6179713 GGCCCCCCGGGCGGCGACGCGGG - Intronic
901272223 1:7961486-7961508 AGCCCCGCGGGCGCCGGGGCAGG + Intronic
902323632 1:15684476-15684498 CGGCCCCCGGCCCCCGGCGCGGG + Exonic
902823256 1:18956265-18956287 TGCCCGCCGGGCGGCGGCGGCGG - Exonic
902916858 1:19644615-19644637 GCGCCTCCGGACGCCGGCGCTGG + Intronic
903785632 1:25859375-25859397 AGCCGGCAGGACGCCGGCGCAGG + Exonic
904619069 1:31764509-31764531 TGGGCCCCAGGCGCCGGCGCGGG + Intronic
907767380 1:57424199-57424221 AGCTCCCCGGCCGCCGCCGCCGG + Intronic
912879137 1:113390982-113391004 GGCGCCCCGGCCGCCCGCGCGGG + Exonic
915213300 1:154325495-154325517 CGCCCCCCGGCCCCCGCCGCCGG + Intergenic
1066094020 10:32055985-32056007 TGGCTCCCGGCCGCCGGCCCCGG - Exonic
1067091256 10:43266765-43266787 TGCCCTCCGGTCGCCGGCGCGGG - Intronic
1067369878 10:45673002-45673024 TGCCCTCCAGACGCCCGCGTGGG - Intergenic
1069899320 10:71697878-71697900 TGCCCACCTGACGCCAGCGGTGG - Intronic
1069925928 10:71850961-71850983 TGCCCCCGGGAGGACGGCCCAGG - Intronic
1069984325 10:72273439-72273461 TGCCCGTGGGACGGCGGCGCAGG - Intergenic
1070280376 10:75044004-75044026 TGCGCCCAGGGCGACGGCGCTGG - Exonic
1075031946 10:119029757-119029779 CGCCTCCCCGCCGCCGGCGCGGG - Exonic
1075401379 10:122163727-122163749 CGCCCCCCGGCCCCCGGCTCGGG + Intronic
1076724012 10:132405056-132405078 AGCCCCCCGGAGGCCAGCCCCGG + Exonic
1076817066 10:132920259-132920281 GGCCACCCCGGCGCCGGCGCAGG - Intronic
1077372598 11:2190387-2190409 TGCCCCTCGGAAGCCGGCCTGGG - Intergenic
1081831507 11:46119970-46119992 CGCCCCGCGGCCGCCGGCGGCGG + Intronic
1092270435 12:7018897-7018919 TTACTCCCGGTCGCCGGCGCTGG + Intronic
1096116811 12:49059961-49059983 AGCGCCCCGGCCGCCCGCGCCGG + Intergenic
1102254060 12:111406028-111406050 CGCCCCCGGGCCGCCGCCGCCGG - Exonic
1103321555 12:120095469-120095491 TGCCCCCCGCCCACCGGCACAGG + Exonic
1103649528 12:122422319-122422341 GGACCCCCGGCCTCCGGCGCCGG + Intronic
1104030863 12:125065258-125065280 CGCCCCCCGGCCGCGGGCGCTGG + Intergenic
1104448886 12:128853679-128853701 CGCCCCCCGGCCCCCGGCCCAGG - Intronic
1105378423 13:19864448-19864470 TGCCCCGCGGACGCAGACGCCGG - Intergenic
1108618524 13:52159237-52159259 TGCCCCGCGGGCGCCGGCCCCGG - Intronic
1110925763 13:81149537-81149559 TGCCCCCCAGACCCCAGCGCAGG - Intergenic
1112041444 13:95552497-95552519 TTCCTCCCGCACGCGGGCGCGGG + Intronic
1112216320 13:97434316-97434338 GGCCCCCTGGGCGCCGGCGGCGG - Exonic
1112508931 13:99991523-99991545 TGCTCCGCGGAGGCCGGCGGAGG + Intergenic
1114736559 14:25049324-25049346 TGCCCCCAGGGCGCTGGCCCTGG - Intronic
1119046346 14:71321192-71321214 TCCCCCCAGGACCCGGGCGCGGG - Intronic
1119290512 14:73491507-73491529 TGCGGCCCCGACGCCGTCGCAGG - Exonic
1122969901 14:105148271-105148293 TGCCCCCAGGACCCTGGCCCTGG - Intronic
1123739777 15:23225789-23225811 AGCCCCCAGGAGGCCGGTGCGGG + Intergenic
1124291003 15:28454762-28454784 AGCCCCCGGGAGGCCGGTGCGGG + Intergenic
1127588407 15:60398571-60398593 TGGCCCTCGGAGGCCGGGGCGGG - Intronic
1132163622 15:99565293-99565315 TGCCGCCCGGAGTCCGGGGCCGG - Intergenic
1132659544 16:1055269-1055291 TGCCCCCCAGTGGCCAGCGCCGG + Intergenic
1132954873 16:2586342-2586364 TGCCCCCCGGAGGTGGGGGCTGG - Intronic
1136385976 16:29926198-29926220 CACCACCCGGAAGCCGGCGCCGG + Exonic
1136778786 16:32884968-32884990 TGCCCCCCAGACTCCTGGGCTGG - Intergenic
1136891832 16:33976550-33976572 TGCCCCCCAGACTCCTGGGCTGG + Intergenic
1137251269 16:46742734-46742756 TGCCTCCCCCACGCCGGTGCTGG - Intronic
1138492123 16:57382846-57382868 TGCCACCCGGAGGCAGGCGGTGG + Exonic
1140478568 16:75250920-75250942 TTCACTCCGGCCGCCGGCGCGGG - Intronic
1142221603 16:88857520-88857542 TTCCCCGCGGACGGCGGCCCCGG + Intronic
1203081201 16_KI270728v1_random:1147057-1147079 TGCCCCCCAGACTCCTGGGCTGG - Intergenic
1142598308 17:1040189-1040211 GGCCCCCAGGACGCACGCGCAGG + Intronic
1145935198 17:28711185-28711207 GCCCACCCGGACGCCGGGGCGGG - Intronic
1146058604 17:29593234-29593256 GGCCCCGGGGACGCCGCCGCAGG - Intronic
1147044500 17:37743179-37743201 TGGCCCCCGGTGGCCGGCGGTGG + Intronic
1147312592 17:39604244-39604266 TGCCCCCCGGACGCCGGCGCCGG + Intronic
1147970982 17:44219091-44219113 GGCTCCCCGGAGGCCGGGGCGGG - Intronic
1148581550 17:48747438-48747460 TTCCCGCTGGACGGCGGCGCGGG - Intergenic
1150840374 17:68600997-68601019 GGGCCCCGGGGCGCCGGCGCCGG + Exonic
1156651971 18:39235609-39235631 GGCCCCCCGGCCCCCGGCGTGGG + Intergenic
1160577246 18:79863683-79863705 TGCTCCCCGGGCGGCGGCGGCGG + Exonic
1160679820 19:407538-407560 AGCACCCCGGACGCCAGCCCCGG - Exonic
1160859064 19:1230080-1230102 TCCCCCCCGGAGCGCGGCGCGGG - Exonic
1160919508 19:1513171-1513193 TGCCCGGCGGACGCGAGCGCAGG + Exonic
1161069257 19:2252300-2252322 GGGCCCCTGGACTCCGGCGCGGG + Exonic
1161587423 19:5113215-5113237 AGCCCCCAGGATGGCGGCGCGGG - Intronic
1162035091 19:7934273-7934295 CGCCCCCCGGCCGCCAGGGCCGG - Intronic
1162916353 19:13876575-13876597 TGCCCCCCGGCCCCCAGCTCTGG - Intronic
1166317981 19:41999206-41999228 GGCCGCCCGGGCGTCGGCGCCGG + Exonic
1166329564 19:42070169-42070191 TGCCCGCCTGCCGCCTGCGCTGG + Intronic
1166564403 19:43754814-43754836 TGCAACCCGGACGCCGAGGCCGG - Exonic
1167239364 19:48334026-48334048 TGCCCCCTGGCCGCCGGGCCAGG + Exonic
1168622221 19:57888663-57888685 TGCAGCCCGGACGCCGGCGTTGG - Intronic
1168720978 19:58554938-58554960 TGCCGCCCGCACGCCCGCCCGGG + Intronic
930096890 2:47571878-47571900 AGCTCCCCTGAGGCCGGCGCGGG + Intergenic
933751197 2:85602822-85602844 TTCCCCCGTGACGCGGGCGCGGG - Intronic
934678252 2:96265334-96265356 TGCCCGGCGGGCGCCGGCGGAGG - Exonic
936863893 2:117055711-117055733 TCCCCCCCGGGCGCTGCCGCGGG - Intergenic
941111603 2:161423511-161423533 TTCCACCCGGGCGCGGGCGCGGG + Exonic
942150929 2:173075716-173075738 TGCCCCCCGGGCGCAGGCCAGGG + Intronic
946366943 2:219254219-219254241 TGCCTCCAGGACGCAGGTGCAGG - Intronic
947418482 2:229921706-229921728 GGCCCCGCCGCCGCCGGCGCCGG + Intronic
948850884 2:240704721-240704743 CTCCCGCCGGACGCAGGCGCGGG + Intergenic
1168951204 20:1803387-1803409 TGCGCTCCGCACGCTGGCGCCGG + Intergenic
1170889346 20:20365308-20365330 TGCGCCCCCGACGCCGGCCTTGG - Intergenic
1171012439 20:21515824-21515846 TGCCCCCGGGTTGCCAGCGCTGG + Intergenic
1171223551 20:23421630-23421652 AGCTCCCAGGACGTCGGCGCAGG + Intergenic
1176016912 20:62938430-62938452 TGCCCCCTGGGCACCGGCGCGGG - Intronic
1179496954 21:41778184-41778206 TGCCCCCCGGCGGGGGGCGCAGG - Intergenic
1180866218 22:19121595-19121617 TGCTCCCGGGACGCTCGCGCCGG + Intronic
1181583800 22:23842149-23842171 TGCCCACCGGGCGCCCGCCCAGG - Intergenic
1181776909 22:25166441-25166463 TGCCCCCCTGCCGCCTGCCCTGG + Intronic
1183509679 22:38227461-38227483 AGCCACCGGGAAGCCGGCGCAGG + Intronic
1184222644 22:43110728-43110750 TGCGGCCCGGCTGCCGGCGCGGG - Exonic
949260552 3:2099028-2099050 TGCCCCGGGGACGCGGTCGCGGG + Intronic
950043317 3:9933790-9933812 CGCCCCCTGGACTGCGGCGCGGG + Intergenic
955060450 3:55488208-55488230 TGCCGCACGGACCCCGGCTCTGG + Intronic
966390805 3:179451105-179451127 GGCCCCACGACCGCCGGCGCAGG - Intronic
966684828 3:182682730-182682752 CGCCCCCCGCGCGCCGGCCCGGG + Intergenic
967904281 3:194487519-194487541 TGCGCCCCGGCCGCAGGCGGAGG + Intronic
968541643 4:1171224-1171246 GGCCCCCCGGACCCCGCCCCCGG + Intronic
969259159 4:6022730-6022752 TGCCCTCCGGGAGGCGGCGCAGG - Intergenic
969553895 4:7893077-7893099 TGCCCCCCCGGCACCGGGGCTGG - Intronic
973319131 4:48792430-48792452 TGCCCCCCGCACCCCCGCACAGG + Intergenic
975633093 4:76421309-76421331 CGCCCGCCGGACGCCGTCGCTGG + Intronic
979231550 4:118353060-118353082 TGCCCCCTGGGGGCGGGCGCCGG + Intergenic
982745744 4:159103197-159103219 CGGCCCTCGGACGCCCGCGCCGG + Intergenic
984778584 4:183504898-183504920 AGCGCCCGGGACCCCGGCGCCGG + Intergenic
985666968 5:1186430-1186452 TGCCCCCCGGCCTCCTGCCCTGG + Intergenic
985808889 5:2068743-2068765 TTCCCCCCGCAGGCCGGTGCTGG - Intergenic
985895990 5:2750502-2750524 CGCCCCCAGGTCGCCGGAGCAGG + Intronic
986608729 5:9546461-9546483 TGCACCCCGGAGGGGGGCGCCGG + Intergenic
997349647 5:133221473-133221495 TGCCCCCCTGACCCCGGCCCAGG + Intronic
1002121269 5:177006450-177006472 TGGGCTCCGGACGCCGGGGCTGG - Intronic
1002487729 5:179550920-179550942 TCCCCGCTGGCCGCCGGCGCGGG + Intronic
1002887890 6:1312265-1312287 TGCCCCGAAGACGCCCGCGCGGG + Intergenic
1002926695 6:1609453-1609475 AGCCCCGCCGACGCCAGCGCTGG - Intergenic
1004690436 6:17987990-17988012 GGCCCCGCGGGCGCCGGTGCAGG - Intergenic
1005605513 6:27473146-27473168 CCCGCCCCGCACGCCGGCGCCGG + Intergenic
1026894576 7:74002844-74002866 TTCCTCCCGGACGCCGGCCTGGG + Intergenic
1032190499 7:129762720-129762742 TGCGCCCCCGACGGCGGCTCTGG - Intergenic
1034128968 7:148698742-148698764 TCCCCCGCGGTCGCCGGAGCCGG + Intronic
1042532888 8:69833047-69833069 TGCCCCCCCACCCCCGGCGCAGG - Exonic
1053841559 9:42191892-42191914 TGCCCCCTGCACCCCGGTGCCGG - Intergenic
1054120021 9:61198286-61198308 TGCCCCCTGCACCCCGGTGCCGG - Intergenic
1054587735 9:66984276-66984298 TGCCCCCTGCACCCCGGTGCCGG + Intergenic
1054798508 9:69324970-69324992 GGACCCCAGGAAGCCGGCGCAGG + Intronic
1058866610 9:109167032-109167054 AGCCCCGCGGACGACGGTGCGGG - Exonic
1060812017 9:126615316-126615338 TGCGACCGGGACGCCGGGGCTGG + Intronic
1062491709 9:136808082-136808104 GCCCCCCCGGAGGCCGGAGCCGG - Exonic
1200002132 X:153067514-153067536 GGCCCCCCCGACCCCGGGGCTGG - Intergenic
1200005601 X:153082511-153082533 GGCCCCCCCGACCCCGGGGCTGG + Intergenic
1200101020 X:153689073-153689095 TGCCCCCCAGACTCCCGGGCTGG + Intronic