ID: 1147312828

View in Genome Browser
Species Human (GRCh38)
Location 17:39605307-39605329
Sequence CGCTGCCCCAGGAGAGCGGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 245}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147312819_1147312828 11 Left 1147312819 17:39605273-39605295 CCCTGGGACAGGCCACCCACAGG 0: 1
1: 0
2: 2
3: 32
4: 301
Right 1147312828 17:39605307-39605329 CGCTGCCCCAGGAGAGCGGCAGG 0: 1
1: 0
2: 2
3: 21
4: 245
1147312812_1147312828 30 Left 1147312812 17:39605254-39605276 CCCCTGGGGGAAGCGAGGCCCCT 0: 1
1: 0
2: 0
3: 21
4: 213
Right 1147312828 17:39605307-39605329 CGCTGCCCCAGGAGAGCGGCAGG 0: 1
1: 0
2: 2
3: 21
4: 245
1147312823_1147312828 -1 Left 1147312823 17:39605285-39605307 CCACCCACAGGTAACAGGACTGC 0: 1
1: 0
2: 2
3: 12
4: 130
Right 1147312828 17:39605307-39605329 CGCTGCCCCAGGAGAGCGGCAGG 0: 1
1: 0
2: 2
3: 21
4: 245
1147312813_1147312828 29 Left 1147312813 17:39605255-39605277 CCCTGGGGGAAGCGAGGCCCCTG 0: 1
1: 0
2: 2
3: 20
4: 231
Right 1147312828 17:39605307-39605329 CGCTGCCCCAGGAGAGCGGCAGG 0: 1
1: 0
2: 2
3: 21
4: 245
1147312824_1147312828 -4 Left 1147312824 17:39605288-39605310 CCCACAGGTAACAGGACTGCGCT 0: 1
1: 0
2: 1
3: 5
4: 66
Right 1147312828 17:39605307-39605329 CGCTGCCCCAGGAGAGCGGCAGG 0: 1
1: 0
2: 2
3: 21
4: 245
1147312825_1147312828 -5 Left 1147312825 17:39605289-39605311 CCACAGGTAACAGGACTGCGCTG 0: 1
1: 0
2: 2
3: 11
4: 96
Right 1147312828 17:39605307-39605329 CGCTGCCCCAGGAGAGCGGCAGG 0: 1
1: 0
2: 2
3: 21
4: 245
1147312821_1147312828 10 Left 1147312821 17:39605274-39605296 CCTGGGACAGGCCACCCACAGGT 0: 1
1: 0
2: 3
3: 23
4: 232
Right 1147312828 17:39605307-39605329 CGCTGCCCCAGGAGAGCGGCAGG 0: 1
1: 0
2: 2
3: 21
4: 245
1147312818_1147312828 12 Left 1147312818 17:39605272-39605294 CCCCTGGGACAGGCCACCCACAG 0: 1
1: 0
2: 3
3: 34
4: 296
Right 1147312828 17:39605307-39605329 CGCTGCCCCAGGAGAGCGGCAGG 0: 1
1: 0
2: 2
3: 21
4: 245
1147312814_1147312828 28 Left 1147312814 17:39605256-39605278 CCTGGGGGAAGCGAGGCCCCTGG 0: 1
1: 0
2: 1
3: 23
4: 287
Right 1147312828 17:39605307-39605329 CGCTGCCCCAGGAGAGCGGCAGG 0: 1
1: 0
2: 2
3: 21
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147312828 Original CRISPR CGCTGCCCCAGGAGAGCGGC AGG Exonic