ID: 1147312828

View in Genome Browser
Species Human (GRCh38)
Location 17:39605307-39605329
Sequence CGCTGCCCCAGGAGAGCGGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 245}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147312812_1147312828 30 Left 1147312812 17:39605254-39605276 CCCCTGGGGGAAGCGAGGCCCCT 0: 1
1: 0
2: 0
3: 21
4: 213
Right 1147312828 17:39605307-39605329 CGCTGCCCCAGGAGAGCGGCAGG 0: 1
1: 0
2: 2
3: 21
4: 245
1147312819_1147312828 11 Left 1147312819 17:39605273-39605295 CCCTGGGACAGGCCACCCACAGG 0: 1
1: 0
2: 2
3: 32
4: 301
Right 1147312828 17:39605307-39605329 CGCTGCCCCAGGAGAGCGGCAGG 0: 1
1: 0
2: 2
3: 21
4: 245
1147312818_1147312828 12 Left 1147312818 17:39605272-39605294 CCCCTGGGACAGGCCACCCACAG 0: 1
1: 0
2: 3
3: 34
4: 296
Right 1147312828 17:39605307-39605329 CGCTGCCCCAGGAGAGCGGCAGG 0: 1
1: 0
2: 2
3: 21
4: 245
1147312823_1147312828 -1 Left 1147312823 17:39605285-39605307 CCACCCACAGGTAACAGGACTGC 0: 1
1: 0
2: 2
3: 12
4: 130
Right 1147312828 17:39605307-39605329 CGCTGCCCCAGGAGAGCGGCAGG 0: 1
1: 0
2: 2
3: 21
4: 245
1147312825_1147312828 -5 Left 1147312825 17:39605289-39605311 CCACAGGTAACAGGACTGCGCTG 0: 1
1: 0
2: 2
3: 11
4: 96
Right 1147312828 17:39605307-39605329 CGCTGCCCCAGGAGAGCGGCAGG 0: 1
1: 0
2: 2
3: 21
4: 245
1147312814_1147312828 28 Left 1147312814 17:39605256-39605278 CCTGGGGGAAGCGAGGCCCCTGG 0: 1
1: 0
2: 1
3: 23
4: 287
Right 1147312828 17:39605307-39605329 CGCTGCCCCAGGAGAGCGGCAGG 0: 1
1: 0
2: 2
3: 21
4: 245
1147312813_1147312828 29 Left 1147312813 17:39605255-39605277 CCCTGGGGGAAGCGAGGCCCCTG 0: 1
1: 0
2: 2
3: 20
4: 231
Right 1147312828 17:39605307-39605329 CGCTGCCCCAGGAGAGCGGCAGG 0: 1
1: 0
2: 2
3: 21
4: 245
1147312821_1147312828 10 Left 1147312821 17:39605274-39605296 CCTGGGACAGGCCACCCACAGGT 0: 1
1: 0
2: 3
3: 23
4: 232
Right 1147312828 17:39605307-39605329 CGCTGCCCCAGGAGAGCGGCAGG 0: 1
1: 0
2: 2
3: 21
4: 245
1147312824_1147312828 -4 Left 1147312824 17:39605288-39605310 CCCACAGGTAACAGGACTGCGCT 0: 1
1: 0
2: 1
3: 5
4: 66
Right 1147312828 17:39605307-39605329 CGCTGCCCCAGGAGAGCGGCAGG 0: 1
1: 0
2: 2
3: 21
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147312828 Original CRISPR CGCTGCCCCAGGAGAGCGGC AGG Exonic
900307780 1:2019481-2019503 CGCGGCACCAGGTGAGCGGGCGG + Exonic
900446382 1:2683146-2683168 CACAGCCCCAGGAGAGCATCCGG + Intronic
900446594 1:2684231-2684253 CACAGCCCCAGGAGAGCATCCGG + Intronic
900622081 1:3592140-3592162 AGTGGCCCCAGGAGAGCAGCCGG + Intronic
900851025 1:5143155-5143177 CGCTGCGCCCGGAAAGAGGCTGG - Intergenic
901075760 1:6554034-6554056 GGCAGCCCCGGGAGAGCTGCAGG - Intronic
901417600 1:9128494-9128516 CGCTGGCCCAGGACAGCCTCGGG + Intronic
901453992 1:9352937-9352959 TGCTGCCACAGTTGAGCGGCAGG + Intronic
902082223 1:13828989-13829011 CACAGCCCCAGGTGAGCTGCCGG - Intergenic
902385451 1:16073291-16073313 CGCGTCCCCAGGGGTGCGGCGGG + Intronic
903968312 1:27103078-27103100 CTCTGCCCCAGGAGGCCGCCAGG - Intronic
904285997 1:29453640-29453662 CTCTGCCCCTGGAGAGGGGAGGG + Intergenic
907749299 1:57246735-57246757 CTCTGCCCCTGGAGCGCTGCAGG - Intronic
907857771 1:58320921-58320943 TGCTGCTCCAGGAGAGAGGGAGG - Intronic
911176996 1:94826971-94826993 CCCTGCCCCTGGGGAGCTGCAGG + Intronic
917749068 1:178038012-178038034 CCCAGCCCCGGGAGAGCGGAAGG + Intergenic
920388393 1:205583659-205583681 TGCTGGCCCAGGAGAGGTGCTGG - Intronic
920431889 1:205924022-205924044 CCCCACCCCAGGAGAGCGCCAGG - Intronic
922195208 1:223353723-223353745 CGGTGCCCCAGGACAGAGGAAGG + Intronic
922903455 1:229156203-229156225 AGCTGACCCAGGAGCTCGGCTGG - Intergenic
923280338 1:232437578-232437600 CACTGCCCCAGAAGAGAAGCAGG - Intronic
1067066038 10:43104879-43104901 CCCTTCCCGAGGAAAGCGGCTGG + Intronic
1070670893 10:78376504-78376526 CGCTGACCAAGGAGTGGGGCTGG - Intergenic
1073103744 10:101020667-101020689 CCCCTCCCCAGGAGACCGGCCGG - Exonic
1076297546 10:129398039-129398061 CGCAGCCCCAGGAGAGAGGCCGG + Intergenic
1076753468 10:132555358-132555380 CGCTGGCCCAGTGGAGCTGCTGG + Intronic
1076756873 10:132577155-132577177 CGCTGCACCTGGAGAGAAGCTGG + Intronic
1081805316 11:45886839-45886861 TGGTGCCCCAGGAGAGGGGAAGG - Intronic
1081809769 11:45908264-45908286 AGCTGTCAGAGGAGAGCGGCTGG - Intergenic
1082808473 11:57464352-57464374 CGCTGCCCCAGGAGAGACAGAGG - Intronic
1083664540 11:64267396-64267418 GGCTCCCCCAGGAGATCCGCCGG + Exonic
1083902520 11:65650514-65650536 GGCTGCCCCAGGAAAGGGGCTGG + Intronic
1084153296 11:67301203-67301225 CGCAGTCCCTGGAGAGCTGCAGG + Intronic
1084559146 11:69892963-69892985 CTCTGCCGCAGGAGACCAGCTGG - Intergenic
1084697908 11:70767207-70767229 CCCAGCCCCAGGAGAGGGCCAGG + Intronic
1084698064 11:70768199-70768221 CTCTGCCCCAGTAGACAGGCAGG - Intronic
1089578023 11:119460364-119460386 GGCTGCCACAGGAGATGGGCGGG + Intergenic
1089583984 11:119498333-119498355 GGCTGAACCAGGAAAGCGGCAGG - Intergenic
1090187363 11:124747104-124747126 CACAGCCCCAGGAGCCCGGCGGG - Exonic
1090391593 11:126392279-126392301 TGCAGTCCCAGGAGAGCTGCAGG - Intronic
1090748519 11:129726269-129726291 CTCTGCCACAGGGGAGGGGCTGG - Intergenic
1091221265 11:133931258-133931280 AGCTGACCCTGAAGAGCGGCAGG - Intronic
1091275114 11:134344725-134344747 CCCTGCCCCAGCCCAGCGGCCGG - Intronic
1091460804 12:642648-642670 CGCTGCCCACGGAGGGGGGCGGG + Intronic
1092255003 12:6922061-6922083 AGCTGGCCCAGGAGAATGGCTGG + Exonic
1095181663 12:39153791-39153813 CGCTGCCTCAGGAAAGCGGAGGG - Intergenic
1101037180 12:100717308-100717330 GGCTGCGCCGCGAGAGCGGCAGG - Intergenic
1101449234 12:104761239-104761261 GGATGCCACAGGAGAGCAGCAGG + Exonic
1101521091 12:105483099-105483121 AGCTGCCCCAGGAGAGAGGAGGG + Intergenic
1102490656 12:113287943-113287965 GGCAGCCCCAGGACACCGGCTGG - Intronic
1102969624 12:117155779-117155801 CGCAGCCCAAGGTAAGCGGCGGG - Exonic
1103699460 12:122841284-122841306 GGCTGGCCCAGCAGAGCGGGAGG + Intronic
1103841635 12:123869919-123869941 TGCTGCAGCAGGAGAGGGGCAGG - Intronic
1104482216 12:129117606-129117628 TGCAGCCCCAGGAGAAAGGCTGG - Intronic
1105033974 12:132904937-132904959 CGCTGCCCCTGGTGGCCGGCAGG - Intronic
1105717542 13:23082156-23082178 TGCTTCCCCAGGAGAATGGCGGG - Intergenic
1106234561 13:27851137-27851159 CCCTGCCCCATGCCAGCGGCTGG + Intergenic
1110305675 13:73984352-73984374 CGCTGGCACAGGGAAGCGGCTGG + Intronic
1113378573 13:109784598-109784620 CGCTGCCGCTGGAGGGCCGCTGG + Exonic
1113486389 13:110655599-110655621 CGCTGCTTCAGGAGAGAAGCCGG + Intronic
1113733551 13:112659224-112659246 CCCTGCCCCTGGAGAGCTTCGGG - Intronic
1113784517 13:112995512-112995534 TTCTGCCCCAGGAGAGCAGAGGG + Intronic
1113804088 13:113103591-113103613 GGCTGCCACAGGAGAGAGGGAGG + Intergenic
1113936180 13:113996262-113996284 CCCTGCCCCGGGGGAGCGGGAGG - Intronic
1114647121 14:24262067-24262089 CGCTGCCCCGGGATACAGGCCGG + Exonic
1118722530 14:68604517-68604539 AGGTGCCCCAGGAGAGCAGGGGG + Intronic
1121561847 14:94881793-94881815 CACAGCCCCATGAGAGGGGCAGG + Intergenic
1121586142 14:95064369-95064391 AGCAGGCACAGGAGAGCGGCAGG + Intergenic
1122140844 14:99662110-99662132 GCCTGACCCAGCAGAGCGGCTGG - Intronic
1122155358 14:99747332-99747354 CTCTGGCCCAGGAGAAAGGCAGG + Intronic
1122438710 14:101715939-101715961 AGCTGCCCTTGGAGAGAGGCCGG - Intergenic
1122834090 14:104422697-104422719 CGCTGCCCGGGAAGCGCGGCAGG - Intergenic
1123036153 14:105472794-105472816 CGCTGCCCAGGGACTGCGGCTGG + Intergenic
1123480683 15:20628734-20628756 CGCCGCCCGAGGAGAACGGGAGG - Intergenic
1123632760 15:22273379-22273401 GGCTGCCCCAAGTGCGCGGCCGG + Intergenic
1123637326 15:22371633-22371655 CGCCGCCCGAGGAGAACGGGAGG + Intergenic
1124594893 15:31084030-31084052 CCCTGGCCCAGGAGAGGGGTCGG - Intronic
1127394976 15:58537343-58537365 GGCTCCCCCAGAAGAGAGGCTGG + Intronic
1130460580 15:84156221-84156243 TGCAGCCACAGGAGAGCAGCCGG - Intergenic
1130512538 15:84601219-84601241 CCCTCCCCCAGCAGAGCTGCCGG - Intronic
1132544717 16:527914-527936 TTCTGCCTCCGGAGAGCGGCGGG - Exonic
1132568247 16:632934-632956 CGCGGCCCCAGGTGTGGGGCGGG - Exonic
1132703728 16:1232300-1232322 AGCAGCCCCAGGGGAGCGGCCGG - Intergenic
1132704782 16:1239061-1239083 AGCAGCCCCAGGGGAGCGGCCGG + Intergenic
1132707790 16:1254095-1254117 AGCAGCCCCAGGGGAGCGGCCGG + Intergenic
1133032445 16:3017843-3017865 CGCTCCCCCAGGTGAGGGGGAGG + Intronic
1133236368 16:4389154-4389176 GGCTGCCCCAGGCAAGAGGCAGG + Intronic
1133502510 16:6379283-6379305 TGCTTCCCTAGGAGAGAGGCAGG + Intronic
1135091557 16:19522001-19522023 TACTGCCCCAGGAGCCCGGCGGG - Exonic
1137386786 16:48049404-48049426 CCCTGCACCAGCAGAGTGGCAGG + Intergenic
1139492471 16:67293739-67293761 CGCTTCCCAAGGGGAGCTGCAGG + Exonic
1141700036 16:85638234-85638256 CGCTGCCCTGGGAGAAAGGCTGG + Intronic
1141749676 16:85949974-85949996 CCCTGCCCCAGGTGACTGGCAGG - Intergenic
1141847269 16:86619367-86619389 CCCTGCTCCAAGAGAACGGCGGG - Intergenic
1141970304 16:87477387-87477409 GGCTGCCCCATGTGCGCGGCCGG - Intronic
1142213129 16:88817779-88817801 CGCTGCACCAGGGCAGCCGCAGG - Intronic
1142217810 16:88838419-88838441 CCCGGTCCCAGGAGAGCGGTTGG - Intronic
1142422725 16:89982371-89982393 GGCTGACCCTGGACAGCGGCTGG + Intergenic
1142738565 17:1917279-1917301 AGGTGCCCCAGGAGAGCGGCAGG - Intergenic
1143321193 17:6070343-6070365 CGCGGCCCGGGGACAGCGGCCGG - Intronic
1143741752 17:8959591-8959613 CGCTCCCCCAGGAGGCTGGCTGG + Intronic
1146901419 17:36591925-36591947 GGCGGCGGCAGGAGAGCGGCCGG + Exonic
1147312828 17:39605307-39605329 CGCTGCCCCAGGAGAGCGGCAGG + Exonic
1147381372 17:40058202-40058224 CACTGCCCCAGGAGAGTGAAAGG + Intronic
1147598862 17:41733844-41733866 CGCAGTGCCAGGAGAGGGGCGGG - Intronic
1148031314 17:44623038-44623060 CCCTGCCTCAGGAGAGTAGCTGG - Intergenic
1149537022 17:57441010-57441032 TGCAGCCCTGGGAGAGCGGCAGG - Intronic
1152652154 17:81499701-81499723 CTCCGCCCCAGGAGAGAAGCTGG + Intergenic
1152722887 17:81931506-81931528 CCCTGCCCCAGCAAAGCGCCTGG - Intergenic
1152725148 17:81941483-81941505 AGTTGCCCCAGGAGAGCCGCAGG + Exonic
1152800376 17:82328038-82328060 TGCTGCCCCGGGAGGGGGGCTGG - Intronic
1153805632 18:8706422-8706444 CGCAGCCCGAGGAGCGCCGCCGG + Intronic
1153978505 18:10290080-10290102 CCCTGCCCTAGGAGGGAGGCTGG - Intergenic
1159040456 18:63319576-63319598 CGCCTCCCCAGGAGAGAGACAGG + Exonic
1159241850 18:65751434-65751456 CGCTGCACCTGGAGAGTGCCGGG - Intronic
1160892678 19:1387535-1387557 CCCTGGCGCAGGAAAGCGGCAGG + Intronic
1160922324 19:1526781-1526803 CGCTGCCACAGGTGAGAGCCGGG + Exonic
1161104620 19:2437126-2437148 CCCTGCCCAGGGAGAGCTGCTGG - Intronic
1161571331 19:5032314-5032336 CCTTGACCCAGGAGAGCAGCAGG - Intronic
1161620040 19:5292984-5293006 AGCTGGCCCTGGAGGGCGGCCGG + Intronic
1161768062 19:6217582-6217604 CGCTGGCCCTGGGGAGCGGGTGG + Intronic
1162373610 19:10292722-10292744 GGCTGCCCCGGGACCGCGGCTGG - Exonic
1162777892 19:12990537-12990559 CGCTGCCCCAGAAGAGGGAGGGG - Intergenic
1163118081 19:15200185-15200207 CGCGGCCAGAGGAGAGAGGCGGG + Intronic
1163655155 19:18541688-18541710 CCCGGCCCCAGAAGAGTGGCTGG - Exonic
1164577121 19:29411998-29412020 CGGTCCCACAGGAGAGGGGCTGG + Intergenic
1166094184 19:40529442-40529464 CTCTACCCCAGGAGAGGGGCGGG + Intronic
1167439282 19:49499199-49499221 CCCTTCCCCAGCAGAGCAGCAGG - Intronic
1167557171 19:50203686-50203708 CGCCGCCCCCGGAGGGCTGCCGG - Intronic
1168176965 19:54633367-54633389 CCCTGCCCCAGGAGAGCTCTGGG + Intronic
925019656 2:558409-558431 CGATGACCCAGGAGAACGGAAGG - Intergenic
925041766 2:736752-736774 CCCTGCCCCAGGAGAGCTTGAGG + Intergenic
925071980 2:976884-976906 GGCTGCCTCTGGAGAGCTGCTGG - Intronic
925099930 2:1235665-1235687 CGCTGCCCCAGGATCCCTGCAGG + Intronic
925970956 2:9106188-9106210 TGCTGCCCCAGGTGTGCGGGAGG + Intergenic
927417964 2:22898877-22898899 CGATGGCCCAGGAGAGCTGATGG - Intergenic
927576639 2:24206814-24206836 CGCAGCCTCAGGACAGCGGGGGG + Intronic
927900336 2:26814222-26814244 GGCTGACGCAGGAGAACGGCTGG + Intergenic
930034082 2:47074825-47074847 CTCAGCCACAGGAGAGGGGCTGG - Exonic
931216219 2:60247469-60247491 GGCTGTCCCAGGAGGGCGGCTGG - Intergenic
931321963 2:61180588-61180610 CGCTGCTGGAGGAGAGCAGCTGG - Intronic
933649652 2:84840365-84840387 CGCTGCCTCTGTAGAGAGGCTGG - Intronic
933971257 2:87471544-87471566 GGCTGCCCCAGGACAGAGGAGGG + Intergenic
934654020 2:96108053-96108075 TGCTGCCCCAGGAGAGATGAGGG - Intergenic
934708481 2:96500737-96500759 TGCTGCGGGAGGAGAGCGGCTGG - Exonic
935037887 2:99396627-99396649 AGCGGCCACAGGAGAGGGGCAGG - Intronic
935685539 2:105679547-105679569 TGGTGCCCCAGCAGAGGGGCAGG - Intergenic
936322472 2:111478644-111478666 GGCTGCCCCAGGACAGAGGAGGG - Intergenic
947754245 2:232550465-232550487 CGCTCCCTTAGGAGAGCGGGCGG + Exonic
948831963 2:240602650-240602672 CGGTGCCCCAGGAGCCTGGCGGG - Intronic
948831974 2:240602681-240602703 CGGTGCCCCAGGAGCCTGGCGGG - Intronic
948831986 2:240602713-240602735 CGGTGCCCCAGGAGCCTGGCGGG - Intronic
948832009 2:240602776-240602798 CGGTGCCCCAGGAGCCTGGCGGG - Intronic
1172100858 20:32483470-32483492 GGCTGCCCGGGGAGAGGGGCTGG + Exonic
1172269964 20:33649381-33649403 CGATGCCCGAGGAAAGAGGCAGG - Exonic
1172443762 20:34982522-34982544 CGCTGCCCTGGGAGACGGGCCGG + Exonic
1172778823 20:37423706-37423728 CTGTGCGCCAGGAGAGGGGCTGG - Intergenic
1173729081 20:45316466-45316488 CCCTCCCCCAGCTGAGCGGCGGG + Exonic
1175106165 20:56616555-56616577 CCCTGGCACAGGAGAGGGGCTGG + Intergenic
1175186935 20:57185056-57185078 GGCTGCCCCTGGAGAGCCGATGG + Intronic
1178525503 21:33325121-33325143 CGCAGCCGCAGGTGAGAGGCGGG + Exonic
1180046346 21:45307527-45307549 GTCTGGCCCAGGAGGGCGGCGGG + Intergenic
1180231087 21:46427046-46427068 CGCTGCCCCTGGGGACCAGCGGG + Intronic
1181006475 22:20016152-20016174 CGCTGCCCCAGGAAAGTTCCCGG + Intronic
1181407200 22:22693386-22693408 AGCTTCCCCAGGAGAGAGTCCGG - Intergenic
1181415187 22:22754153-22754175 AGCTTCCCCAGGAGAGAGTCGGG - Intronic
1182502022 22:30754770-30754792 CCCTGCCCCAGCACAGCAGCAGG - Intronic
1183190735 22:36320546-36320568 TCCTGGCCCAGGAGAGCGCCAGG + Intronic
1183240881 22:36657494-36657516 CGTTGCTCCAGGAGCCCGGCTGG + Intronic
1183316810 22:37141528-37141550 AGCTGCCCCAGGAGAGCTCCTGG - Intronic
1183465374 22:37977734-37977756 AGTTGCCCCAGCAGAGCTGCAGG - Intronic
1184075772 22:42176552-42176574 TGCTTCCCCAGGAGAGAAGCAGG - Intronic
1184670657 22:46010979-46011001 CCCCTCCCCAGGAGAGTGGCTGG + Intergenic
1184717043 22:46288300-46288322 CCCTGTCCCAGGTGAGAGGCCGG - Intronic
1184822236 22:46917993-46918015 CGCTGCCCCTGAAGAGCTGCAGG + Intronic
1185409716 22:50675152-50675174 CGCGGCCCCGGGAGGGCGGCTGG - Intergenic
949309549 3:2681348-2681370 CGCTGCTCCAGGGGTGTGGCAGG - Intronic
952011307 3:28903498-28903520 CGCTGGCCCACGAGCGTGGCGGG + Intergenic
954156427 3:48687347-48687369 CCCTGCCCCAGGAGGGCTTCTGG - Intergenic
954334758 3:49909760-49909782 CCCTCCCCCAGCAGAGGGGCTGG - Intronic
955404303 3:58616238-58616260 TGAGGCCCCAGGAGAGCAGCTGG + Intronic
959597456 3:108143756-108143778 GGCTGCCCCAGGACACTGGCTGG + Intergenic
961202437 3:125055669-125055691 CGCCGCCCCGGGAGCGCCGCGGG - Exonic
961359385 3:126357440-126357462 CGCTGCGTCACGTGAGCGGCGGG - Exonic
961572046 3:127806234-127806256 CACAGCCCAAGGAGAACGGCAGG - Intronic
962247288 3:133806142-133806164 CGCTGCTTCAGGAGAGAGGGTGG - Intronic
964118715 3:153161571-153161593 CCCTGCCCCGAGAGAGCTGCAGG + Intergenic
965232204 3:166068998-166069020 GGCTGACGCAGGAGAACGGCGGG + Intergenic
968662238 4:1803457-1803479 CTCTGTCCCAGGTGAGCGGCAGG - Intronic
968701814 4:2061045-2061067 CGCAGGCCCAGCAGCGCGGCCGG - Exonic
968811528 4:2801573-2801595 TGCAGCCCCAGCAGAGGGGCTGG + Intronic
973646644 4:52956881-52956903 AGCTGCCCCGGGTGAGCAGCAGG + Intronic
974022882 4:56707304-56707326 CGCTGCCACTGGAGTGTGGCTGG - Intergenic
975683267 4:76896991-76897013 CGCTCCCCGCGGAGACCGGCCGG - Exonic
976629172 4:87219960-87219982 CGGGGCCCCGGGAGGGCGGCCGG - Intronic
979231362 4:118352441-118352463 GGCAGCCCCAGGGGTGCGGCCGG + Exonic
979531034 4:121769401-121769423 AGCTTCCCCAGGAGAAGGGCAGG + Intergenic
980963966 4:139502698-139502720 CTCTGCCACAGCAGAGAGGCAGG + Intronic
985219679 4:187690936-187690958 CACTGCCCCAGGGGAGTGTCAGG + Intergenic
985474990 5:73921-73943 CCCTGCCCCAGGAGACCTGCAGG + Intergenic
985532981 5:444455-444477 GCGTGCCCCAGCAGAGCGGCTGG + Intronic
986387014 5:7244520-7244542 CACAGCCCCAGCAGAGCTGCAGG - Intergenic
989188898 5:38650594-38650616 CGTTGCCCAATGAGAGCCGCCGG + Intergenic
992550221 5:77852611-77852633 CGCTGCTCCAGGAGGGGGGTGGG + Intronic
998208367 5:140175426-140175448 CGCAGCCCCTGGGGAGGGGCAGG + Intronic
998416054 5:141946675-141946697 GGCTGTCCCAGGAGAGGGACTGG + Intronic
999171537 5:149599303-149599325 CTCAGCCACAGGAGAGGGGCTGG + Intronic
999750375 5:154624112-154624134 GGCTGCCCCTGGAGAGCTCCTGG + Intergenic
1000220460 5:159209309-159209331 CGCCGCCCGAGGAGAACGGGAGG - Intronic
1001965729 5:175908641-175908663 CCCTGCCCCAGCACAGCAGCCGG - Intergenic
1002107744 5:176888547-176888569 GGCTGCCCCAGTAGAGGGGCTGG + Exonic
1002251216 5:177930555-177930577 CCCTGCCCCAGCACAGCAGCCGG + Intergenic
1002306496 5:178286775-178286797 TGCTGCCCCGGGGGAGGGGCAGG - Intronic
1003274350 6:4636704-4636726 TGCTGCCCCAGGAGGCAGGCAGG - Intergenic
1007406938 6:41640663-41640685 CGCTGCCCCAGGGGCTCTGCTGG + Intronic
1013366943 6:109443855-109443877 TGCTGCCCCAGGAGTAGGGCTGG - Exonic
1014837285 6:126173882-126173904 CTCTGCCCCAGGAGAATGTCTGG + Intergenic
1017097432 6:150817125-150817147 CCCTGCCCTAGGAGAGTGGGTGG + Intronic
1017989428 6:159473241-159473263 TGCAGCACCAGGAGAGGGGCAGG - Intergenic
1018046361 6:159969429-159969451 CGGTGCCCGGGGTGAGCGGCCGG + Intronic
1019180724 6:170186125-170186147 CGCTGTCCCAGGTGAGCCACGGG + Intergenic
1019304867 7:328535-328557 GGCGGCCCCAGGTGAGGGGCAGG - Intergenic
1019343461 7:519057-519079 CGCCGCCACAGGAGACCGGCTGG - Exonic
1019415713 7:925728-925750 CAGTGCCGCAGGAAAGCGGCGGG - Intronic
1019765129 7:2844257-2844279 CGCGGCCTGAGGCGAGCGGCGGG - Exonic
1019853979 7:3586078-3586100 GGCTGGCCCAGGAGAGAAGCAGG + Intronic
1021450332 7:20778262-20778284 CGCAGCCCGAGGGGAGCGGCGGG + Intergenic
1022860572 7:34362671-34362693 GGCTGCAGCAGGAGAGAGGCAGG + Intergenic
1023801519 7:43839032-43839054 CGCTGCCCCAGATGACCAGCAGG - Intergenic
1024462089 7:49669538-49669560 AGCTGCACCAGGAGGGCTGCTGG + Intergenic
1031629887 7:124033142-124033164 CGCTGCCGCGGGACCGCGGCCGG - Intergenic
1031977381 7:128102665-128102687 AGCTGCCTGAGGAGAGGGGCTGG + Intergenic
1032194098 7:129779933-129779955 CGCTGCCCCGCGAGAGGGGGCGG + Intergenic
1032690058 7:134276831-134276853 GGCTGCCCCTGAGGAGCGGCCGG - Intergenic
1033195234 7:139321794-139321816 TGCTTCCCCAGGACAGCAGCAGG + Intergenic
1034773376 7:153801572-153801594 CAGTGTCCCAGCAGAGCGGCTGG - Intergenic
1035593250 8:834253-834275 CTCTGCCCCACGTGAGGGGCAGG - Intergenic
1037309219 8:17536985-17537007 AGCTGCCCCAGCAGGGAGGCAGG - Intronic
1042159515 8:65877940-65877962 AGGTTCCCCAGGAGAGAGGCGGG + Intergenic
1042219594 8:66460455-66460477 CGCTGCCCCAGGTAAGAGACCGG + Exonic
1044204661 8:89478735-89478757 TGCAACCCCAGGAGAGTGGCTGG + Intergenic
1044692430 8:94894599-94894621 CGCTGGTCCAGGAGGGAGGCGGG - Intronic
1045506591 8:102782866-102782888 CGCTTTCCCAGGAGGGAGGCTGG - Intergenic
1047347126 8:124039206-124039228 CCCTGCCCCTGGAGAGCTCCTGG - Intronic
1049571474 8:143372099-143372121 CCTGGCCCCAGGAGAGCTGCGGG - Intronic
1049788560 8:144462725-144462747 GGCGGCGGCAGGAGAGCGGCGGG - Intronic
1050067106 9:1771620-1771642 CTCCACCCCAGGAGAGCTGCAGG - Intergenic
1052982325 9:34458330-34458352 GGCGGCCCCAGGAGCCCGGCGGG + Exonic
1055397530 9:75891044-75891066 CGCAGCCCCGGGCGATCGGCAGG - Exonic
1056819097 9:89824356-89824378 CACTGCCCCAGGTGAGAGGTGGG - Intergenic
1059110120 9:111549612-111549634 CGCTGCCCCAGAAGAGCTACAGG - Intronic
1059310830 9:113388067-113388089 GGCTGACCCAGGGGAGGGGCGGG + Exonic
1060216524 9:121741747-121741769 AGCTGCCCCAGGATAGCTGGAGG - Intronic
1060791882 9:126490573-126490595 TGCTCCGCCAGGAGTGCGGCAGG - Intronic
1060792948 9:126498076-126498098 CGCTGCGGGAGGAGAGAGGCAGG - Intronic
1060814672 9:126628273-126628295 CCCTGCCTCAGGGGAGCAGCCGG + Intronic
1060979175 9:127782955-127782977 GTCTGCCCCAAGAGAGCCGCTGG - Intergenic
1061923161 9:133793265-133793287 CCCTGCCCCCCGAGAGCAGCGGG + Intronic
1062105762 9:134753940-134753962 CGCTGCCGCCGGAGAACGGGAGG - Intronic
1062465882 9:136681280-136681302 GGCTGCCCCAGGCCAGCGGGAGG + Intronic
1062698815 9:137888694-137888716 CGCTGCACCAGGAGGGAGTCTGG + Intronic
1187950410 X:24465280-24465302 AGCAGCTCCAGGACAGCGGCGGG - Intronic
1188007115 X:25022963-25022985 CGCGGCCCCAGCAGGGCGCCCGG - Intergenic
1189325290 X:40107811-40107833 CGCAGGCCCGGGAGAGGGGCGGG - Intronic
1190740044 X:53282605-53282627 AGCTGCCCCAGCAGGGAGGCAGG - Intronic
1196456284 X:115893603-115893625 GGCTGCCCCAGGAGACAAGCCGG - Intergenic
1197820204 X:130534384-130534406 TGCTGGCCCAGGAGAGGGGCAGG - Intergenic
1202378669 Y:24258959-24258981 TGCAGCCACAGGAGAGCGGCCGG + Intergenic
1202492113 Y:25411162-25411184 TGCAGCCACAGGAGAGCGGCCGG - Intergenic