ID: 1147315347

View in Genome Browser
Species Human (GRCh38)
Location 17:39617773-39617795
Sequence CCGTGCCAGGCGCGGGGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147315347_1147315359 8 Left 1147315347 17:39617773-39617795 CCCCCGCCCCGCGCCTGGCACGG No data
Right 1147315359 17:39617804-39617826 GCGCCCCAGCCGCCCAATCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147315347 Original CRISPR CCGTGCCAGGCGCGGGGCGG GGG (reversed) Intergenic