ID: 1147316515

View in Genome Browser
Species Human (GRCh38)
Location 17:39623440-39623462
Sequence GTCCCAGGAAACACCCTTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147316515_1147316527 26 Left 1147316515 17:39623440-39623462 CCTCTAAGGGTGTTTCCTGGGAC No data
Right 1147316527 17:39623489-39623511 CATGCCAACCCAGCCGGCTCCGG No data
1147316515_1147316525 20 Left 1147316515 17:39623440-39623462 CCTCTAAGGGTGTTTCCTGGGAC No data
Right 1147316525 17:39623483-39623505 CTGCCACATGCCAACCCAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147316515 Original CRISPR GTCCCAGGAAACACCCTTAG AGG (reversed) Intergenic
No off target data available for this crispr