ID: 1147318292

View in Genome Browser
Species Human (GRCh38)
Location 17:39631547-39631569
Sequence CAACCTCCGCAGGAGCGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 78}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147318292_1147318306 19 Left 1147318292 17:39631547-39631569 CCCCTCCGCTCCTGCGGAGGTTG 0: 1
1: 0
2: 0
3: 9
4: 78
Right 1147318306 17:39631589-39631611 GAGTATGCTGGGAAGTGGTTCGG 0: 1
1: 0
2: 0
3: 16
4: 219
1147318292_1147318308 21 Left 1147318292 17:39631547-39631569 CCCCTCCGCTCCTGCGGAGGTTG 0: 1
1: 0
2: 0
3: 9
4: 78
Right 1147318308 17:39631591-39631613 GTATGCTGGGAAGTGGTTCGGGG 0: 1
1: 0
2: 0
3: 6
4: 91
1147318292_1147318310 25 Left 1147318292 17:39631547-39631569 CCCCTCCGCTCCTGCGGAGGTTG 0: 1
1: 0
2: 0
3: 9
4: 78
Right 1147318310 17:39631595-39631617 GCTGGGAAGTGGTTCGGGGGAGG 0: 1
1: 0
2: 2
3: 27
4: 333
1147318292_1147318309 22 Left 1147318292 17:39631547-39631569 CCCCTCCGCTCCTGCGGAGGTTG 0: 1
1: 0
2: 0
3: 9
4: 78
Right 1147318309 17:39631592-39631614 TATGCTGGGAAGTGGTTCGGGGG 0: 1
1: 0
2: 0
3: 10
4: 171
1147318292_1147318311 26 Left 1147318292 17:39631547-39631569 CCCCTCCGCTCCTGCGGAGGTTG 0: 1
1: 0
2: 0
3: 9
4: 78
Right 1147318311 17:39631596-39631618 CTGGGAAGTGGTTCGGGGGAGGG 0: 1
1: 0
2: 1
3: 20
4: 320
1147318292_1147318302 7 Left 1147318292 17:39631547-39631569 CCCCTCCGCTCCTGCGGAGGTTG 0: 1
1: 0
2: 0
3: 9
4: 78
Right 1147318302 17:39631577-39631599 GAGCTACCGGAAGAGTATGCTGG 0: 1
1: 0
2: 0
3: 3
4: 41
1147318292_1147318307 20 Left 1147318292 17:39631547-39631569 CCCCTCCGCTCCTGCGGAGGTTG 0: 1
1: 0
2: 0
3: 9
4: 78
Right 1147318307 17:39631590-39631612 AGTATGCTGGGAAGTGGTTCGGG 0: 1
1: 0
2: 1
3: 15
4: 164
1147318292_1147318305 14 Left 1147318292 17:39631547-39631569 CCCCTCCGCTCCTGCGGAGGTTG 0: 1
1: 0
2: 0
3: 9
4: 78
Right 1147318305 17:39631584-39631606 CGGAAGAGTATGCTGGGAAGTGG 0: 1
1: 0
2: 0
3: 22
4: 246
1147318292_1147318303 8 Left 1147318292 17:39631547-39631569 CCCCTCCGCTCCTGCGGAGGTTG 0: 1
1: 0
2: 0
3: 9
4: 78
Right 1147318303 17:39631578-39631600 AGCTACCGGAAGAGTATGCTGGG 0: 1
1: 0
2: 0
3: 2
4: 50
1147318292_1147318301 -6 Left 1147318292 17:39631547-39631569 CCCCTCCGCTCCTGCGGAGGTTG 0: 1
1: 0
2: 0
3: 9
4: 78
Right 1147318301 17:39631564-39631586 AGGTTGGGAGGGAGAGCTACCGG 0: 1
1: 0
2: 3
3: 43
4: 669

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147318292 Original CRISPR CAACCTCCGCAGGAGCGGAG GGG (reversed) Intronic
900606468 1:3525778-3525800 CACCCTCTGCAGGAACGCAGCGG + Intronic
901197903 1:7450451-7450473 CCACCTCTGCTGGAGGGGAGGGG + Intronic
903259293 1:22122658-22122680 CTGTGTCCGCAGGAGCGGAGGGG + Intronic
906539026 1:46570639-46570661 CAACATCCGCAACAGCAGAGGGG + Intronic
912799942 1:112714443-112714465 CAGCTTCCCCAGGAGCGGGGAGG - Intronic
915277152 1:154797077-154797099 CAGTCTCCGAAGGAGAGGAGAGG + Intronic
917098190 1:171420711-171420733 TAACCACCACAGGACCGGAGTGG - Intergenic
922464374 1:225836737-225836759 CAAACTCAGCAGAAGCAGAGAGG + Intronic
922598881 1:226834889-226834911 CAGCCTCGGGAGGAGGGGAGAGG - Intergenic
1062930659 10:1350370-1350392 CAGCCTGGGGAGGAGCGGAGGGG - Intronic
1064672481 10:17730978-17731000 CCACCTCCCCAGAAGCGGTGGGG + Intergenic
1064797847 10:19033645-19033667 CAGCCTCCGAAGTAGCTGAGTGG - Intergenic
1082761351 11:57130073-57130095 CAACCTCAGCAAGAGGGGTGAGG + Intergenic
1084190800 11:67497877-67497899 CGGCCTCCTCAGGAGCGGAAAGG - Intronic
1084686274 11:70697784-70697806 CCACCTCTGCAGGAGATGAGTGG + Intronic
1085401560 11:76238842-76238864 CAACCCACACAGGAGCGGGGAGG + Intergenic
1089368033 11:117932778-117932800 CAACCTCTGCAGGCCTGGAGTGG - Intergenic
1094840111 12:34339302-34339324 CAACCTGCGCAGCAGGGCAGGGG + Intergenic
1096782817 12:54000752-54000774 CAACCGGCGCGGGAGGGGAGGGG + Intronic
1106079324 13:26487528-26487550 TGACCTCCGCATGAGAGGAGAGG - Intergenic
1107364557 13:39656065-39656087 CAACCTCCGGAAAAGCGAAGGGG + Intronic
1107941498 13:45381627-45381649 CCACCATCGCAGGAGGGGAGGGG - Intergenic
1110432950 13:75446928-75446950 CACCCTCAGCAGGACCTGAGGGG + Intronic
1113273467 13:108701190-108701212 CAATCTACCCAGGAGCGGAGAGG + Intronic
1119433957 14:74585930-74585952 CAACCTGCGCAGGAGCAGTGCGG - Exonic
1121095443 14:91215207-91215229 AAAGCTCAGCAGGAGAGGAGAGG - Intronic
1130392055 15:83465467-83465489 AAACATCCTCAGGAGAGGAGTGG - Intronic
1137568535 16:49549515-49549537 CAACCTCTGGAGGAGAGGAGAGG - Intronic
1137864149 16:51876224-51876246 AAAGCTCTGCAGGAGGGGAGAGG - Intergenic
1138185557 16:54974501-54974523 CAACCTCCCCGGCAGTGGAGGGG - Intergenic
1139440913 16:66966401-66966423 CATCCCCTGCAGGAGCAGAGGGG + Intronic
1142741062 17:1932310-1932332 CAGCCCCGGCAGGAGAGGAGGGG + Intergenic
1144261646 17:13527510-13527532 CCATCACCCCAGGAGCGGAGTGG + Intronic
1144854398 17:18260086-18260108 CATCCTTCGCAGGGGAGGAGGGG + Intergenic
1145000290 17:19300138-19300160 CAATGTCCGGAGAAGCGGAGGGG + Intronic
1146062713 17:29615540-29615562 CAGCCTCCGCTGGAGCGACGTGG + Exonic
1146590706 17:34125978-34126000 CAGCCTCCACTGGAGCGGAGTGG + Intronic
1147318292 17:39631547-39631569 CAACCTCCGCAGGAGCGGAGGGG - Intronic
1148048445 17:44758090-44758112 CAACATCCCCAGGAGCTGGGTGG + Intergenic
1152438008 17:80288039-80288061 CAACCTCGGTGGGCGCGGAGAGG - Exonic
1160901113 19:1429177-1429199 CAGCCTCCTCAGTAGCGGGGTGG + Intronic
1161520273 19:4719976-4719998 CAACCCCAGCAGGTGGGGAGTGG + Intronic
1163472386 19:17505203-17505225 CACTCTCGGCAGGAGAGGAGAGG - Exonic
927517254 2:23679756-23679778 CAGCCTCCGGAGGAGGGCAGAGG + Intronic
928444639 2:31322221-31322243 CATCCTCCCCAGGAGGGAAGAGG + Intergenic
929688606 2:44056109-44056131 GATCGTCCGCAGGAGCAGAGGGG - Intergenic
934503523 2:94875835-94875857 CATCCCCCGCAGGTGCTGAGAGG + Intronic
934921292 2:98347057-98347079 CAACCTCCCCCGGCGCGGCGCGG - Intronic
937954768 2:127416023-127416045 GCTCCTCCGCAGGAGCGGTGCGG + Intergenic
940081919 2:149812693-149812715 TAAGCTCCGGTGGAGCGGAGAGG + Intergenic
941018272 2:160381594-160381616 CAACCTCTTCAGGAGCTGAGTGG + Intronic
1173183455 20:40821405-40821427 AAACCTCCACAGGAGGAGAGGGG - Intergenic
1174444657 20:50582576-50582598 CAACCTCCGAGGGAGCAAAGGGG - Intronic
1176888079 21:14280955-14280977 AAACATCCGCAGGTGTGGAGGGG - Intergenic
1182628002 22:31662362-31662384 CTACCTCCGCAGGTGCCAAGCGG - Intronic
950364127 3:12471213-12471235 CAGCCTCAGCAGGAGCGATGTGG - Intergenic
951078682 3:18425749-18425771 CAGCGTCCGCCGGAGCGGGGAGG + Intronic
955412849 3:58667131-58667153 CAACCTCCCCAGGCGCTGGGAGG + Intergenic
964032941 3:152160402-152160424 CAGCCTAAGCAGGAGTGGAGAGG - Intergenic
967822941 3:193855114-193855136 AAAACTCAGCAGGAGCTGAGGGG - Intergenic
969791595 4:9497207-9497229 CAACCACTGCTGGAGCGCAGTGG - Intergenic
980252466 4:130335557-130335579 CAACATGAGCAGGAGTGGAGAGG + Intergenic
985627289 5:995670-995692 CAACCTCAGCAGGATGGGGGTGG - Intergenic
985823902 5:2178938-2178960 CAGCCTCCCCTGGAGGGGAGAGG + Intergenic
985880053 5:2632625-2632647 CAACCTCTGCAGCAGGGGTGAGG + Intergenic
987306759 5:16644641-16644663 CAACCTCCGCAAGCCTGGAGAGG - Intergenic
991647908 5:68819547-68819569 CAACCTCCTCAAGAGCAGAGAGG + Intergenic
1002304214 5:178273890-178273912 CAACTTCCCCAGGACAGGAGGGG - Intronic
1006375902 6:33671458-33671480 CCACCTCAGCAGGACCAGAGGGG + Intronic
1008932282 6:56954070-56954092 CATCCTTCGCTGGAGCGTAGGGG - Intronic
1013452732 6:110301029-110301051 CAACCTCCACAGGTGCTGAGGGG + Intronic
1013459175 6:110358496-110358518 GCACCTCCGGAGGGGCGGAGAGG - Intergenic
1019514041 7:1431999-1432021 CAGCCTCTGCAGGAGCCGGGCGG + Intronic
1019915910 7:4132390-4132412 CAACCTCCGGAGGAGCCCAACGG + Exonic
1020225901 7:6279739-6279761 CAGCCTCCTGAGGAGCTGAGAGG + Intergenic
1020680651 7:11232773-11232795 CAGCCTCCTCAGTAGGGGAGAGG - Intergenic
1026603346 7:71795133-71795155 CAGCCTCCCGAGTAGCGGAGAGG + Intronic
1027853229 7:83475588-83475610 CACCCCCTGCAGGACCGGAGGGG + Intronic
1035487227 7:159235590-159235612 CCACCTCCGCAGGACAGGTGTGG - Intergenic
1038537116 8:28361132-28361154 TCGCCTCCGCAGGAGAGGAGAGG - Exonic
1039496601 8:37985436-37985458 AGACCTCCCCAGGAGTGGAGGGG - Intergenic
1041108648 8:54466074-54466096 CCACCTCCGCAGAAGAGGAGAGG - Intergenic
1048317217 8:133371199-133371221 CAAGGTCTGCAGGAGCTGAGGGG - Intergenic
1049418466 8:142506177-142506199 CGACCTTGGCAGGAGCCGAGTGG + Intronic
1049734939 8:144199820-144199842 CAAGATCCGCAGGAGGGGTGTGG + Intronic
1053503827 9:38622619-38622641 CACCCTCCGCTGCAGCGGAGTGG - Intergenic
1061034993 9:128108450-128108472 CAACCCCAGCAGGGGCGCAGCGG + Exonic
1203564410 Un_KI270744v1:79720-79742 CATCCCCCGCAGGTGCTGAGAGG + Intergenic