ID: 1147320498

View in Genome Browser
Species Human (GRCh38)
Location 17:39642995-39643017
Sequence CTGGGGAAGCCATTGGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 280}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147320498 Original CRISPR CTGGGGAAGCCATTGGAGGT TGG Intronic
900309088 1:2024800-2024822 CTGTGGGAGCCCTTGCAGGTGGG - Intronic
900325076 1:2104645-2104667 CAGGGGAAGCCAGTGTGGGTGGG + Intronic
900530182 1:3149212-3149234 CAGGGGCAGCCACTGGAGGATGG + Intronic
901137345 1:7006587-7006609 CTGGAGAACCCAGTTGAGGTGGG + Intronic
901600139 1:10417154-10417176 CTGCGGAAGGCAGTGGGGGTGGG + Intronic
902042393 1:13502386-13502408 CTGGGGAAGCAAGTGGGGGCAGG - Intronic
902199393 1:14822507-14822529 CTGGGGAGGGAATTGGAGGCTGG + Intronic
904672932 1:32179747-32179769 GTGGGGAAGCCATCGGACGTCGG + Intronic
905626653 1:39493905-39493927 CAGGGGATGCCAGGGGAGGTCGG - Intronic
905670237 1:39786551-39786573 CAGGGGATGCCAGGGGAGGTCGG + Intronic
907342697 1:53748117-53748139 CTGGGGAACTCCTTGGAGGCAGG + Intergenic
907594833 1:55710122-55710144 CTAGGGAAGCCAATGAATGTGGG + Intergenic
908384269 1:63626130-63626152 CAGGGGAGGCCATTTGAGGATGG + Intronic
912666315 1:111583153-111583175 CAGGGAAAGACATTGGGGGTTGG - Intronic
915322847 1:155065373-155065395 CTGGGGAAGCCAGCACAGGTGGG - Intronic
915839880 1:159205247-159205269 CTGGGGAAGCCAGGGCAGCTGGG - Exonic
917853814 1:179085977-179085999 CTGGAGAAGCCTGGGGAGGTGGG + Intronic
919846649 1:201647180-201647202 CTTGGGAGGCCATTTGAGGATGG + Intronic
920791922 1:209101260-209101282 CTGGGGAAGTGAATGGAGGCTGG - Intergenic
920840803 1:209552038-209552060 ATGTGGAAGGCAGTGGAGGTTGG + Intergenic
922994552 1:229945353-229945375 CTGGGGAGGGCATGGGTGGTTGG - Intergenic
923035761 1:230283994-230284016 CTGGGGAAGGCTGTGGGGGTGGG + Intergenic
1063141813 10:3262579-3262601 CTGGGGAAGGCCATGGAGGGAGG - Intergenic
1063592342 10:7407244-7407266 CTGGGGAGGCTGTTGGGGGTGGG - Intronic
1065846865 10:29751733-29751755 TGGGGGAATGCATTGGAGGTAGG + Intergenic
1066194078 10:33081632-33081654 GTGGGGAGGCCCTTGGTGGTGGG + Intergenic
1067109542 10:43390456-43390478 ATGGTGAAATCATTGGAGGTAGG - Intronic
1069184691 10:65408811-65408833 CTGGGGTAGAGATAGGAGGTGGG + Intergenic
1070680784 10:78447729-78447751 CTGGGGATGCTAATTGAGGTTGG - Intergenic
1071549704 10:86557173-86557195 CAGGGGAAGCCAGAGGAGGAAGG + Intergenic
1072824316 10:98590685-98590707 GTGGGAAAGCTATTGGAAGTTGG - Intronic
1073388867 10:103154874-103154896 CTAGGGAATCCATGGGAAGTTGG - Intronic
1073472740 10:103733202-103733224 CTGGGGGAGCCATTGAAGTGGGG - Intronic
1074894593 10:117763970-117763992 ATGGGAAAGTAATTGGAGGTGGG - Intergenic
1075120275 10:119659543-119659565 CTTGAGAAGCCACTGCAGGTGGG + Intronic
1075926877 10:126258533-126258555 CAGGGGAAGCCACTGAAGGTTGG - Intronic
1077095940 11:799136-799158 ATGGAGAAGCCGTTGGAGGGCGG - Exonic
1077877168 11:6318904-6318926 ATGGGGAAGCGGTTGGATGTGGG - Intergenic
1077996436 11:7456447-7456469 ATGGGGAAGACACTGGAGGGAGG - Intronic
1080524311 11:33098851-33098873 ATGGAGATGCCATTGGGGGTGGG - Intronic
1081722591 11:45301285-45301307 CCAGGGAAGCCAATGGATGTGGG - Intergenic
1082028606 11:47589567-47589589 CCGGGGAAGGGGTTGGAGGTTGG - Intergenic
1082872903 11:57960184-57960206 CTGAGGAAGCAAAGGGAGGTGGG - Intergenic
1083844327 11:65322026-65322048 GTGGGGAAGGGATTGGAGCTAGG - Exonic
1085696598 11:78710092-78710114 CTGGGGAAGGCAGTGGAAGAAGG + Intronic
1086139162 11:83475151-83475173 GTGGGGAAACCCGTGGAGGTGGG + Intronic
1087258695 11:95986127-95986149 GTGGGGAAAGCATAGGAGGTAGG + Intronic
1089113764 11:116077869-116077891 CTGGGGAAGCCAGTGAGGGGTGG + Intergenic
1090312044 11:125749566-125749588 CTGAGGAAGCCATTTGAGTCTGG + Exonic
1091069284 11:132548183-132548205 CTGGGGAAGGCATAGGAGCTTGG + Intronic
1091566812 12:1654901-1654923 CTGGGAAAGCCAGTGGAGAGAGG - Intergenic
1091858435 12:3757423-3757445 CTGGCGAAGCTCTGGGAGGTGGG - Intronic
1092024064 12:5226072-5226094 CTGGGAAAGCTAGTGGAAGTTGG + Intergenic
1093280881 12:17195114-17195136 TTAGTGATGCCATTGGAGGTAGG + Intergenic
1094502464 12:31033515-31033537 CTGGGGAAGACTGGGGAGGTAGG + Intergenic
1096461064 12:51821653-51821675 GTGGGGAAGCCATAGGCGGTGGG + Intergenic
1098160865 12:67648010-67648032 CTGGGGAAGCAGTTGGCTGTGGG - Intergenic
1098252417 12:68584126-68584148 GTGCGGAAGACATTGAAGGTTGG - Intergenic
1098880208 12:75909480-75909502 CTGAGGAGGCCATGGGAGGATGG + Intergenic
1100288186 12:93187576-93187598 GTGGGGCAGCCATGGGATGTGGG - Intergenic
1101837188 12:108303841-108303863 CAGGAGAAGCCTTTGGAGGCGGG + Intronic
1102148038 12:110669420-110669442 CTGGGGAAGCCAAGAGAGCTGGG - Intronic
1104958457 12:132477081-132477103 CTGGGGAGGCCAGTGGAGCCGGG - Intergenic
1106770572 13:32957514-32957536 CTGGGGGTACCATTGCAGGTTGG + Intergenic
1110139257 13:72107187-72107209 CTGGGGAAAGGATGGGAGGTGGG - Intergenic
1110879563 13:80555114-80555136 CTGTGTAAGCCATAGGAGGCAGG - Intergenic
1111292956 13:86191124-86191146 CTGGGAAAGGCAGTGGAGGTTGG + Intergenic
1111432517 13:88162171-88162193 CTGGGGATGGTATTGGAGGTGGG + Intergenic
1112819278 13:103312124-103312146 CTGGGGAACCCATTTGGGCTGGG - Intergenic
1117079934 14:52141440-52141462 GTGAGGAAGACATTGGAGATAGG - Intergenic
1119658889 14:76436694-76436716 CTGGGGACTCCACTGGTGGTTGG + Intronic
1120528737 14:85607360-85607382 CTGGGAAAGCAATTAGAGTTAGG + Intronic
1121211405 14:92210455-92210477 CTAGAGAACCCATTGCAGGTTGG + Intergenic
1121501225 14:94439962-94439984 CTTGGGAAGCCAGTTGAGGCAGG - Intergenic
1121660723 14:95633066-95633088 CAGAGGAAGCCATGGGAGGCAGG + Intergenic
1122193669 14:100068416-100068438 TAGGGGAAGCCTTTGGAGGGAGG + Intronic
1122363273 14:101180018-101180040 CTGGTGTGGCCAGTGGAGGTGGG - Intergenic
1123044419 14:105504251-105504273 CTGGTGGAGCCCTGGGAGGTGGG + Intergenic
1125293958 15:38182289-38182311 CTGGCGAAGCCATTTGGGCTTGG - Intergenic
1126675286 15:51155465-51155487 CTGGGGAAGGAATTGGGGGCCGG + Intergenic
1129742296 15:77995167-77995189 CCGGGGAAGTCCTTGCAGGTGGG - Exonic
1129843186 15:78756313-78756335 CCGGGGAAGTCCTTGCAGGTGGG + Intergenic
1130200942 15:81826323-81826345 CTGGGGAAAGCCTTGGAGGGAGG - Intergenic
1130305160 15:82708582-82708604 GTGGAGAAGAGATTGGAGGTGGG - Intronic
1133102841 16:3489627-3489649 CTGAGGAAGCCATGGAAGGAAGG - Intergenic
1133343697 16:5055714-5055736 CTGGGGCAGCCTTTGGGGGCAGG + Intronic
1133494119 16:6299853-6299875 CTAGTGAAGCCATCTGAGGTTGG - Intronic
1134381580 16:13732149-13732171 CTTGGGCAGAAATTGGAGGTGGG - Intergenic
1135138642 16:19903318-19903340 CAGGGGAAGGCCTTGGAGGGTGG + Intergenic
1135700992 16:24632329-24632351 TTGGGAAAGATATTGGAGGTTGG - Intergenic
1138626546 16:58256467-58256489 ATGGGCAAGGCAGTGGAGGTGGG + Intronic
1139339580 16:66259366-66259388 CTGGGGCTGCCCATGGAGGTTGG - Intergenic
1141526805 16:84617263-84617285 CTGGAGAAGGCATTGTAGGATGG + Intronic
1142376467 16:89709349-89709371 GTGGGGATGCCAATGGCGGTGGG + Exonic
1142378323 16:89718043-89718065 CAGGGGGAGCCACTGGACGTGGG - Intronic
1142641565 17:1288550-1288572 ATGGGGAACCCATTGGGGATGGG - Intronic
1144828061 17:18117609-18117631 CTGGGCAGGCCAGCGGAGGTGGG - Intronic
1145018790 17:19414709-19414731 GTGGGGAAGACATGGGAGGCTGG + Intronic
1145909553 17:28534647-28534669 CTGGGGAAGACTGTGGAGGAGGG + Intronic
1146089779 17:29865072-29865094 CTGGAGAAGTCATTGGAATTTGG - Intronic
1146477068 17:33171618-33171640 TTGGAGAACACATTGGAGGTAGG - Intronic
1147320498 17:39642995-39643017 CTGGGGAAGCCATTGGAGGTTGG + Intronic
1149228926 17:54509519-54509541 CTGGGGGAGCCATAGGAAATAGG - Intergenic
1152091240 17:78249073-78249095 CTGGGGAAGCCCTCGGTGGACGG - Intergenic
1152205066 17:78970223-78970245 CTGGGGGACCCATTGGATGCCGG - Intergenic
1152390753 17:80002421-80002443 CCAGGGAAGCCATGTGAGGTGGG + Intronic
1153168215 18:2285849-2285871 CCTGGGAGGCCAGTGGAGGTAGG + Intergenic
1154112361 18:11580870-11580892 CCGATGAAGCCATTGGAGGTTGG + Intergenic
1156467392 18:37356491-37356513 CTGGGAAGGCCATTGGTGCTGGG + Intronic
1156505393 18:37587380-37587402 CTGGGAAAGCCATTCTAGGTGGG + Intergenic
1156991595 18:43415194-43415216 CATGGGAAGCCTATGGAGGTGGG + Intergenic
1157232891 18:45935782-45935804 CTGTGGAAGCCTTTGAATGTGGG - Intronic
1157964084 18:52188590-52188612 TTGGGGGAGCTATTGTAGGTAGG - Intergenic
1158893206 18:61892592-61892614 TTGAAGAAGCCATTGGAGGTAGG - Intronic
1159667750 18:71183747-71183769 CTGAGGAAACCACTGGAAGTTGG - Intergenic
1161585172 19:5101939-5101961 CTGGGGAGGCCAGAGAAGGTGGG - Intronic
1163170443 19:15527395-15527417 TTGGGAAAGGCCTTGGAGGTGGG - Intronic
1163192079 19:15684615-15684637 TGGGGGAAGCCCTTGGAGTTGGG + Intronic
1163509375 19:17726072-17726094 CTGAGGAAGCCCCCGGAGGTCGG - Exonic
1163633113 19:18426959-18426981 CTGGGGATGAGTTTGGAGGTGGG + Intronic
1164696970 19:30252414-30252436 CTGGAGAAGCCTCTGGAGGTTGG + Intronic
1164733504 19:30523566-30523588 ATGGAGAAGCCTTTGGAGATAGG + Intronic
1165309381 19:35021344-35021366 CCAGGGAAGCCATGGGGGGTAGG + Intronic
1166317301 19:41996355-41996377 ATGGGGAAGCCTGGGGAGGTGGG + Intronic
1166742311 19:45121902-45121924 CTGGGGAAGGGCTTGGAGGCGGG + Intronic
1166912662 19:46171126-46171148 CTGGGGAAGACATCACAGGTCGG - Intergenic
1166947333 19:46405096-46405118 CTGGGGAACCCGTTGGCGGTAGG - Intergenic
1167108560 19:47445723-47445745 CTGGGGAAGCCATGTGGGGGAGG + Intronic
925048585 2:793528-793550 CTGGGGAAGGCCTTGGAAGGAGG - Intergenic
925627135 2:5852756-5852778 ATGGGGAGGCCATTGATGGTTGG - Intergenic
926121653 2:10244297-10244319 CTGGGGAAGCCTCAGTAGGTAGG - Intergenic
927335534 2:21919262-21919284 CTGGGAAAGCCAGTGGGTGTGGG - Intergenic
929148769 2:38729591-38729613 CTGAGAAAGCCAGTGGAGCTTGG + Exonic
929499560 2:42478679-42478701 CTGTGGAAGGCAGTGCAGGTGGG - Intronic
934768060 2:96891711-96891733 CTGAGGCAGCCAGAGGAGGTGGG + Intronic
934854104 2:97718392-97718414 CTGGGGAGGCCAGAGAAGGTGGG - Intronic
937223192 2:120353671-120353693 GTGGGGGAGGCATTTGAGGTGGG - Intergenic
937403427 2:121605825-121605847 GTGGGGAAACGATTGCAGGTTGG - Exonic
937814947 2:126240953-126240975 CTGGAGAAGGCATTAGTGGTGGG - Intergenic
939859137 2:147396848-147396870 CCTGGGAAGCCCCTGGAGGTAGG - Intergenic
940886534 2:158994511-158994533 TTGGGGAAGCCAAGGGAGGAAGG - Intronic
941361521 2:164557562-164557584 CTGGCTAACCCATTGTAGGTAGG - Intronic
943592280 2:189813220-189813242 CTTTGGAAACCATTGGATGTTGG + Intronic
947525012 2:230872343-230872365 CGGGGGAAGGCATAGGAGGTAGG + Intronic
948077459 2:235176399-235176421 AATGGGAAGCCATTGGAGGTAGG + Intergenic
948989283 2:241544025-241544047 CTGGGGAACACATTGGAAGCTGG - Intergenic
949055404 2:241925483-241925505 CTGGTGCAGCCATGGGAGGAAGG - Intergenic
1170769923 20:19323632-19323654 CTGGTGAACCCACTGGATGTGGG - Intronic
1172093646 20:32450280-32450302 CTGGGGAGGCCAGTGGGGCTGGG + Intronic
1174188457 20:48723271-48723293 CTGGAGAAGCCAGAGGGGGTGGG + Intronic
1174845839 20:53942377-53942399 TTGGGGAAGCCATTGGTGGGAGG - Intronic
1174875363 20:54221821-54221843 ATGGAAAAGCCATTTGAGGTAGG + Intronic
1175100589 20:56576120-56576142 CTGGGGGTGGCACTGGAGGTGGG - Intergenic
1175110868 20:56646913-56646935 ATGGGGAAGCCAGTGGGGTTTGG + Intergenic
1175128731 20:56773243-56773265 CTGGGGCAGGCTTTGGGGGTAGG + Intergenic
1175538706 20:59734498-59734520 CTTGGGAAGCCAATGCAGGAGGG - Intronic
1175744853 20:61449065-61449087 CTGGGGAAGCAGTTGGGGATGGG + Intronic
1176025449 20:62983155-62983177 CGGGGGATGCCATTGTAGGAAGG - Intergenic
1176299904 21:5094699-5094721 CTGGGGCACCCAGTGGAGGCCGG - Intergenic
1178772876 21:35521785-35521807 CCGGGGAAGCGATTGGAGAGAGG + Intronic
1178831673 21:36061622-36061644 CTGGGGAAGGCCTTGAAGGAAGG - Intronic
1179605314 21:42512507-42512529 CTGGGGAGACCATTGGAGAGAGG + Intronic
1179857118 21:44167212-44167234 CTGGGGCACCCAGTGGAGGCCGG + Intergenic
1180626918 22:17199618-17199640 CTGGGATCGCCATTTGAGGTGGG + Intronic
1181235629 22:21446231-21446253 CTGGGGAAGCCCTTGGCGCAGGG - Exonic
1181568530 22:23753719-23753741 CAGGGGAAGCTATTGTGGGTTGG - Intronic
1182251500 22:29004669-29004691 CAGGGGAAGCCACTGGGGGAGGG - Intronic
1182480930 22:30608238-30608260 CTGGGGAAACCCTGAGAGGTGGG + Intronic
1183511018 22:38235049-38235071 CTCCGGTAGTCATTGGAGGTAGG - Intronic
1183743782 22:39681984-39682006 CTCAGCAAGTCATTGGAGGTCGG + Intronic
1184256990 22:43292966-43292988 CTGGGGAAGCCTGGGGAGGAGGG + Intronic
1184777976 22:46632789-46632811 CTGGAGCAGCCATTGGAGACAGG + Intronic
1184995044 22:48199270-48199292 CTGGGGAAGACAGTGGAAGAGGG + Intergenic
949233041 3:1773976-1773998 CTGGGGCAGCCATTGGAAGTTGG - Intergenic
950171327 3:10840894-10840916 CTTGAAAAGCCATTGAAGGTAGG + Intronic
950246728 3:11427392-11427414 CTGGGGAAGCCATTTCATGGTGG - Intronic
950551476 3:13668786-13668808 CTGAGGAAGCCATGGTAGGCAGG - Intergenic
950880321 3:16317822-16317844 CTGGGGCAGTCATTGGTTGTAGG - Intronic
954385127 3:50240144-50240166 CTGGGGCAGCCACTGGAGCCTGG + Intronic
954810385 3:53243787-53243809 CCGGGGCTGCCCTTGGAGGTGGG - Intronic
954902352 3:54030827-54030849 GTGGGGAAGCCATTGTGGCTGGG - Intergenic
955122923 3:56079579-56079601 CAATGGAAGCCAATGGAGGTGGG + Intronic
956114120 3:65901492-65901514 AAGGGGAAGCAATTGGAAGTTGG + Intronic
959376664 3:105596060-105596082 ATGGGGAAGGCATTAGAGGTAGG - Intergenic
960036766 3:113109949-113109971 CTGGGGCAGTTAATGGAGGTGGG + Intergenic
960458175 3:117899556-117899578 CTGGGAAAGCCATAGGATGGAGG - Intergenic
961035149 3:123636793-123636815 CTGGGGAAGGCTGTGGTGGTGGG + Intronic
961346041 3:126263974-126263996 CTGGGGAAGCGGTAGGATGTTGG + Intergenic
961480476 3:127176296-127176318 CTGGGAGAGCCATTGGTGCTGGG - Intergenic
963062521 3:141235920-141235942 CTGGGGAAGCCACTGGCTTTTGG + Intronic
969239440 4:5889082-5889104 GTGGGGAAGGCATTGGAGATGGG - Intronic
972649799 4:41005624-41005646 CTTAGGAAGCAACTGGAGGTAGG - Intronic
977547469 4:98400983-98401005 CTCTGGAAGCCACTGGAAGTTGG + Intronic
981600848 4:146486988-146487010 CTGAGGAAGCAATTGCAGTTTGG - Intronic
982296310 4:153833197-153833219 CTGGGGAGGCCAAGGCAGGTGGG + Intergenic
982379335 4:154732939-154732961 CTGGGGAAGGAATGAGAGGTAGG - Intronic
985493760 5:193365-193387 CTGGGGAAGCACCTAGAGGTGGG + Intronic
988302265 5:29446580-29446602 GTGGGGAAGAGATTGGAGGAAGG + Intergenic
988442578 5:31249669-31249691 CAGAGGAAGCCAGTGGAGGTTGG - Intronic
989380388 5:40804407-40804429 TTGGGGAAGGCATTCCAGGTAGG + Intergenic
989568413 5:42924044-42924066 CTGGCGAAGCCATGTGAGGGGGG + Intergenic
990058620 5:51618415-51618437 CTGGGGAGGGCAGTGGAGGCAGG + Intergenic
991633312 5:68678858-68678880 CTGGCCAAGACTTTGGAGGTCGG + Intergenic
993462737 5:88204465-88204487 CTGGGTAAACCATCGGATGTGGG + Intronic
995169528 5:109091238-109091260 CTGGGGAACCCATTGGACCTTGG + Intronic
996115040 5:119608975-119608997 CTGGGGACTCCACTGGGGGTGGG - Intronic
997020196 5:129991207-129991229 GTGGGGAATTCATTGGAGGAAGG + Intronic
997672018 5:135683037-135683059 CTGGAGAAGCCTCTGGAGGGTGG + Intergenic
998410024 5:141902825-141902847 CTGGGGGAGCCAGGGGAAGTAGG + Intergenic
999250348 5:150178706-150178728 CTGGAGAGGGCACTGGAGGTTGG - Intronic
1000434891 5:161196274-161196296 CATGGGAAGCCATTGGAGGATGG - Intergenic
1000535414 5:162472300-162472322 CTGGGGAAGTCATTGGGCATAGG + Intergenic
1001535459 5:172494898-172494920 CTGGGGAAGCCAGTGCAGACTGG + Intergenic
1001940331 5:175735570-175735592 TTGGGGAAGACATTGGTGCTGGG + Intergenic
1002860251 6:1073799-1073821 CTGGAGGTGCCATTGCAGGTAGG + Intergenic
1003660135 6:8052546-8052568 CTGAGGAAGCCATTATAGATGGG + Intronic
1003978474 6:11366549-11366571 ATGGGATAGCCATTAGAGGTTGG + Intronic
1005419227 6:25631727-25631749 CTGGTGGAGCCATTGAATGTTGG + Intergenic
1007772492 6:44202671-44202693 CTGGGGCAGGCAAGGGAGGTGGG + Intergenic
1008553255 6:52653499-52653521 CTGGGAAAGACTTTGGAGGAAGG - Intergenic
1011055266 6:83197385-83197407 CTGGTGAAGCCTGTGGAGCTTGG - Exonic
1011275544 6:85628025-85628047 ATGTGGAAGGCTTTGGAGGTAGG - Intronic
1011327673 6:86168199-86168221 CTGGGGAAGCCAAGGCGGGTGGG + Intergenic
1014861800 6:126478035-126478057 CTGGTGAAGCCAGAGGAAGTTGG - Intergenic
1018924125 6:168194767-168194789 CTGAGGATGCCATGGCAGGTGGG - Intergenic
1019736155 7:2650712-2650734 AGGGGGAGGCCATTGGAGGGAGG + Intronic
1019772591 7:2893097-2893119 GTGGGGATGCCATTGGTGGAGGG + Intergenic
1019860435 7:3653538-3653560 CAGGAGAAGCCAGTGGAGGAAGG + Intronic
1020093161 7:5352677-5352699 CTGGGGAAGCCAGCAGTGGTGGG - Intronic
1020378439 7:7514760-7514782 CTGTGGAAGGAGTTGGAGGTGGG - Intronic
1020765626 7:12316556-12316578 CTGGGGAAGGTAATGGGGGTGGG + Intergenic
1022469322 7:30672491-30672513 CTTGGGAACTCATTGAAGGTAGG + Intronic
1024222998 7:47303039-47303061 CTGGAGAAGCCACTGGAGGAGGG + Exonic
1024663375 7:51520819-51520841 ATGGGGAGGCTCTTGGAGGTTGG + Intergenic
1024776109 7:52788151-52788173 ATGGAGTAGCCATTGGAGGGTGG - Intergenic
1025121499 7:56307814-56307836 CTGGTGATGCCATTGGAGATAGG - Intergenic
1026944879 7:74309231-74309253 TTGGGGAGGCCAATGCAGGTGGG + Intronic
1027006777 7:74701086-74701108 CTGTGGATGTTATTGGAGGTTGG + Intronic
1027184874 7:75965075-75965097 CTGGGGAAGCCTGTGTAGGATGG + Intronic
1028902728 7:96119076-96119098 CCCAGGAAGCCAATGGAGGTAGG - Intergenic
1029388909 7:100261593-100261615 CTGGGGACTCCAATAGAGGTTGG + Intronic
1029920249 7:104254823-104254845 GTGGGGAGGCCATTGCAAGTGGG - Intergenic
1030742986 7:113131689-113131711 CTTGGCAACTCATTGGAGGTGGG + Intergenic
1031547434 7:123068009-123068031 CTGGGGGCGCCAGTGGTGGTGGG + Intergenic
1031894652 7:127335294-127335316 CTGGGGAAGGAATAGGGGGTGGG + Intergenic
1032156661 7:129475175-129475197 CTGGAGAAGGCAGTGGATGTGGG + Intronic
1032337825 7:131042796-131042818 CTGGGGAAGGCCTTGCAGGAGGG - Intergenic
1032460243 7:132104856-132104878 GTGGGGAAGCCACTGGTGGAGGG + Intergenic
1033420987 7:141204408-141204430 CTTGGGAAGGGAGTGGAGGTAGG + Intronic
1034472813 7:151264685-151264707 CTGGGGAGCCCAGTGGAGCTGGG + Intronic
1036307757 8:7614284-7614306 CTGGGGTAGCCATAGCAGGGAGG - Intergenic
1036358611 8:8062285-8062307 CTGGGGTAGCCATAGCAGGGAGG - Intergenic
1036727916 8:11236631-11236653 CAGAGGGAGCCATTGGAGGCCGG - Intergenic
1036892349 8:12604667-12604689 CTGGGGTAGCCATAGCAGGGAGG + Intergenic
1036899893 8:12662643-12662665 CTGGGGTAGCCATAGCAGGGAGG + Intergenic
1036993658 8:13629810-13629832 CTGGGTGACCCATTGGAGGAAGG + Intergenic
1037624596 8:20595948-20595970 CTGGGGAAGGCCCTGGAGCTGGG - Intergenic
1038976752 8:32705913-32705935 ATGGGGAAGCCTTGGTAGGTTGG - Intronic
1039588916 8:38730228-38730250 CTAGGGAACCCGCTGGAGGTGGG + Intronic
1039947957 8:42146225-42146247 CTGGGGAAAACAGTTGAGGTTGG + Intergenic
1041237249 8:55816690-55816712 CTGGGGAAGCCATGGAAGGGTGG - Intronic
1041785066 8:61622676-61622698 AGGTGGAAGCCATTGGAGGGAGG - Intronic
1043695118 8:83208092-83208114 CTGGAGCAGGCACTGGAGGTAGG - Intergenic
1044340782 8:91044299-91044321 CTGAGAAAGCCATTGATGGTGGG - Intergenic
1044613813 8:94119716-94119738 CTGGGGCAGGCATTGGGAGTGGG - Intergenic
1044893806 8:96866060-96866082 CTGTGGCAGGCAATGGAGGTAGG - Intronic
1047219740 8:122909886-122909908 CTGGGGCAGCCAATGAAGGCAGG - Intronic
1047581883 8:126224766-126224788 CTTGGGAAATCATTGGAGGCAGG + Intergenic
1047968606 8:130065748-130065770 CTGGAGAAGCCAGTGTGGGTAGG + Intronic
1048921520 8:139235557-139235579 CTGGGGAAGCCCATGGAGAAAGG + Intergenic
1049420646 8:142515074-142515096 CAGGAGAAGCCATTGGTGGGAGG + Intronic
1049662281 8:143824820-143824842 CTGTGGAAGGCACTGGAGCTGGG - Intronic
1051544436 9:18258606-18258628 CTGGAGAAGGCACTGGCGGTGGG - Intergenic
1053141872 9:35687668-35687690 CTGGGGACAGCATTGGGGGTTGG + Intronic
1053444072 9:38137980-38138002 CAGGGGGAGCCATAGGAGGCAGG + Intergenic
1055036585 9:71824519-71824541 CAGAGGAAGAGATTGGAGGTGGG + Intergenic
1056385917 9:86097535-86097557 CTGGGGTGGCCATTGGGGGCGGG - Intronic
1056647305 9:88425064-88425086 TTGGGGGAGCTATTGGTGGTAGG + Intronic
1057859590 9:98629492-98629514 ATGTTGAAGCTATTGGAGGTAGG - Intronic
1058726010 9:107804893-107804915 CTGGAAAAGACAGTGGAGGTGGG - Intergenic
1058892297 9:109371369-109371391 TTGGAGAAGCCTTTGGAGGTAGG + Intergenic
1060279832 9:122208347-122208369 CAGGGGAAGCCATGGGAGCTGGG - Intronic
1061045068 9:128160429-128160451 CTGGGGATGCCGGTGGAGGCGGG + Exonic
1061329955 9:129886021-129886043 CTGGGGAAGCCTCTTGAAGTAGG - Intergenic
1203736813 Un_GL000216v2:144831-144853 CGGGGGAAGGCAGTGGGGGTGGG - Intergenic
1187127000 X:16463231-16463253 CTGGGCAAGCCAGAGGAGTTGGG - Intergenic
1188565182 X:31518888-31518910 ATGGGGAAGACACTGGAGCTTGG - Intronic
1188980352 X:36721583-36721605 CAGGAGAAGCCATAGTAGGTGGG + Intergenic
1189083257 X:37995910-37995932 CAGGAGAAGCCATAGTAGGTGGG + Intronic
1189504277 X:41595355-41595377 TTGGGGAGGCCATACGAGGTAGG + Intronic
1190067032 X:47248515-47248537 CTGGGCATGCCATTGGTGCTTGG - Intergenic
1190825538 X:54014771-54014793 CTGGAGAAGCCTGTGGAGCTTGG - Intronic
1191153842 X:57249808-57249830 CTGCTGAAGCCATTGAAGGAAGG + Intergenic
1192435264 X:71139421-71139443 CTGGGGAAGTCACTGGGGCTAGG + Intronic
1192491410 X:71579515-71579537 CTGGTGGTGGCATTGGAGGTGGG + Intronic
1195211308 X:102653966-102653988 CTGGGGAAGAGGTTGTAGGTGGG + Exonic
1195585095 X:106555990-106556012 CAGGGGAAGTCAGGGGAGGTAGG + Intergenic
1196807026 X:119597433-119597455 CTGGGGAAGGCTCTGAAGGTAGG - Intronic
1197186583 X:123593832-123593854 CTAGGAAAGCCCTGGGAGGTTGG - Intergenic
1197522786 X:127520304-127520326 CTGGGAGACCCATTGCAGGTTGG - Intergenic
1198087503 X:133294596-133294618 CTGAGGTGGCCATTGGAGCTAGG - Intergenic
1198531225 X:137550847-137550869 GTGGGGAGGGGATTGGAGGTTGG - Intergenic
1198841743 X:140864950-140864972 CTTGGCAAGCCTTTGGAGATGGG - Intergenic
1200060066 X:153480172-153480194 CTGGGGAAGTGAGGGGAGGTGGG + Intronic
1200827164 Y:7657639-7657661 CTGGGAAAGTCCTTGGAGGAAGG + Intergenic
1200909421 Y:8517064-8517086 CTGGGAAAGTCCTTGGAGGAAGG - Intergenic