ID: 1147322776

View in Genome Browser
Species Human (GRCh38)
Location 17:39656284-39656306
Sequence GTGGCTGGTGCCCCACCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 197}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147322762_1147322776 22 Left 1147322762 17:39656239-39656261 CCTGGGCTCCATCGCCCAGAGTC 0: 1
1: 0
2: 1
3: 14
4: 157
Right 1147322776 17:39656284-39656306 GTGGCTGGTGCCCCACCTGAAGG 0: 1
1: 0
2: 1
3: 9
4: 197
1147322768_1147322776 -1 Left 1147322768 17:39656262-39656284 CCTGTGTCCTCCCTTCTCCAGGG 0: 1
1: 0
2: 1
3: 54
4: 482
Right 1147322776 17:39656284-39656306 GTGGCTGGTGCCCCACCTGAAGG 0: 1
1: 0
2: 1
3: 9
4: 197
1147322764_1147322776 8 Left 1147322764 17:39656253-39656275 CCCAGAGTCCCTGTGTCCTCCCT 0: 2
1: 1
2: 3
3: 39
4: 467
Right 1147322776 17:39656284-39656306 GTGGCTGGTGCCCCACCTGAAGG 0: 1
1: 0
2: 1
3: 9
4: 197
1147322766_1147322776 0 Left 1147322766 17:39656261-39656283 CCCTGTGTCCTCCCTTCTCCAGG 0: 1
1: 0
2: 2
3: 65
4: 628
Right 1147322776 17:39656284-39656306 GTGGCTGGTGCCCCACCTGAAGG 0: 1
1: 0
2: 1
3: 9
4: 197
1147322771_1147322776 -8 Left 1147322771 17:39656269-39656291 CCTCCCTTCTCCAGGGTGGCTGG 0: 1
1: 0
2: 4
3: 43
4: 399
Right 1147322776 17:39656284-39656306 GTGGCTGGTGCCCCACCTGAAGG 0: 1
1: 0
2: 1
3: 9
4: 197
1147322763_1147322776 14 Left 1147322763 17:39656247-39656269 CCATCGCCCAGAGTCCCTGTGTC 0: 1
1: 0
2: 1
3: 15
4: 203
Right 1147322776 17:39656284-39656306 GTGGCTGGTGCCCCACCTGAAGG 0: 1
1: 0
2: 1
3: 9
4: 197
1147322761_1147322776 30 Left 1147322761 17:39656231-39656253 CCAGGGCTCCTGGGCTCCATCGC 0: 1
1: 2
2: 2
3: 52
4: 391
Right 1147322776 17:39656284-39656306 GTGGCTGGTGCCCCACCTGAAGG 0: 1
1: 0
2: 1
3: 9
4: 197
1147322765_1147322776 7 Left 1147322765 17:39656254-39656276 CCAGAGTCCCTGTGTCCTCCCTT 0: 1
1: 1
2: 8
3: 38
4: 535
Right 1147322776 17:39656284-39656306 GTGGCTGGTGCCCCACCTGAAGG 0: 1
1: 0
2: 1
3: 9
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147322776 Original CRISPR GTGGCTGGTGCCCCACCTGA AGG Intronic
900374058 1:2345316-2345338 GTGGCTGCTGCCCCAGCGGGTGG - Intronic
903557334 1:24203238-24203260 GAGGCTGCTCCCCCACCTGCTGG - Intergenic
904382190 1:30119133-30119155 GTGGCCGGTGGCCCGCCTGGGGG + Intergenic
904858543 1:33518059-33518081 TTGGCTGGTGGCCCACTTGGCGG + Intronic
914944578 1:152052736-152052758 ATGGCTTGTGCGCCACCTGGTGG - Intergenic
915288309 1:154866885-154866907 GGGGCAGGTGCCACCCCTGAGGG - Intronic
915565151 1:156708818-156708840 GTGGCTGGTCTTACACCTGAAGG + Intergenic
916075181 1:161196541-161196563 CTGACTGGGGCCTCACCTGACGG + Exonic
917298641 1:173549473-173549495 GTGGCTGTTGCCCCATCATATGG - Intronic
918004057 1:180525176-180525198 GTGGCTGGTTCATCATCTGAGGG + Intergenic
921199409 1:212791058-212791080 GTGGCTAGTGGCTCACCTGTTGG - Intronic
924193228 1:241578087-241578109 GTGACTGCCGCCCCACATGAGGG - Intronic
924590604 1:245400550-245400572 GTGGCTGGTGGCCCCCATGCTGG - Intronic
924650135 1:245918480-245918502 GTGGCTGTTGTCTCAGCTGAAGG - Intronic
1066409286 10:35150483-35150505 GTGGCTGTCGCCCAGCCTGAAGG - Intronic
1069842966 10:71351483-71351505 GGGGCTGGTGAGCCACCTTAAGG - Intronic
1073711874 10:106052639-106052661 GTGGCCTGTTCCCCACCTGTTGG - Intergenic
1076798217 10:132808989-132809011 GTGGCAGCTGCTCCAACTGAGGG + Intronic
1076854063 10:133106614-133106636 ATGGCTGGTGCCCTTCCTGGGGG - Intronic
1076871318 10:133196359-133196381 TTGGCTCCTGCCCCACCTGCTGG - Intronic
1077378612 11:2217466-2217488 GTGCCTGGAGTCCCACCTGCTGG + Intergenic
1077412373 11:2409670-2409692 GTGGCTGGGGTTCAACCTGAAGG + Intronic
1077918629 11:6626773-6626795 ATGGCTGGGGACCCACCTGGGGG + Exonic
1079478419 11:20856284-20856306 GTGCCTGGACCCACACCTGAGGG + Intronic
1080109961 11:28555537-28555559 GTGGCTGGAGCTCCAGCTGGAGG + Intergenic
1081589090 11:44408482-44408504 CTGTCGGGTCCCCCACCTGATGG + Intergenic
1083644593 11:64165196-64165218 GGGGCTGGCGTCCCACCTGGTGG - Intronic
1084333362 11:68442954-68442976 GTGGCTGGGCCCCCACTGGAGGG + Intronic
1085085299 11:73662628-73662650 GAGACTGGTGGACCACCTGAGGG - Exonic
1089297418 11:117478384-117478406 GTGGCCTGTGCCCAACCTCAGGG + Intronic
1089505407 11:118958802-118958824 GGGGCTGGTGCCCCATGTGGAGG + Intergenic
1092296854 12:7207727-7207749 TTGGCAGGTCCCCCTCCTGAAGG - Exonic
1093029162 12:14272182-14272204 GTGGGAGCTGTCCCACCTGAGGG + Intergenic
1098924776 12:76337357-76337379 GTGGCTGGGGCCCAACGTGAAGG + Intergenic
1100329195 12:93569743-93569765 TTGCCTGGTGCCCCCCCTGCCGG - Intergenic
1102034466 12:109762890-109762912 GAGGCTCATGCCCCACCTGAAGG + Intronic
1103988081 12:124780510-124780532 GTGGCTGGTGGTCCCCCTGCAGG - Intronic
1104068823 12:125327626-125327648 TTGGCTGGTGGCCCAGGTGATGG - Intronic
1105943201 13:25169735-25169757 GTTGCTGGTGCACCACGGGATGG + Exonic
1109116773 13:58398479-58398501 GTTGGTGGTCCCCCACCTAAAGG + Intergenic
1111436882 13:88222693-88222715 GAGGCTGGTGGATCACCTGAGGG + Intergenic
1114629676 14:24151091-24151113 GTGAAGGGTGCCCCTCCTGATGG + Intronic
1115219584 14:31046186-31046208 GAGGCTGGTGGATCACCTGAGGG - Intronic
1117020669 14:51567070-51567092 GTAGTTAGTGCCCCATCTGAAGG + Intronic
1119545665 14:75469723-75469745 CTGCCTGGGGCCCCACTTGAAGG + Exonic
1121579941 14:95022115-95022137 GTGGCTGCTGTCTCATCTGAAGG - Intergenic
1121670270 14:95704364-95704386 GTGACTGGTGGCCAACCTGTTGG - Intergenic
1122053597 14:99077104-99077126 CTGACTGGTCCTCCACCTGAAGG + Intergenic
1122252576 14:100450227-100450249 GTGGCTGGAGCCCTATGTGAAGG - Intronic
1122298927 14:100720897-100720919 GGGGCTGGTGCCTCACTGGATGG + Intergenic
1122806716 14:104263449-104263471 TTGGCTCGTTCCCCACCTGAAGG + Intergenic
1122836652 14:104433968-104433990 GTGGCTGGTTCCCCCTCTGGAGG - Intergenic
1123008236 14:105334642-105334664 GTGGGTAGAGCTCCACCTGAGGG + Intronic
1123983042 15:25621270-25621292 CTGGCTGGTGCCCACCATGATGG - Intergenic
1126060983 15:44782322-44782344 CTAGCTGGAGCACCACCTGAGGG + Intergenic
1129002208 15:72344175-72344197 GTTGCTGGGGCCCCTTCTGAGGG - Intronic
1130354377 15:83116663-83116685 CTGACTGGTGCCCCAGCTCATGG - Intronic
1133326923 16:4947535-4947557 GTCCCTGGGCCCCCACCTGACGG - Intronic
1134492167 16:14703428-14703450 GTGGCTGCTGCCCCATCCCAGGG + Intergenic
1134497548 16:14742550-14742572 GTGGCTGCTGCCCCATCCCAGGG + Intronic
1136069144 16:27777764-27777786 CCGGCTGGGGCCCTACCTGATGG - Exonic
1136096527 16:27960986-27961008 GTGGCCTGTGCCCCTCCAGAAGG - Intronic
1138119219 16:54384794-54384816 GTGGCAGGTGCATCACCTCATGG - Intergenic
1140935280 16:79664399-79664421 GTGGGAGCTGCCCCACCTGCTGG - Intergenic
1141704039 16:85654985-85655007 GTGGGGGATGCCTCACCTGAAGG - Exonic
1143594411 17:7905945-7905967 GTGGCTGGTGCGGGACCTGAGGG + Exonic
1144408939 17:14981114-14981136 GTGGGTGCTGTCCCACCTCAGGG - Intergenic
1146940998 17:36844428-36844450 GTGTCAGGTGCCCTCCCTGAGGG + Intergenic
1147322776 17:39656284-39656306 GTGGCTGGTGCCCCACCTGAAGG + Intronic
1150862230 17:68812418-68812440 GGGGCTGCTGTCCCATCTGAAGG - Intergenic
1151266791 17:72962766-72962788 GAGGCGGGTGGACCACCTGAGGG - Intronic
1151895071 17:76974668-76974690 GTGGCTGCCGCCCCACCAGGAGG - Intergenic
1152139943 17:78530327-78530349 ATGGCTGGGGACCCACCTGTTGG + Exonic
1152979316 18:260304-260326 TTGGCTTGTGCTCCACTTGAAGG - Exonic
1153543787 18:6185493-6185515 GTGGCTGAAGTCCCACCGGAGGG + Intronic
1154344646 18:13531886-13531908 GTGGCTGGTGGCCCTGCTGGGGG + Intronic
1154382520 18:13865563-13865585 GTGGCTGGAGCTCCACTTAAGGG - Intergenic
1155148443 18:23103619-23103641 GTAGCTGGTGGCCAACGTGAAGG - Intergenic
1158397986 18:57094745-57094767 GTGGCTGGAGCCCAAGCAGAAGG - Intergenic
1159542013 18:69790131-69790153 GTGCCTGGTGCTTCTCCTGATGG - Intronic
1159662632 18:71117654-71117676 GTGCCTGCTGCCCAACTTGAAGG - Intergenic
1163134203 19:15297682-15297704 GTGGGAGATGCCCCACCTGCTGG + Intronic
1163206944 19:15810566-15810588 GAGGGTTGTGCCCCACCTGTTGG + Intergenic
1163266619 19:16226083-16226105 GTGCCTGGAGCCCCCTCTGAGGG - Intronic
1165397887 19:35577121-35577143 CTGGGTGGTGCCCATCCTGAGGG + Intergenic
1166303997 19:41927700-41927722 GGGGTTGGTGGCCGACCTGAAGG - Intronic
1166785304 19:45363727-45363749 CTGTCTGGGGCCGCACCTGAGGG + Exonic
1167203857 19:48086659-48086681 GCAGCTGGTGCTCCACCTGCTGG + Intronic
1168264869 19:55217180-55217202 GTGGCTGGTGCGGCTCCCGATGG + Intergenic
926715388 2:15920039-15920061 CTGGCAGGTGCCCCCACTGAGGG + Intergenic
926853200 2:17223584-17223606 GAGGCTGCTGCCCCTCCTGTGGG - Intergenic
928850025 2:35734447-35734469 GTGGCAGCTGCCCCTCCTGCTGG - Intergenic
929715073 2:44301830-44301852 GAGGCTGGTGGATCACCTGACGG + Intronic
929941574 2:46337912-46337934 GGGGCTGGTGTGCCAGCTGAGGG + Intronic
931842107 2:66163815-66163837 GTGTCTTGTTCCCAACCTGAGGG - Intergenic
931965747 2:67532167-67532189 GTGGCCTGTGTCCCACCTCAAGG - Intergenic
932399405 2:71469383-71469405 ATGCCTGGGGCCCCACCGGAAGG - Intronic
934686856 2:96327480-96327502 GTGCCTGGTGCACCACCACAGGG + Exonic
935722879 2:105995141-105995163 GTGGCTGGTGTCCAAAGTGAGGG + Intergenic
937460510 2:122081610-122081632 GAGGCTGGCCCACCACCTGAAGG - Intergenic
947178110 2:227387860-227387882 GTGGCAGATGCACCACCTGCAGG - Intergenic
947197960 2:227587414-227587436 GTGGCAGCTGCACCACCTGCAGG - Intergenic
947199128 2:227599056-227599078 GTGGCAGCTGCACCACCTGCAGG + Intergenic
947201006 2:227614715-227614737 GTGGCAGCTGCACCACCTGCAGG - Intronic
947201386 2:227617616-227617638 GTGGCAGCTGCACCACCTGCAGG + Intronic
947206600 2:227666862-227666884 GTGGCAGCTGCACCACCTGCAGG + Intergenic
947212948 2:227724641-227724663 GTGGCAGCTGCACCACCTGCAGG - Intergenic
947213436 2:227728426-227728448 GTGGCAGCTGCACCACCTGCAGG + Intergenic
947215476 2:227746003-227746025 GTGGCAGCTGCACCACCTGCAGG + Intergenic
947965825 2:234280776-234280798 GTGGCAGCTGCCACAGCTGAGGG - Intergenic
948454089 2:238096757-238096779 CTGGCTGGAGCCCCATCTCAGGG + Intronic
1169209189 20:3756194-3756216 GTGGCTGGTGCCAGGCCTGTGGG - Intronic
1169217381 20:3801556-3801578 GTGGCTGGTGCCACAGTGGAGGG + Intronic
1171325687 20:24290346-24290368 CTGCCTGGTGCCCCTCCTCACGG - Intergenic
1172816843 20:37694045-37694067 GTGGCTGGAGCCGCGGCTGACGG + Exonic
1175594252 20:60217961-60217983 GTGGCTGGTGCATCATTTGAGGG - Intergenic
1175995889 20:62812178-62812200 ATGGCTGGGGCCCCTCCTGCTGG - Intronic
1176152060 20:63596521-63596543 GTGGCTGGTGGCACAGCTGTGGG - Intronic
1176264186 20:64200127-64200149 GATGCTGGTGCGCCACATGATGG - Intronic
1176367862 21:6044626-6044648 GTGGCTGGCCCCTCACCTGGAGG + Intergenic
1176722834 21:10405624-10405646 CGGGCTGGAGCCCCACCTGCCGG - Intergenic
1177514717 21:22134583-22134605 ATTCCTGGTGCCCCACCTCAAGG + Intergenic
1179252038 21:39678729-39678751 TTGGCTGGTGGCTCATCTGAAGG + Intergenic
1179615770 21:42582286-42582308 GGGGCTGGTGCCCGTCCTCAGGG - Intergenic
1179755657 21:43493916-43493938 GTGGCTGGCCCCTCACCTGGAGG - Intergenic
1179943467 21:44654597-44654619 GTGGCTGGTGTGGCACATGATGG + Exonic
1180170744 21:46056976-46056998 GTGGGCGGTGCCCACCCTGATGG + Intergenic
1180303997 22:11058366-11058388 GGGGCTGGAGCCCCAACTGCCGG - Intergenic
1180793752 22:18591904-18591926 GAGGCTGTTGCCCCAGCTCAGGG - Intergenic
1181185818 22:21102963-21102985 GTGGTTGGGGCGCCCCCTGATGG - Intergenic
1181227988 22:21403416-21403438 GAGGCTGTTGCCCCAGCTCAGGG + Intergenic
1181250665 22:21531423-21531445 GAGGCTGTTGCCCCAGCTCAGGG - Intergenic
1181811685 22:25406953-25406975 GTGGCTGGAGCCGGCCCTGAAGG - Intergenic
1183616617 22:38949824-38949846 GTGACTTTTGCCCCACATGAAGG - Intergenic
1184650763 22:45918604-45918626 GAGGCTGGTGGCCCATCTGGGGG - Intergenic
1184834858 22:47015069-47015091 GTTCCTGATGCCCCACCTGCGGG + Intronic
1185213075 22:49582938-49582960 GTGGCTGGCTCCCCATCTGCAGG - Intronic
952295405 3:32057832-32057854 TGGGTTGGTCCCCCACCTGAGGG - Intronic
954257395 3:49416229-49416251 GTGGCTGGTGGCCCAGCAGATGG - Exonic
954258619 3:49422986-49423008 GTGGCTGTGTCCCCATCTGAGGG - Exonic
955270250 3:57490855-57490877 GAGGCGGGTGGACCACCTGAGGG + Intronic
955409556 3:58646976-58646998 GTGGGTTGTGCCCCTCCAGAGGG - Intronic
956260129 3:67330102-67330124 GTGGCTGGAGTCTCAGCTGAGGG + Intergenic
961668385 3:128508545-128508567 GTGCCGGGTGCCCCACGTGTGGG - Intergenic
962197414 3:133376308-133376330 GTGGCTCCTCTCCCACCTGAGGG + Intronic
965250157 3:166332703-166332725 GTGGGTGGTCCCCCACCCAAAGG + Intergenic
966593816 3:181709700-181709722 GTGGCTGGTGCGCCCCCTGCTGG - Intergenic
966818981 3:183910286-183910308 GTAGCTGGAGCCTCAGCTGAAGG - Intergenic
968168243 3:196486458-196486480 GTGCCTGGAGCTCCACCTGCTGG - Intronic
968931401 4:3581463-3581485 AGGGCTGGGGCCGCACCTGAGGG - Intronic
974933183 4:68383462-68383484 GTGGCTGGTGCCTGAGGTGATGG + Intergenic
975121640 4:70735216-70735238 TTTGATGGTGCCCCTCCTGAGGG + Intronic
978383474 4:108155585-108155607 GTGCCTTGGGCCCCACCTGGTGG - Intronic
978852896 4:113358973-113358995 GGGGCTCGTGCCCCCCCTGCAGG - Exonic
983645504 4:169986573-169986595 GTGTGTTGTGTCCCACCTGAAGG - Intergenic
995109937 5:108417932-108417954 GTGGGTAGTCCCCAACCTGAAGG - Intergenic
997593184 5:135087990-135088012 GTGGCTGGTGCCCCAGCATAAGG - Intronic
998404426 5:141866145-141866167 GTGGCTGGGGCCCGGCCTGGAGG - Intronic
1001564382 5:172690018-172690040 GGGGCTGGGGCCCCGCTTGAGGG - Exonic
1002046759 5:176545862-176545884 GTGGATGGTGCCCCTCGAGATGG + Intronic
1002948884 6:1788933-1788955 GGGGCTGGTGCCCGAAGTGAGGG - Intronic
1005903328 6:30238468-30238490 GTGGCAGATGGCCAACCTGATGG + Intergenic
1009026494 6:58006743-58006765 GTGGCTGGAGACCTATCTGATGG - Intergenic
1009202043 6:60758216-60758238 GTGGCTGGAGACCTATCTGATGG - Intergenic
1010228713 6:73515798-73515820 GTGGCTTGAGCACCACCTGCTGG - Exonic
1013488576 6:110621447-110621469 GTGGCTGCTGACCAACCTGGGGG + Intronic
1016830244 6:148426546-148426568 GTGCCTGGTGCCCGAACAGAAGG + Intronic
1018992448 6:168684574-168684596 TGGGCTGGTGCCGCACCTGCTGG + Intergenic
1019121891 6:169810702-169810724 GTGTCTGGTGCTCCACCCGCGGG - Intergenic
1023291383 7:38672011-38672033 GGAGCTGGTGCCCCACCTGATGG - Intergenic
1024283991 7:47741411-47741433 GAGGTTGGAGCCCCAGCTGAGGG - Intronic
1024532544 7:50405768-50405790 GTGGCTGGTCCCACACCTCGAGG - Intergenic
1027266973 7:76499825-76499847 GTGGCAGGAGCCCACCCTGACGG - Intronic
1027318788 7:76999693-76999715 GTGGCAGGAGCCCACCCTGACGG - Intergenic
1027432857 7:78132457-78132479 GTGGCTGGGGCCCACCCTAAAGG - Intronic
1028999599 7:97139277-97139299 GTGAGTGGTCCCCCACCTGAAGG + Intronic
1029189354 7:98760830-98760852 GCTGCTGGTGCCCCTGCTGAGGG + Intergenic
1032619368 7:133512196-133512218 GTGGCAGGTGGATCACCTGAGGG + Intronic
1032673120 7:134104120-134104142 GTGGCTGGTGGCCCACTTATTGG + Intergenic
1034918675 7:155061157-155061179 GTGGTGAGTGCCCCACCTCATGG + Intergenic
1035166024 7:156990358-156990380 GTGGGTGGTGCCCTGGCTGACGG - Intergenic
1035569128 8:660437-660459 GTGGCCGCTGCCACACCTCAAGG - Intronic
1037803985 8:22049319-22049341 GGGGCGGGGGCCACACCTGAGGG + Intronic
1039261937 8:35781304-35781326 GTGGCAGGTGCCCATCCTAAAGG + Intronic
1039545118 8:38404392-38404414 GTGGCAGGACCTCCACCTGAAGG + Exonic
1040537655 8:48323645-48323667 ATGGCTGGTGGCTCCCCTGATGG + Intergenic
1047188431 8:122656496-122656518 GATGCTGGTACCCCACCTCATGG - Intergenic
1047336773 8:123943583-123943605 GTGGCTGCTGCCCTTCCTGCTGG + Intronic
1048138343 8:131768330-131768352 GAAGCTGGTGCTCCACCTGCAGG - Intergenic
1049041675 8:140116787-140116809 GTCGCTGCTGCCCCACCTGTAGG - Intronic
1049179086 8:141211637-141211659 TTGGCTGGTGCCGCAGCTGTTGG - Exonic
1049574820 8:143385160-143385182 GTGGCCTGTGCCCCGCCAGAGGG + Intergenic
1049953964 9:674243-674265 CTGGCTGGTGACACACCAGAAGG - Intronic
1051518381 9:17956564-17956586 TTGGGTGCTGACCCACCTGAAGG + Intergenic
1055187570 9:73474626-73474648 GTCGCTGATGCGCCCCCTGAGGG - Intergenic
1057188370 9:93071923-93071945 GTTTCGGGAGCCCCACCTGATGG - Intronic
1057724311 9:97557377-97557399 CTGGGTTCTGCCCCACCTGAAGG - Intronic
1057909142 9:99004668-99004690 GTGGCTGGTGGCACACCACACGG + Intronic
1060822881 9:126671709-126671731 GTGCCTGGTGACCCAGCTGCTGG - Intronic
1061597517 9:131641430-131641452 GTTCCTGGAGCCCGACCTGAGGG - Intronic
1062229730 9:135475097-135475119 GTGCCAGCTGCCCCACCTGGTGG + Intergenic
1189236221 X:39489367-39489389 GTGGCTTGAGTCCCACCTGCAGG - Intergenic
1189350762 X:40273869-40273891 GTGGCTGGTGGCTCCCCTGTTGG - Intergenic
1190259001 X:48786472-48786494 GTGGCTGGTGCCCCAGTGGGTGG - Intergenic
1190286384 X:48964148-48964170 GAGGCAGGTGGACCACCTGAAGG + Intronic
1190868128 X:54401751-54401773 GTGGCTGTGGTCTCACCTGAAGG + Intergenic
1191632033 X:63331789-63331811 CTGGCGGGTGCCCCACTGGAAGG + Intergenic
1196760186 X:119193941-119193963 GTGGGGGGTGCCCAACTTGATGG - Intergenic