ID: 1147323782

View in Genome Browser
Species Human (GRCh38)
Location 17:39660767-39660789
Sequence CTTTTGGAACAGGTCGCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 56}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147323782_1147323788 13 Left 1147323782 17:39660767-39660789 CCTGGGGCGACCTGTTCCAAAAG 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1147323788 17:39660803-39660825 CCCTCAGATCCTGCAGCGAGTGG 0: 1
1: 0
2: 1
3: 6
4: 148
1147323782_1147323784 -10 Left 1147323782 17:39660767-39660789 CCTGGGGCGACCTGTTCCAAAAG 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1147323784 17:39660780-39660802 GTTCCAAAAGTCTCCGTTGACGG 0: 1
1: 0
2: 0
3: 4
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147323782 Original CRISPR CTTTTGGAACAGGTCGCCCC AGG (reversed) Intronic
905688762 1:39927440-39927462 CTGTAGGAACAGGTAGTCCCTGG + Intergenic
913084779 1:115426537-115426559 CTTCTGGACAAGGTCGACCCTGG + Intergenic
914981682 1:152420095-152420117 CTGTTGGTACAGGTCTCCACTGG + Intergenic
915834338 1:159163171-159163193 CATTTGTAACAGGTGGCTCCAGG + Intergenic
922198009 1:223376436-223376458 CTTTTAGAACAGGCCACCACTGG + Intergenic
1070508722 10:77140394-77140416 ATTATGGAACAGGTCCCCCAGGG + Intronic
1070637528 10:78141138-78141160 CTTTGGGAACTGGTAGCACCAGG + Intergenic
1075937468 10:126355379-126355401 ATAGTGGAACAGGTGGCCCCAGG + Intronic
1076885185 10:133258880-133258902 CTCTGGGAACAGGCGGCCCCGGG + Intergenic
1078518347 11:12044322-12044344 CTTTTGGAAGAGGTTTTCCCTGG - Intergenic
1078813284 11:14793638-14793660 CTTTTTGAACAGGTTTTCCCTGG + Intronic
1088785053 11:113173920-113173942 GATTTGGAACAGGTGGCCTCTGG - Intronic
1093181011 12:15966918-15966940 GTTCTGGAGCAGGTGGCCCCGGG - Intronic
1101579039 12:106025253-106025275 CTGTTGGATCAGGTCTCCCCAGG - Intergenic
1103409533 12:120700973-120700995 CTCTTGGGACAGGTTCCCCCAGG + Exonic
1110139839 13:72114902-72114924 CTTTTGAAACATGTCTCTCCTGG - Intergenic
1123017930 14:105384422-105384444 CTTGTTGAACAGGTCTCTCCAGG - Exonic
1124186010 15:27530173-27530195 CAATTGGAACAGCTTGCCCCAGG - Intronic
1130091963 15:80828799-80828821 GCTTTGGAACAGGTCTCCACTGG + Intronic
1131376005 15:91924036-91924058 CTTTTGGAAAAAGTCACCGCAGG - Intronic
1132558465 16:582956-582978 CTTGCGGCACAGGGCGCCCCAGG - Exonic
1139852725 16:69960733-69960755 CTTTTGGAGCAGGTGGCCAGAGG + Intronic
1139881696 16:70183641-70183663 CTTTTGGAGCAGGTGGCCAGAGG + Intronic
1140370812 16:74411865-74411887 CTTTTGGAGCAGGTGGCCAGAGG - Intronic
1142607826 17:1091668-1091690 CTTCTGGAAGAGGTGGCCCATGG + Exonic
1146497259 17:33334162-33334184 CTTTTGGAACATGTAGACTCTGG - Intronic
1147323782 17:39660767-39660789 CTTTTGGAACAGGTCGCCCCAGG - Intronic
1148832547 17:50443308-50443330 CTTTTGAAACAGGTCTGCCATGG - Intronic
1149700593 17:58651992-58652014 CTTTTGGAACAGGATGTCTCGGG - Exonic
1151401035 17:73856358-73856380 CATTTCTAACAGGTCCCCCCCGG + Intergenic
934934817 2:98457464-98457486 CTTTGGGAACTGGTCATCCCAGG + Intronic
1169405096 20:5315951-5315973 CTGCTGGAACGGGTCGCTCCCGG - Intergenic
1174085915 20:48006976-48006998 GTTCTGGAACAGGGAGCCCCAGG + Intergenic
1176143690 20:63556048-63556070 CTGTTGGAACAGCTCGACCATGG + Exonic
1179103956 21:38381796-38381818 CTTTTGGAACAGAAGGACCCCGG - Exonic
1185179665 22:49351916-49351938 CTTTGGGACCAGGTTGCCGCTGG + Intergenic
953469343 3:43153871-43153893 CTTTTGGAACAGGTCCGGACTGG + Intergenic
954296544 3:49677474-49677496 CTTTTGCCTCAGGTAGCCCCAGG - Intronic
961566526 3:127767619-127767641 CTTATGGAACAGAGTGCCCCAGG - Intronic
965588178 3:170337481-170337503 CTTTTGTAACAGGACGCAACTGG - Intergenic
973157467 4:46974860-46974882 AGTTTGGAACAGGTGACCCCAGG - Intronic
978197751 4:105990683-105990705 CTTATTGAACAGGATGCCCCAGG + Intronic
982457573 4:155628551-155628573 CTTTTGGAACAGTTTGACTCTGG + Intergenic
993680972 5:90877329-90877351 CTTTTCCAACAGGTCTGCCCAGG - Intronic
999888827 5:155954632-155954654 CTTTTGATAGAGGTAGCCCCAGG + Intronic
1000147823 5:158470449-158470471 CTTCTGGACCAGTTCCCCCCAGG + Intergenic
1003112883 6:3263958-3263980 CTTTGGGAACAGGCCAGCCCTGG - Intronic
1006503526 6:34473421-34473443 CTTGTGGGACAGGTGGCCCAGGG + Intronic
1007703472 6:43777717-43777739 CTTTGGGAACAGGTGGTCCCAGG + Intronic
1007729801 6:43938936-43938958 CTCTGGGAAGAGGTGGCCCCAGG - Intergenic
1019135112 6:169902995-169903017 GTTTTGGAACATGTCCACCCAGG - Intergenic
1020430962 7:8115787-8115809 CTTTTGGGACAGGTCCCCCAAGG - Intronic
1022337419 7:29434724-29434746 CTTTTGGAGAAGGTCACCACAGG + Intronic
1024653485 7:51429116-51429138 GTATAGGAACAAGTCGCCCCTGG - Intergenic
1027545327 7:79520430-79520452 ATTTTGGAACAGGTCTCTTCTGG - Intergenic
1034331022 7:150282238-150282260 CTTCTGGAACACATCGCCTCAGG - Intronic
1034667021 7:152827615-152827637 CTTCTGGAACACATCGCCTCAGG + Intronic
1055445460 9:76377799-76377821 CTTTTGGAAGAGGCTGCCCAGGG - Intergenic
1056332784 9:85535620-85535642 CTTTGGGAACAGGCTGCCACGGG + Intergenic
1190540817 X:51476218-51476240 CTTTTGTAACAGGACACCACTGG - Intergenic