ID: 1147325319

View in Genome Browser
Species Human (GRCh38)
Location 17:39667169-39667191
Sequence GAACCCACGGTGGCAGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147325314_1147325319 -4 Left 1147325314 17:39667150-39667172 CCACATCAAGCGGGGCCAGGAAC No data
Right 1147325319 17:39667169-39667191 GAACCCACGGTGGCAGGAGCTGG No data
1147325313_1147325319 -3 Left 1147325313 17:39667149-39667171 CCCACATCAAGCGGGGCCAGGAA No data
Right 1147325319 17:39667169-39667191 GAACCCACGGTGGCAGGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147325319 Original CRISPR GAACCCACGGTGGCAGGAGC TGG Intergenic
No off target data available for this crispr