ID: 1147326401

View in Genome Browser
Species Human (GRCh38)
Location 17:39671761-39671783
Sequence GAACATGCACACAGGCAGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 339}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147326390_1147326401 21 Left 1147326390 17:39671717-39671739 CCCTGTGAGGTTTGCAGGAGGCG 0: 1
1: 0
2: 0
3: 12
4: 103
Right 1147326401 17:39671761-39671783 GAACATGCACACAGGCAGCCTGG 0: 1
1: 0
2: 2
3: 22
4: 339
1147326391_1147326401 20 Left 1147326391 17:39671718-39671740 CCTGTGAGGTTTGCAGGAGGCGG 0: 1
1: 0
2: 1
3: 8
4: 131
Right 1147326401 17:39671761-39671783 GAACATGCACACAGGCAGCCTGG 0: 1
1: 0
2: 2
3: 22
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147326401 Original CRISPR GAACATGCACACAGGCAGCC TGG Exonic
900522867 1:3114668-3114690 ACACATGCACACATGCACCCGGG + Intronic
900898469 1:5500584-5500606 GAACATTCACACCAGCCGCCAGG + Intergenic
900952949 1:5868237-5868259 GCACATGCACACAGGGTGTCGGG - Intronic
901275349 1:7986870-7986892 GAGCAGGCACGCAGGCAGGCGGG + Intergenic
901676744 1:10889778-10889800 GAAACTCCACACAGGCAACCTGG + Intergenic
902647027 1:17806687-17806709 GGACATCCACACAGGGAGCAAGG + Intronic
903383588 1:22912897-22912919 GAAAATGCAAGCTGGCAGCCGGG + Intronic
903472872 1:23599452-23599474 GGAAATGAACCCAGGCAGCCTGG - Intronic
904038513 1:27571367-27571389 GACCAGGCACAGAGGCAGGCTGG + Intronic
904056218 1:27672053-27672075 TTACAGGCAGACAGGCAGCCTGG + Intronic
904777378 1:32919001-32919023 GAACTTGAATCCAGGCAGCCTGG - Intergenic
905856972 1:41320688-41320710 GCAGATGTACTCAGGCAGCCTGG + Intergenic
905921907 1:41725237-41725259 GGACATGCAGACATGCAGCTGGG + Intronic
905960524 1:42038779-42038801 GAAGGTGCAGATAGGCAGCCTGG - Intergenic
905970445 1:42137936-42137958 GAACAAGCACATTGTCAGCCTGG + Intergenic
906273648 1:44500677-44500699 GAGAATGGAGACAGGCAGCCTGG - Intronic
907855829 1:58302582-58302604 ATACATGAACACAGGAAGCCTGG - Intronic
908120672 1:60983398-60983420 GAAGATGCACACAGGCCTGCGGG - Intronic
908268991 1:62404709-62404731 GAGCCTGCACACAGGCAGTAAGG - Intergenic
912013812 1:105005883-105005905 GAGCATGCACACACCCTGCCAGG + Intergenic
912483984 1:110009346-110009368 GACCACACACACAGACAGCCAGG - Intronic
913205952 1:116538953-116538975 GGATATGCACTCAGGCAGCTGGG - Intronic
913533461 1:119749498-119749520 CAACATGCACACAGGCTCCCGGG + Intronic
917476408 1:175373065-175373087 AAACATGCACAGAAGCAGCATGG + Intronic
918071525 1:181136883-181136905 GAGCACGCACACAGACAGCGGGG + Intergenic
919515435 1:198516273-198516295 GAACATGCACAAAGGCTGAGAGG - Intergenic
919611034 1:199745798-199745820 AAAGATGCACACAGGGAGGCAGG + Intergenic
920179177 1:204122079-204122101 GAACAAGAACACAGGATGCCAGG - Intronic
920188779 1:204179215-204179237 GGACAGGCACAGAGTCAGCCTGG - Intergenic
920960778 1:210662285-210662307 TAGCATTCAGACAGGCAGCCTGG - Intronic
922470662 1:225875166-225875188 GAGCATGCATGCAGGCAGCAAGG + Intronic
922549692 1:226484860-226484882 TCTCATGCAAACAGGCAGCCTGG - Intergenic
923954709 1:239002957-239002979 GATAATACACATAGGCAGCCAGG + Intergenic
924578767 1:245304656-245304678 GGACAGGCAGACAGGCAGACAGG - Intronic
1062999671 10:1904116-1904138 GCACATGCACACAGGCACACAGG + Intergenic
1063933151 10:11049916-11049938 GAGCATGCACACGGGCAACGGGG - Intronic
1064010254 10:11729926-11729948 GAGCATGCACACACCCGGCCAGG - Intergenic
1066233114 10:33457134-33457156 GAACAGGCACAGAGGCAAGCTGG + Intergenic
1066388831 10:34962704-34962726 CAAAATGCCCACAGGCAGGCTGG - Intergenic
1068657261 10:59588498-59588520 GACCATGCACAGAGTCAGCAGGG + Intergenic
1068973726 10:62985988-62986010 TAGATTGCACACAGGCAGCCTGG - Intergenic
1069812081 10:71169090-71169112 GAACAAGCAGACAGGCAGGGAGG + Intergenic
1069860223 10:71466176-71466198 GCACATGCACACACACAGACGGG - Intronic
1071903517 10:90146615-90146637 GAACAGACAGACAGGCAGACAGG - Intergenic
1073204376 10:101761211-101761233 GAACGTGCACACTGGCCCCCGGG + Intergenic
1074892258 10:117745509-117745531 TTCCATGCATACAGGCAGCCTGG - Intergenic
1075032137 10:119030427-119030449 GAACACGCACACCTGCAGCTCGG - Exonic
1076008412 10:126966946-126966968 GAAGATGCTCATTGGCAGCCAGG + Intronic
1076183990 10:128432267-128432289 CCACATGCACACAGGCAGCTGGG + Intergenic
1076441087 10:130481800-130481822 GTCCACTCACACAGGCAGCCAGG - Intergenic
1076496766 10:130902613-130902635 AACCATGCACCCAGGCAGTCTGG + Intergenic
1077191796 11:1258790-1258812 GAGCATGGACCCAGGCAGGCAGG - Intronic
1078001970 11:7504160-7504182 GAACAGGCATAAAGGCAGCAAGG + Intronic
1078740176 11:14059152-14059174 GTCCAGGGACACAGGCAGCCTGG + Intronic
1079168073 11:18065696-18065718 GAACATGCACACAGCCTGAAGGG - Intergenic
1080174354 11:29343886-29343908 GCGTATGCACAGAGGCAGCCTGG - Intergenic
1084529230 11:69717284-69717306 GATCCTGCACACACACAGCCTGG - Intergenic
1084727060 11:70948751-70948773 CCACATGCACAGAGGCTGCCTGG + Intronic
1085196951 11:74678518-74678540 CAACAGCCTCACAGGCAGCCAGG + Intergenic
1088811981 11:113398179-113398201 GCACATGCCCTCAGGGAGCCTGG + Intronic
1089261847 11:117229145-117229167 GACCATGAGCCCAGGCAGCCTGG + Intronic
1089282681 11:117385445-117385467 GAACTTGCACAGAGGCAACCTGG - Intronic
1089543399 11:119205007-119205029 GACCATTCAGACAGGCATCCTGG - Intergenic
1090088827 11:123675651-123675673 GAACACGCACCCAGGAGGCCGGG - Intergenic
1090394361 11:126408978-126409000 GAACATCCACACAGGTAGAAGGG - Intronic
1090957314 11:131524961-131524983 GCACCTGCACACAGGAAACCTGG + Intronic
1093164622 12:15790064-15790086 AAATAGGCTCACAGGCAGCCTGG - Intronic
1095839997 12:46682608-46682630 GAACATTCTCACAGGGACCCAGG - Intergenic
1102167323 12:110817064-110817086 GGATATGAACCCAGGCAGCCAGG - Intergenic
1102242626 12:111334589-111334611 GAAGATGTACTCAGGCAGCCAGG + Exonic
1102833431 12:116029696-116029718 GAACATGTACACAGCCACACTGG + Intronic
1103075350 12:117977971-117977993 TAAAAAGCACACATGCAGCCAGG + Intergenic
1104496539 12:129245774-129245796 GAACGTGAAAACAGGCATCCTGG + Intronic
1104519518 12:129460418-129460440 GAACATGAACTCAGGCTGCCGGG + Intronic
1104604686 12:130179517-130179539 GAACATGGACAGAGGCATCCAGG - Intergenic
1106134164 13:26961908-26961930 GAAGGTGCACAGAGGCAGCATGG - Intergenic
1106809846 13:33349508-33349530 GAGCATGCACAGAAGCAGCAAGG + Intronic
1107628463 13:42316645-42316667 GGACATTTACACAGGCAGTCTGG - Intronic
1107990571 13:45815441-45815463 GAACAGGCAGGCAGGCAGACTGG - Intronic
1108017074 13:46086878-46086900 GATCATGCACACAGCCAGCCAGG + Intronic
1108707272 13:53000959-53000981 GAGCAGGCACAGAGGCATCCAGG + Intergenic
1109619226 13:64879872-64879894 GAGCATACAGACAGGCAGGCTGG + Intergenic
1110777929 13:79432234-79432256 GAGCATGCTCACACCCAGCCAGG - Intergenic
1113178337 13:107594470-107594492 GAACCTGCACACAGGGACACAGG - Intronic
1113586434 13:111469187-111469209 GGATTTGCACCCAGGCAGCCTGG - Intergenic
1114686539 14:24537362-24537384 GCACATTCACACTGGCAGCAAGG - Intergenic
1114732195 14:25004858-25004880 TAACAAGCACACACACAGCCTGG + Intronic
1115395258 14:32901561-32901583 TAACATGCAGACTGGCATCCCGG - Intergenic
1115484723 14:33899588-33899610 GAATTTGAACCCAGGCAGCCTGG + Intergenic
1115824218 14:37248033-37248055 AAACATGCACACAGAGACCCAGG + Intronic
1116115590 14:40645538-40645560 GAATATGCCCACAGTCACCCAGG - Intergenic
1117592170 14:57281830-57281852 GAACATGGAGACGGGGAGCCTGG + Intronic
1118607259 14:67513686-67513708 GGTCATTCACACAGGCAGGCGGG + Intronic
1118711670 14:68524671-68524693 AATCATTGACACAGGCAGCCTGG - Intronic
1119485047 14:74981532-74981554 GAGCAGGCGCAGAGGCAGCCAGG - Intergenic
1122248854 14:100424170-100424192 GAACACTCACCCAGCCAGCCTGG - Intronic
1122273215 14:100577679-100577701 GTCCCTGAACACAGGCAGCCGGG - Intronic
1122860852 14:104581805-104581827 GAACAGGGAAACAGGGAGCCTGG + Intronic
1123699178 15:22902141-22902163 GACCCTGGACACAGGCAGGCTGG - Intronic
1124231698 15:27951683-27951705 GACTTTGCCCACAGGCAGCCGGG - Intronic
1126706564 15:51411368-51411390 GAACATGAACAGAGACAGACTGG + Intergenic
1129725539 15:77899717-77899739 GCACGTGCACACATGCAACCTGG - Intergenic
1129931174 15:79412271-79412293 GCACATGCACACATGCACACTGG - Intronic
1130412607 15:83659569-83659591 GGACATCCACACTGTCAGCCTGG - Intronic
1130486769 15:84402521-84402543 GCACGTGCACACACGCAACCTGG + Intergenic
1131340964 15:91600348-91600370 GCACATGCACCCAGGCTGACTGG + Intergenic
1133970563 16:10564764-10564786 GGAAATGCAAACAGGCAGCTCGG + Intronic
1139544807 16:67645170-67645192 GAGCGCGCACACAGGAAGCCTGG - Exonic
1140656582 16:77147099-77147121 GAAGATGCCCTCAGGCATCCAGG + Intergenic
1140989216 16:80192079-80192101 GGTCATGCAAACAGGCAGTCAGG - Intergenic
1141492087 16:84380649-84380671 GAATTTGCATCCAGGCAGCCTGG - Intronic
1141668263 16:85477432-85477454 AAACATGCCCACAGCCAGCTGGG + Intergenic
1141988311 16:87594294-87594316 GAACATGAACACAGGAGACCTGG + Intergenic
1142590905 17:1005565-1005587 GCACATGCATGCAGGCAGGCTGG + Exonic
1142744413 17:1948539-1948561 GGACAGGCAGACAGGCAGACAGG + Intronic
1143052326 17:4136537-4136559 GAACTTGCTCACAAGCAGGCTGG + Intronic
1143104592 17:4522644-4522666 GACCACGCACACATTCAGCCTGG + Intronic
1143541338 17:7571261-7571283 GAACATCCCCAAAGGGAGCCAGG - Intronic
1143936953 17:10495967-10495989 GAACACGCTCACTGGCATCCAGG + Exonic
1143939410 17:10524483-10524505 GAACACGCTCACTGGCATCCAGG + Exonic
1145905450 17:28513853-28513875 GAAGGTGCCCAGAGGCAGCCAGG + Intronic
1146487887 17:33258877-33258899 GAACATGCACAGTGGAGGCCGGG + Intronic
1147326401 17:39671761-39671783 GAACATGCACACAGGCAGCCTGG + Exonic
1147931147 17:43982367-43982389 AAAAATGCACACAGGCATTCAGG - Intronic
1148474147 17:47916086-47916108 GATCATGGACAGAGGCGGCCGGG + Intronic
1148539475 17:48468462-48468484 GCACCTGCACTCAGGCAGGCCGG - Intergenic
1148844408 17:50520683-50520705 GGACCTGAACCCAGGCAGCCTGG - Intronic
1149297478 17:55273667-55273689 GGTCATGCAGGCAGGCAGCCAGG - Intronic
1149972748 17:61235320-61235342 AGACTTGCAGACAGGCAGCCTGG + Intronic
1150183767 17:63157525-63157547 GTATATGAACACAGGCAGTCTGG - Intronic
1150411859 17:64951074-64951096 GACCAAGCTCACTGGCAGCCAGG + Intergenic
1151122079 17:71803797-71803819 GAACTTGCACACAGGTGGCCTGG + Intergenic
1151568613 17:74914936-74914958 GAACATCCCCACAGGCTCCCTGG + Intergenic
1152012474 17:77726981-77727003 GAACATGCAAAGAGGGGGCCAGG - Intergenic
1152215261 17:79028163-79028185 GAAGAGGCAGACAGGCAGGCGGG + Intronic
1152254065 17:79227276-79227298 GAACATCCACAGAGGCAGGTTGG + Intronic
1152560206 17:81074777-81074799 GTACATGCACACAGACACACAGG - Intronic
1153988118 18:10371088-10371110 ACACATGCCCACAGGCTGCCAGG - Intergenic
1155179387 18:23330943-23330965 GAAAAGGCCCACGGGCAGCCTGG + Intronic
1155347946 18:24877248-24877270 GAACATCCCCACATGCTGCCTGG + Intergenic
1156459871 18:37315691-37315713 GCACATGCACCCAGGGAGGCGGG + Intronic
1156464731 18:37341591-37341613 CAACATGGGCACAGGCTGCCTGG + Intronic
1158341857 18:56474610-56474632 GTACATGCAGACAGGCGGGCAGG + Intergenic
1158668880 18:59456818-59456840 GAGCAGGCCCAGAGGCAGCCTGG + Intronic
1159386144 18:67727525-67727547 GAAAATACACACACACAGCCGGG + Intergenic
1160005938 18:75069155-75069177 GGACCTGGACACAGCCAGCCAGG - Intergenic
1160192025 18:76722533-76722555 GAACCTGCAGCCAGGCTGCCTGG + Intergenic
1161249798 19:3274461-3274483 GCACATGCACACAGGCAGGAAGG - Intronic
1162111557 19:8402552-8402574 GAACATCCTCACAGGTGGCCGGG + Exonic
1162114703 19:8421868-8421890 GAGCAGTCACACAGGGAGCCGGG - Exonic
1162606275 19:11710519-11710541 AAGCATGCACACAGGCAAGCAGG + Intergenic
1164598710 19:29547036-29547058 GGACTTGCACCCAGGCAGTCTGG - Intronic
1165406497 19:35634079-35634101 GAACTTCCACACAGACAGACCGG + Intronic
1166304328 19:41928928-41928950 GGACCCGCACACACGCAGCCTGG + Intronic
1166855883 19:45782445-45782467 GGACAGGCAGACATGCAGCCAGG - Intronic
925299559 2:2800877-2800899 GAAAATGCACACATGCACCATGG - Intergenic
925933937 2:8735079-8735101 GAACATGAACACAAGCTGCTGGG + Intronic
926014148 2:9434464-9434486 GATCCTGCCCAGAGGCAGCCTGG - Intronic
926958920 2:18332606-18332628 AAGCATGCACACACCCAGCCGGG + Intronic
927684092 2:25158849-25158871 ACACATGCACACACACAGCCAGG - Exonic
929295547 2:40242427-40242449 CAACATAAACACAGGCAGCATGG - Intronic
929404969 2:41631080-41631102 GAGTGTCCACACAGGCAGCCTGG - Intergenic
930142488 2:47966413-47966435 GATGATGCACACAGGGAGACAGG - Intergenic
930611201 2:53545917-53545939 GCACATGAACAGAAGCAGCCAGG + Intronic
931218695 2:60269729-60269751 CAAGGGGCACACAGGCAGCCAGG + Intergenic
932123181 2:69119770-69119792 GGATCTGCACCCAGGCAGCCTGG - Intronic
932222038 2:70006929-70006951 GGACTTGAACCCAGGCAGCCAGG - Intergenic
933131291 2:78676983-78677005 CAACATACACACAGACAGGCAGG + Intergenic
933166883 2:79086471-79086493 GAACATGAATTCAGGCAACCTGG - Exonic
933787984 2:85859017-85859039 CAAAATGATCACAGGCAGCCGGG + Intronic
934913229 2:98277703-98277725 GAAAATGCACACAGGGAGGCAGG + Intronic
935199700 2:100845538-100845560 CTACATGCACTCAGGCACCCAGG + Intronic
937359847 2:121221266-121221288 GAACATGCACCAAGGAAGACTGG + Exonic
937950191 2:127379789-127379811 GGACTTGAACTCAGGCAGCCTGG - Intronic
938595891 2:132786870-132786892 GGACATGAACCCAGGCAGTCTGG + Intronic
940073538 2:149716099-149716121 GAACTTGAACCCAAGCAGCCTGG - Intergenic
941219610 2:162759671-162759693 GAACATGACAACAGGCAGGCAGG + Intronic
943726102 2:191253346-191253368 GCACATTCCCACAGGAAGCCAGG - Intronic
944948039 2:204713292-204713314 GAACATTCACACTGGCACACTGG - Intronic
945424250 2:209680386-209680408 GAAAACACACACAGGCAGGCAGG - Intronic
946181540 2:217952005-217952027 GAACATGAACACAGCCAGATGGG + Intronic
948123830 2:235550411-235550433 GAGCATGCACACGGGCTGTCAGG + Intronic
1168790685 20:573873-573895 GAACCTGGACACAGAAAGCCAGG - Intergenic
1169992252 20:11516447-11516469 GGACATGCACACAGGCCACTGGG + Intergenic
1171193379 20:23178168-23178190 GATCAGGCACACAGTCATCCTGG + Intergenic
1171213782 20:23337037-23337059 GAACAGCCACACAGGGAGGCTGG - Intergenic
1173188800 20:40860926-40860948 GGACTTGAACACAGGCAGGCTGG - Intergenic
1174380903 20:50154801-50154823 GAAATTCCATACAGGCAGCCGGG + Intergenic
1174451171 20:50621441-50621463 GCACATGCACACATGCACACGGG + Intronic
1174728561 20:52890891-52890913 AATCTTGCACACGGGCAGCCAGG + Intergenic
1176217123 20:63953404-63953426 AGAAATACACACAGGCAGCCGGG + Intronic
1176217654 20:63955940-63955962 GAGCAGGCACACAGCCCGCCGGG + Intronic
1176236847 20:64057423-64057445 GCACACGCACACACGCAGGCGGG - Intronic
1177844001 21:26267824-26267846 GAACATGCAGACAGTCAGGTCGG + Intergenic
1178010779 21:28283884-28283906 GACCTTACACACAGGCAGTCTGG + Intergenic
1178725559 21:35048390-35048412 GCACATGCACAGAGCCAGCCAGG - Intronic
1178964132 21:37099422-37099444 GAATTTGAACCCAGGCAGCCTGG + Intronic
1179398174 21:41060192-41060214 GAAGATGCAGACAGGGAGACAGG - Intergenic
1179407298 21:41136561-41136583 GAGCATGCACACACCCAGCTGGG - Intergenic
1179955427 21:44735625-44735647 GAGCCTCCACACAGGCAGCGAGG + Intergenic
1179982323 21:44902118-44902140 GAACATGCTCACATGCATACAGG - Intronic
1180102539 21:45595678-45595700 GCACATGCACACATGCACACAGG - Intergenic
1181565847 22:23736915-23736937 GGACATGCACACAGGCACCCAGG + Intergenic
1183384236 22:37505875-37505897 TAACATGCACACAGGCACTCAGG + Intronic
1183678361 22:39312373-39312395 GAACATGAACACAGGCACAGAGG - Intergenic
1183702900 22:39459803-39459825 GAGGATGCACACAGGGTGCCTGG + Intronic
1184445761 22:44545900-44545922 GAAAATGCCCCCAGGGAGCCTGG + Intergenic
1184901730 22:47450561-47450583 GAACACACCCACAGGCTGCCGGG + Intergenic
1185094996 22:48801303-48801325 ACACATGCACACAGGCACACAGG + Intronic
949358930 3:3211314-3211336 GACAATGCACACAGGCAGAAAGG + Intergenic
949402014 3:3674916-3674938 GAATTTACACAAAGGCAGCCTGG - Intergenic
950543611 3:13626464-13626486 GGACCTGCACACGTGCAGCCGGG + Exonic
951718533 3:25674138-25674160 GAGCATGCACACACCCAGCCAGG + Intergenic
952064883 3:29557315-29557337 CAACATACACACAGGCAATCTGG - Intronic
953267366 3:41404722-41404744 GCACATGCACATATGCAGCAGGG - Intronic
953403927 3:42651059-42651081 GAACTTGAACCCAAGCAGCCTGG - Intergenic
953848795 3:46449576-46449598 GAACATGAACAAAGATAGCCAGG - Intronic
954226857 3:49187502-49187524 GAACATGCACCCAACCAGACAGG + Intronic
956691114 3:71878336-71878358 GCACATGTGCACTGGCAGCCTGG - Intergenic
956724434 3:72145579-72145601 GCACATGCAGACTGGCAGGCAGG + Intergenic
957967409 3:87340184-87340206 AAACATGAACCCAGGCTGCCAGG + Intergenic
960803545 3:121561848-121561870 GAACAAGGACACTGGCAGGCAGG + Intergenic
961036714 3:123647562-123647584 CAACATGCAAACAGCCAGGCAGG - Intronic
961761540 3:129172606-129172628 AGACAGGCAGACAGGCAGCCAGG + Intronic
963386818 3:144607488-144607510 GAATATGCACTCAGTCAGTCTGG - Intergenic
964091664 3:152884432-152884454 GGACTTGAACCCAGGCAGCCTGG - Intergenic
964172707 3:153789901-153789923 GAACATGAACACAGAGAGGCAGG - Intergenic
964720301 3:159763622-159763644 GAGCATGCCCAGAGGCTGCCGGG - Intronic
964927897 3:161979251-161979273 GAGCATGCACACACCCAGCCAGG + Intergenic
967856758 3:194123764-194123786 GAACATGAACTCAGGCAGTCTGG + Intergenic
968347032 3:198017281-198017303 TAACATACATACAGGCAGACTGG - Intronic
968443309 4:635438-635460 GAACACGCAGGCAGGCAGGCAGG - Intronic
968926179 4:3549599-3549621 CCACATCCACACAGGCAGACCGG - Intergenic
969190636 4:5515838-5515860 CAACATGCAAACAGCCAACCAGG - Intergenic
969338928 4:6528301-6528323 GGACATGTTCACAGGCAGGCAGG - Intronic
969680620 4:8641386-8641408 GAACGTGGAGACAGGCAGACAGG - Intergenic
970953071 4:21778831-21778853 GAATTTGCACATAGGTAGCCTGG - Intronic
971598650 4:28565379-28565401 GAACCTCCAAACAGACAGCCAGG - Intergenic
976700723 4:87966396-87966418 GAGCATGCGCACAGCCAGCTGGG - Intergenic
978466682 4:109016227-109016249 GATCATGCACACACCCAGCTTGG - Intronic
981734283 4:147933460-147933482 GAACAGGCACAAAGCCAGACTGG - Intronic
982217726 4:153096592-153096614 GGATTTGCACCCAGGCAGCCTGG + Intergenic
983615408 4:169698877-169698899 GAAGATGCAAATAGACAGCCAGG - Intronic
986049980 5:4081019-4081041 GCACATGCACACAGGCACACAGG + Intergenic
986444177 5:7807170-7807192 GAACAGGCAGACACGCACCCTGG - Intronic
986955474 5:13145245-13145267 TCAGATGCACACAGGCAGGCAGG + Intergenic
986958557 5:13186690-13186712 GAAAATGCAAACAAGCAGGCAGG - Intergenic
987298910 5:16579335-16579357 GGACATGAATCCAGGCAGCCTGG + Intronic
990821563 5:59846408-59846430 GAACATTAACACAAGCATCCCGG - Intronic
990982986 5:61618315-61618337 GAGCATGCACACAGTGAGCATGG + Intergenic
994289734 5:98014620-98014642 ACACAGGCACACAGGCAGCTGGG + Intergenic
994692442 5:103034959-103034981 TAGCATGCACACACCCAGCCAGG + Intergenic
996717953 5:126602324-126602346 GGATCTGAACACAGGCAGCCTGG - Intronic
997420537 5:133763535-133763557 GCAGATGCTCACAGGGAGCCAGG - Intergenic
997429419 5:133827156-133827178 AAACAAGCAGGCAGGCAGCCAGG - Intergenic
998016390 5:138735499-138735521 GCAAAGGCACACAGGCAGCTGGG - Intronic
998419811 5:141973532-141973554 GAAAATGCACAGAGGCTGGCCGG - Intronic
998506867 5:142679269-142679291 GAGCATGCACAAAGGTTGCCTGG - Intronic
1000281201 5:159783878-159783900 GAGCATGCACACAGGAAGCATGG + Intergenic
1001266725 5:170279209-170279231 GAACCTCCCCACAGGAAGCCAGG + Intronic
1001419739 5:171577585-171577607 GATGATGCAGAGAGGCAGCCTGG + Intergenic
1001556450 5:172640852-172640874 GAACTTACACAGAGGCAGACGGG - Intergenic
1001777527 5:174339768-174339790 GGCCATACAAACAGGCAGCCAGG - Intergenic
1002299631 5:178249894-178249916 GGGTTTGCACACAGGCAGCCTGG + Intronic
1002540170 5:179901454-179901476 ACACATCCACACAGGCAGCGAGG - Intronic
1003871053 6:10403854-10403876 AAACATGCTCGCACGCAGCCTGG + Intronic
1004925274 6:20410345-20410367 GAACAAGAACACAGGCACTCTGG - Intronic
1005097916 6:22138666-22138688 GAACATGCACAGAGAAAGGCTGG + Intergenic
1007217403 6:40250988-40251010 TAATTTGCAAACAGGCAGCCTGG + Intergenic
1007721245 6:43886597-43886619 GAACTTGAACCCAGGCAGTCTGG - Intergenic
1007778467 6:44237448-44237470 GAGCATCTACACAGGAAGCCAGG - Intergenic
1007793411 6:44327790-44327812 GAATCTGAACTCAGGCAGCCTGG + Intronic
1008910111 6:56722789-56722811 GAACATGTACAAAGGCAGGGAGG + Intronic
1009577462 6:65484645-65484667 GACCAAGCTCACTGGCAGCCTGG - Intronic
1009813940 6:68706537-68706559 GAATATGAACACAGGCAGCGTGG - Intronic
1012520602 6:100116713-100116735 GAACAGGGAGACAAGCAGCCTGG - Intergenic
1014204308 6:118640357-118640379 GAACTTGAACCCAGGTAGCCTGG - Intronic
1014890729 6:126841551-126841573 ACACATGCACACAGACAGACAGG - Intergenic
1015308620 6:131739171-131739193 GAATATGAACCCAGACAGCCTGG + Intronic
1015830720 6:137365969-137365991 CAACTTTCACACAGGCAGGCAGG + Intergenic
1016124960 6:140388548-140388570 GGGCATGCACACAGACATCCTGG - Intergenic
1018127089 6:160692182-160692204 GAACATTCTCTCAGGAAGCCTGG - Intergenic
1018149470 6:160924897-160924919 GAACATTCTCTCAGGAAGCCTGG + Intergenic
1018890903 6:167980900-167980922 GGGCATGCACGCAGCCAGCCTGG - Intergenic
1019077282 6:169397907-169397929 GAGCCTGCACTCAGGCAGACCGG + Intergenic
1019301685 7:307531-307553 GCATTTGAACACAGGCAGCCTGG + Intergenic
1019340731 7:507666-507688 GAACAAGACCACAGGCATCCCGG + Intronic
1019631173 7:2050606-2050628 GACCATGGACACAGGGACCCAGG + Intronic
1020732234 7:11894838-11894860 GAATTTGCACACAGGCAACATGG + Intergenic
1021270101 7:18574739-18574761 GAGCATGCACATACCCAGCCGGG + Intronic
1021454415 7:20814017-20814039 GAAAATGTACACAGAGAGCCGGG + Intergenic
1022040680 7:26578633-26578655 GAAGATGAAAGCAGGCAGCCAGG - Intergenic
1023877373 7:44294279-44294301 GGACAAGGACACAGGCATCCTGG + Intronic
1024943148 7:54782900-54782922 CAGCCTGCATACAGGCAGCCTGG + Intergenic
1025940295 7:66071965-66071987 GGACATGTACACAGGCACCCAGG - Intergenic
1026371122 7:69700536-69700558 GAAAATCCCCAGAGGCAGCCAGG - Intronic
1026776344 7:73233399-73233421 CAACATGCATACCTGCAGCCGGG + Intergenic
1027017196 7:74786768-74786790 CAACATGCATACCTGCAGCCGGG + Intronic
1027070827 7:75159164-75159186 CAACATGCATACCTGCAGCCGGG - Intergenic
1027420616 7:78014548-78014570 GGACATGCACACAGCCTGCTAGG + Intergenic
1027682054 7:81233479-81233501 AAGCATGCACACACCCAGCCGGG + Intergenic
1031922037 7:127609239-127609261 GAGCATGCACACACCCAGCCAGG + Intergenic
1032012843 7:128358167-128358189 GAACATGCACACGGACAAGCTGG - Intronic
1032221220 7:129995695-129995717 GAAAATGAACACATTCAGCCAGG + Intergenic
1032353167 7:131184840-131184862 AAAGATGCACACACCCAGCCAGG + Intronic
1032363843 7:131280857-131280879 AAACATGGACAAAGACAGCCTGG - Intronic
1034130696 7:148714013-148714035 AAATATACACACATGCAGCCAGG - Intronic
1034202369 7:149290413-149290435 GGACATGCACGCAGGCACCAAGG - Intronic
1034458721 7:151186477-151186499 GCACATGAACACAGGCAGTGTGG + Exonic
1035472475 7:159119249-159119271 CAACATGCTCAGGGGCAGCCAGG - Intronic
1035996337 8:4551543-4551565 GAACCTGCAGAGAGTCAGCCAGG - Intronic
1038311359 8:26448768-26448790 GAACCTGCACAGAGGCGTCCAGG + Intronic
1038627564 8:29208918-29208940 GCAGATGCACAGAGGCAGGCAGG - Intronic
1040080215 8:43276758-43276780 GAAAATGCAAACAGCCAGACCGG - Intergenic
1040339571 8:46433635-46433657 GAACATTGAGACAGGCAGACGGG + Intergenic
1042875916 8:73439863-73439885 GAATTTGGACTCAGGCAGCCTGG + Intronic
1045117447 8:98999011-98999033 GAAAATGCTCACAGGCACCTGGG + Intergenic
1045738997 8:105332105-105332127 GAACAGGAAGACAGGCAGCTTGG - Intronic
1045774355 8:105784751-105784773 TGACTTGCACCCAGGCAGCCTGG + Intronic
1046036802 8:108852729-108852751 GAACTTGAACACATGCAGTCTGG - Intergenic
1047603577 8:126451778-126451800 GAACATGTCCACAGACAGCTAGG - Intergenic
1048354237 8:133640442-133640464 GAACACCAACACAGGCTGCCTGG - Intergenic
1048378165 8:133840780-133840802 AAACCTGCACAGAGACAGCCAGG - Intergenic
1049336366 8:142088835-142088857 CAGTCTGCACACAGGCAGCCCGG + Intergenic
1050426516 9:5517264-5517286 GGACATGTACACTGGCAGCAAGG + Intronic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053596443 9:39566602-39566624 AGATCTGCACACAGGCAGCCTGG + Intergenic
1053619210 9:39798816-39798838 AAGCATGCACACATGCAGCTGGG + Intergenic
1053854407 9:42323242-42323264 AGATCTGCACACAGGCAGCCTGG + Intergenic
1053877368 9:42558165-42558187 AAGCATGCACACATGCAGCTGGG + Intergenic
1053895295 9:42736523-42736545 AAGCATGCACACATGCAGCTGGG - Intergenic
1054144093 9:61549832-61549854 CCACATCCACACAGGCAGACTGG + Intergenic
1054234327 9:62543557-62543579 AAGCATGCACACATGCAGCTGGG - Intergenic
1054264947 9:62908613-62908635 AAGCATGCACACATGCAGCTGGG - Intergenic
1054569816 9:66798416-66798438 AGATCTGCACACAGGCAGCCTGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1056725119 9:89107514-89107536 GCACATGCACACAGGCAAGCTGG + Intronic
1056926645 9:90840100-90840122 GAACATGCACCAAGGGCGCCTGG + Intronic
1057240143 9:93400530-93400552 GGACAGGCGCACAGGGAGCCTGG - Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1060379706 9:123155987-123156009 GAACAGGAACACTGGCAGTCTGG + Intronic
1062576606 9:137211822-137211844 GACCACGCACACAGGCCACCTGG + Intronic
1185729660 X:2451267-2451289 AAAGGTGCACAAAGGCAGCCAGG + Intronic
1185730361 X:2456649-2456671 AAAGGTGCACAAAGGCAGCCAGG + Intronic
1185732627 X:2473650-2473672 AAAGGTGCACAGAGGCAGCCAGG + Intronic
1185733225 X:2477872-2477894 AAAGGTGCACAGAGGCAGCCAGG + Intronic
1187433070 X:19242309-19242331 GAATTTGAACACAGGCAGTCTGG + Intergenic
1189795233 X:44639642-44639664 GAACATGAACAAAGACAGTCTGG + Intergenic
1190128326 X:47724820-47724842 GGTCATGAACACAGACAGCCAGG - Intergenic
1191255009 X:58275924-58275946 GAGGATGGAGACAGGCAGCCAGG - Intergenic
1191257102 X:58284307-58284329 GGAGATGAAGACAGGCAGCCAGG - Intergenic
1193483785 X:82060437-82060459 GCACATTCACACAGGCAGCAGGG - Intergenic
1194212132 X:91082317-91082339 AAGCATGCACACACCCAGCCAGG - Intergenic
1195023298 X:100850727-100850749 GAGGTTGCAAACAGGCAGCCTGG - Intronic
1197139882 X:123105952-123105974 GAATTTGAACACAGGCAGTCTGG + Intergenic
1197673695 X:129307448-129307470 GTACATGCACACAGCCTACCTGG + Intergenic
1198019151 X:132641544-132641566 GAATTTGAACACAGGCAGTCTGG - Intronic
1199991464 X:152989850-152989872 GAGCATGCCCACTGGCACCCAGG - Exonic
1200000787 X:153058839-153058861 GAACATGCCCACTGGCCCCCAGG + Intronic
1201720319 Y:17089686-17089708 GAGCATGCACACAGCTGGCCAGG - Intergenic
1202369297 Y:24186381-24186403 GCACGTGCACACACGCAACCTGG + Intergenic
1202501488 Y:25483736-25483758 GCACGTGCACACACGCAACCTGG - Intergenic