ID: 1147327712

View in Genome Browser
Species Human (GRCh38)
Location 17:39677678-39677700
Sequence CTGAGGAGAGGGGGTGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 798
Summary {0: 1, 1: 0, 2: 3, 3: 78, 4: 716}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1147327699_1147327712 27 Left 1147327699 17:39677628-39677650 CCAGGAGGGCGACAGGCTGCCCA 0: 1
1: 0
2: 0
3: 18
4: 207
Right 1147327712 17:39677678-39677700 CTGAGGAGAGGGGGTGGCCAGGG 0: 1
1: 0
2: 3
3: 78
4: 716
1147327704_1147327712 -4 Left 1147327704 17:39677659-39677681 CCAGAGCTTTGCGTAAACACTGA 0: 1
1: 0
2: 0
3: 6
4: 71
Right 1147327712 17:39677678-39677700 CTGAGGAGAGGGGGTGGCCAGGG 0: 1
1: 0
2: 3
3: 78
4: 716
1147327701_1147327712 8 Left 1147327701 17:39677647-39677669 CCCAGCAGGCACCCAGAGCTTTG 0: 1
1: 0
2: 0
3: 19
4: 249
Right 1147327712 17:39677678-39677700 CTGAGGAGAGGGGGTGGCCAGGG 0: 1
1: 0
2: 3
3: 78
4: 716
1147327702_1147327712 7 Left 1147327702 17:39677648-39677670 CCAGCAGGCACCCAGAGCTTTGC 0: 1
1: 0
2: 0
3: 18
4: 235
Right 1147327712 17:39677678-39677700 CTGAGGAGAGGGGGTGGCCAGGG 0: 1
1: 0
2: 3
3: 78
4: 716
1147327703_1147327712 -3 Left 1147327703 17:39677658-39677680 CCCAGAGCTTTGCGTAAACACTG 0: 1
1: 0
2: 1
3: 4
4: 81
Right 1147327712 17:39677678-39677700 CTGAGGAGAGGGGGTGGCCAGGG 0: 1
1: 0
2: 3
3: 78
4: 716

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1147327712 Original CRISPR CTGAGGAGAGGGGGTGGCCA GGG Intronic
900176781 1:1294629-1294651 CTGTGGGGAGGGGGCGGTCAGGG + Intronic
900329591 1:2127418-2127440 CTGAGGATCTGGGGTGGCCGTGG - Intronic
901012931 1:6211267-6211289 CTGGGCACAGGGGATGGCCAGGG + Intronic
901017867 1:6242113-6242135 CTCAGGAGAGGGGGCGGGCCCGG + Intergenic
901483009 1:9539264-9539286 CTGGGGAGAGGGGCTGGCCTAGG - Intergenic
901610343 1:10493227-10493249 CTGGGGTGAGTGGGTGGACAAGG + Intronic
901636391 1:10672212-10672234 CGGAGGGGAGGGGGTGGCGGGGG - Intronic
902092148 1:13912170-13912192 CTGGGTAAAGGGGGTGCCCAGGG - Intergenic
902383765 1:16065021-16065043 CTGGGGAGAGAGGGTGGAGAAGG - Intronic
902532336 1:17098527-17098549 CTGAGAAGAAGGGCTGGACAAGG - Intronic
902558177 1:17259458-17259480 CTGAGGGGACTGGGTGGCCAAGG + Intronic
902569857 1:17340407-17340429 GTGTGGAGAGAGGGTGGCCAGGG + Intronic
902776172 1:18676388-18676410 CTGGGGAGAGAGGGTGGGGAGGG + Intronic
903269068 1:22176580-22176602 CTCAGCAGAGGGGGTGCTCAGGG + Intergenic
903756843 1:25668236-25668258 CTGAGTGGGTGGGGTGGCCAAGG - Intronic
904036510 1:27561934-27561956 CTGAGGGGAGGGGGTAGCTCAGG + Intronic
904058333 1:27686776-27686798 CAGAGCAGAGGCGGTGCCCACGG + Intergenic
904255058 1:29249488-29249510 CTGTAGAGATGGGGTGCCCAAGG + Intronic
904635936 1:31881374-31881396 CTGAGGACAAGGGGTGGCTGAGG + Intergenic
904688987 1:32279757-32279779 CTGGGGAGGGGGGCTGGGCAAGG + Intronic
904877818 1:33670151-33670173 CTGAGGGGATGGGGAGGACAAGG - Intronic
905050535 1:35047204-35047226 CTGGAGAGAGGGGGAGCCCAAGG - Intergenic
905067511 1:35195795-35195817 ATGAGGAGAGGGGCAGGGCATGG - Intergenic
905205580 1:36341131-36341153 CTGGGGGCAGGGAGTGGCCATGG + Exonic
905351236 1:37347937-37347959 GAGAGGAGAGGAAGTGGCCAGGG - Intergenic
905885268 1:41488401-41488423 CTGGGAAGAGGGGCTGGCCGGGG + Intergenic
906099941 1:43253730-43253752 CTCAGGAGAGGGGCTGGGCTGGG + Intronic
906256537 1:44355023-44355045 CCGAGGAGGGGGCGTTGCCATGG - Exonic
906264649 1:44418691-44418713 ATGAGGAAAGGGGGTGGGGAGGG - Intronic
906766114 1:48435838-48435860 CTGAAGAGAGTCGCTGGCCATGG + Intronic
907383575 1:54110905-54110927 CTAATTAGAGAGGGTGGCCAGGG - Intronic
908393293 1:63702833-63702855 GAGAGGAGAGGGGGTGGGCTGGG + Intergenic
908800537 1:67875576-67875598 CTGAGGCCTGGGTGTGGCCATGG + Intergenic
909013769 1:70362158-70362180 CTGAGAAGCAGGGGTTGCCAAGG + Intronic
909151267 1:72008974-72008996 CTGATGAGAGGTGGTGGTTAGGG - Intronic
909670409 1:78182257-78182279 CTGAGGAGAGGGAGTGTTGATGG - Intergenic
912417798 1:109521859-109521881 GGGAGGACAGGGGTTGGCCAAGG + Intergenic
913346419 1:117815372-117815394 CTGAGGGGAGTGGGTGGACTGGG + Intergenic
913347398 1:117821718-117821740 CTGAGGGGAGTGGGTGGATAGGG + Intergenic
913702979 1:121391330-121391352 CTGAGGGGAGGGATCGGCCAAGG - Exonic
913939935 1:125092605-125092627 CTGAGGGGAGGGATCGGCCAAGG + Intergenic
914043541 1:144071829-144071851 CTGAGGGGAGGGATCGGCCAAGG - Intergenic
914134546 1:144888662-144888684 CTGAGGGGAGGGATCGGCCAAGG + Exonic
914249643 1:145911126-145911148 CTGAGGAGTTGGGGTGGCAGAGG - Intergenic
915129709 1:153688008-153688030 CTGAGGGGTGGGGCTGGCCAAGG - Intronic
916797540 1:168180603-168180625 TTGAGCAGAGGGAGTGACCAGGG + Intronic
918232450 1:182548601-182548623 TTTTGGAGAGGGGGTGGTCATGG + Intronic
918313218 1:183301601-183301623 CTGAGGACAGGATGTGGCAACGG - Intronic
918406209 1:184214035-184214057 CTGAGGAGGGGAGGGGGGCAGGG - Intergenic
918455720 1:184711348-184711370 CTGAGGACACTGGGAGGCCAAGG - Intronic
919570542 1:199242941-199242963 CTGGGCAGAGGGGGAGGCCCTGG - Intergenic
920009215 1:202855626-202855648 CTGTGGAGAAGTGGTGCCCAAGG - Intergenic
920347949 1:205318706-205318728 TTTAGGGGAAGGGGTGGCCAGGG + Intronic
920658044 1:207891015-207891037 CTGGGGAGCGGGGGTGCTCAAGG - Intronic
920688665 1:208129215-208129237 CTGAGGGGAGGGGATTGGCAAGG + Intronic
921034083 1:211359720-211359742 CTGAGGAGAGGGCATGGGGAGGG - Intronic
921408818 1:214812566-214812588 CTGTGGTGAGCGAGTGGCCAAGG + Intergenic
922619334 1:226980586-226980608 CTAAGGCAAGGGGGTGGCCGAGG + Intronic
922746786 1:228048752-228048774 ATGAGGAGAGGGGGTGGGCCTGG - Intronic
923009880 1:230080291-230080313 CTGTGGAGAAGGGGAGGCCTCGG + Intronic
923674075 1:236065152-236065174 GGGAGGAGAGGGGGCTGCCAGGG - Exonic
923846152 1:237734949-237734971 ATGAGGAGAGGAGGAGGCCTAGG + Intronic
1062952611 10:1516089-1516111 CTGGGAAGAGGGTGTGGTCAGGG - Intronic
1063364382 10:5480890-5480912 CTGGGGAGTGGGGCCGGCCACGG - Intergenic
1063688016 10:8257056-8257078 ATTAGGTGAGAGGGTGGCCAGGG + Intergenic
1064698239 10:17989388-17989410 CTGAGTAGAGGCGGCGGCCCAGG + Intronic
1065099637 10:22320954-22320976 CGGAGGGGAGGGGGCGGCCACGG + Intronic
1065396344 10:25242592-25242614 CTGAAGAGAGAGAATGGCCAAGG - Intronic
1065881627 10:30042346-30042368 CAGAGGGGAGGGGCTGGACAAGG - Intronic
1066744715 10:38596022-38596044 CGGAGGGGAGGGATTGGCCAAGG - Intergenic
1066955966 10:42172489-42172511 CTGAGGGGAGGGATCGGCCAAGG - Intergenic
1067130834 10:43564017-43564039 CTGAGAAGAGGTGGTGAACATGG - Intronic
1067789376 10:49276290-49276312 CTGAGGAGAGGGTCTCGCCCTGG - Intergenic
1068861869 10:61855661-61855683 CTGAGGAAAGGAGGTGGGTAGGG + Intergenic
1069709452 10:70479272-70479294 CTCGGGAGAGGGGGTAGCCCAGG - Intronic
1069886606 10:71627756-71627778 CTCAGGAGTGTGGGTGGCCGTGG - Intronic
1069948340 10:72002390-72002412 CAGAGGGAAGGGGGTAGCCAGGG + Intronic
1070179359 10:73998915-73998937 CTGGGGAGCGGGGGTGGGCGAGG - Intronic
1070749028 10:78953090-78953112 CTGAGGAGAGGCAGTGGTCCTGG + Intergenic
1071576387 10:86729795-86729817 CTGGGGAGAGAAGGTGTCCAGGG - Intronic
1072295679 10:94007326-94007348 GGGAGGGGAGGGGATGGCCAAGG + Intronic
1072625282 10:97107423-97107445 CTGGGGAGAAGGGGAGGCCCAGG - Intronic
1072686421 10:97539994-97540016 CTCAGGAGAGGGGGCGGAAATGG - Intronic
1073654609 10:105399641-105399663 CTCAGGAGGGGAAGTGGCCAAGG + Intergenic
1074045574 10:109835564-109835586 CTCAGGACAAGGGCTGGCCAGGG + Intergenic
1075197888 10:120377028-120377050 GTCAGGAGAGGGGCTGTCCACGG - Intergenic
1075906465 10:126085975-126085997 CTGGGGAGAGGAGGAAGCCATGG + Intronic
1076015173 10:127021950-127021972 CTTGGGAGAGCGGGTGGTCAGGG + Intronic
1076209922 10:128632328-128632350 CTGGGAGGAGGGGGAGGCCAGGG - Intergenic
1076274276 10:129183310-129183332 GCAAGGAGAGGGGCTGGCCAGGG - Intergenic
1076712419 10:132345678-132345700 CTGAGGGCATGGGGTGGCCGAGG + Intronic
1076920094 10:133446640-133446662 CTGAGGAGTGGGGGCGTCCGGGG - Intergenic
1077061109 11:618284-618306 CGGGGGGGAGGGGGTGGGCAGGG - Intronic
1077064963 11:637056-637078 ATGAAGCGAGGTGGTGGCCACGG - Intergenic
1077299537 11:1840669-1840691 CTGGGGAGGCGGGGTGGCCGGGG - Intronic
1077302770 11:1854882-1854904 CAGCTGGGAGGGGGTGGCCAAGG - Intronic
1077308997 11:1880282-1880304 CTGGGCAGAGGGGGAGGTCAAGG + Intronic
1077432688 11:2523833-2523855 CTGAGGAGGGAAGGGGGCCATGG - Intronic
1077538226 11:3134558-3134580 CTGAGAAGAGCGGCTGGGCAGGG - Intronic
1078065734 11:8078127-8078149 CTTGGGAGAGGGGGTGGCCCTGG + Intronic
1078363319 11:10687114-10687136 GGGAGGAGAGGGGGTGCCCATGG + Intronic
1078442452 11:11378873-11378895 TAGAGGGGAGGGGGTAGCCAGGG - Intronic
1079015077 11:16861993-16862015 CTGAGAAGAGGGGGTGTGGAGGG - Intronic
1079104443 11:17561335-17561357 ATGAGGAGAAGGGGTTTCCATGG + Intronic
1080048620 11:27835937-27835959 CTCAGGAGAGAGTGTGGCCCTGG - Intergenic
1080264539 11:30387762-30387784 CTGGAGAGAGGGGGGGACCATGG - Intronic
1082001932 11:47398024-47398046 CTGGGAAGAGGTGGTGGCCGTGG - Intergenic
1082909404 11:58353620-58353642 GTGAGGAGAGGGGCTGGTCAGGG + Intergenic
1083260008 11:61517814-61517836 CTGAGCAGAGGGGGGCACCAAGG + Intronic
1083476932 11:62921137-62921159 CTGGGGAGCGGGGGAGGGCAGGG - Intronic
1084009156 11:66338185-66338207 CTGAGGAAAGGTGATGGCAAGGG + Intronic
1084188835 11:67489666-67489688 ATGAGGAGACCGGGTGGGCAGGG - Intronic
1084311942 11:68322143-68322165 CTGAAGTGAGGAGGCGGCCAGGG - Intronic
1084938514 11:72600156-72600178 CTGAGGGCAGGGGGTGCCCTGGG + Intronic
1084980407 11:72825818-72825840 CTCTGGAGAGGGGGTGTCCTGGG + Intronic
1085332708 11:75667332-75667354 CTGGGGAGAGGGTGTGGCCTGGG + Intronic
1085340177 11:75726206-75726228 CTGGGGAAAGAGAGTGGCCAAGG + Intronic
1085476984 11:76795121-76795143 CTGAGGGTAGGGTGTGCCCAGGG - Intronic
1089465310 11:118681115-118681137 CAGGGGACAGGGGGTGGGCAAGG + Intergenic
1089623069 11:119733794-119733816 GTGAGGAGAGAGGGTTGTCATGG + Intergenic
1089923167 11:122229819-122229841 CTGAGGAGGGGGTGTGGCGTCGG - Intergenic
1089925302 11:122250953-122250975 ATGAGGAGAGTGGCTGGGCACGG + Intergenic
1090355864 11:126139975-126139997 CTTAGGAGAGGTGGGGGTCAGGG + Intergenic
1090622777 11:128576138-128576160 CTGACAAGAGGGAGTTGCCAGGG + Intronic
1091445716 12:543309-543331 CTGAGGAGCTGGGATGGGCATGG + Intronic
1091445740 12:543393-543415 CTGAGGAGCTGGGGCGGGCATGG + Intronic
1091445752 12:543435-543457 CTGAGGAGCTGGGGCGGGCATGG + Intronic
1091445784 12:543561-543583 CTGAGGAGCTGGGATGGGCATGG + Intronic
1091445796 12:543603-543625 CTGAGGAGCTGGGGCGGGCATGG + Intronic
1091445808 12:543645-543667 CTGAGGAGCTGGGGCGGGCATGG + Intronic
1091445829 12:543729-543751 CTGAGGAGCTGGGATGGGCATGG + Intronic
1091445851 12:543813-543835 CTGAGGAGCTGGGATGGGCATGG + Intronic
1091445863 12:543855-543877 CTGAGGAGCTGGGGCGGGCATGG + Intronic
1091445896 12:543981-544003 CTGAGGAGCTGGGGCGGGCATGG + Intronic
1091445908 12:544023-544045 CTGAGGAGCTGGGGCGGGCATGG + Intronic
1091445919 12:544065-544087 CTGAGGAGCTGGGGCGGGCATGG + Intronic
1091453444 12:587690-587712 GTGGGGGGTGGGGGTGGCCAGGG + Intronic
1091548157 12:1518367-1518389 CAGCAGAAAGGGGGTGGCCAGGG + Intergenic
1091672478 12:2462233-2462255 CTGAGCCGAGGTGGGGGCCAAGG - Intronic
1091794850 12:3292218-3292240 CAGAGGGGTGGGGGTGGCCTGGG - Intergenic
1091838467 12:3602533-3602555 CAGAGTAGTGGGGGTGGCCAGGG - Intergenic
1092256438 12:6928581-6928603 CCGAGGAGAGTCGGGGGCCAGGG + Intronic
1094839413 12:34336725-34336747 GTGTGGCGTGGGGGTGGCCAGGG - Intergenic
1096616160 12:52834581-52834603 CTGGGTGGTGGGGGTGGCCATGG - Intergenic
1097021775 12:56025890-56025912 CTGAGGAGAGGAGGCGACTAAGG - Intronic
1098387679 12:69935972-69935994 CAGGGGGGAGGGGATGGCCACGG - Intronic
1099590053 12:84575339-84575361 CTGTGGGGAGGGGGTGGCTGTGG + Intergenic
1100818738 12:98411164-98411186 CTAAGGAGAGAGTATGGCCAAGG - Intergenic
1101006269 12:100403952-100403974 CTGTGGAGTGGAGGTGGGCAAGG + Intronic
1102506864 12:113389302-113389324 CTGAGGTGAGGGGCAGGCCTGGG - Exonic
1102574500 12:113847617-113847639 CGGTGGGGTGGGGGTGGCCAAGG + Intronic
1103294748 12:119876842-119876864 ATGAGGTGATGGGGTGGGCACGG + Intronic
1103347342 12:120260017-120260039 CTGAGCAGAGGAGGTGGCAAGGG + Intronic
1103921579 12:124402191-124402213 CGGAGGAGAGGGGGGAGCCAGGG + Intronic
1103960146 12:124604226-124604248 CTGAGGCAGGGGGATGGCCAGGG + Intergenic
1104822150 12:131683415-131683437 CTGAGGATGGGCTGTGGCCAGGG + Intergenic
1104974528 12:132546471-132546493 CCTAGGAGAGGGCTTGGCCACGG + Intronic
1104974544 12:132546517-132546539 CCTAGGAGAGGGCTTGGCCACGG + Intronic
1104974560 12:132546563-132546585 CCTAGGAGAGGGCTTGGCCACGG + Intronic
1104974577 12:132546610-132546632 CCTAGGAGAGGGCTTGGCCACGG + Intronic
1105019116 12:132804683-132804705 GGGAGGGGAGGGCGTGGCCAGGG + Intronic
1105661329 13:22498542-22498564 TTGAGGAGACGGGGTGGGAAGGG + Intergenic
1105850277 13:24328177-24328199 GGGGGGAGAGGGGGTGCCCAAGG + Intergenic
1106025635 13:25953038-25953060 CTGAGAAGAGAAGGTGGCAATGG + Intronic
1106070985 13:26410735-26410757 CTGAGGAAGGGTGGAGGCCAGGG - Intergenic
1107288434 13:38823476-38823498 ATGAGGAGATGGGGTGAACAAGG - Intronic
1107317580 13:39150252-39150274 CTGAGAAAAGGGGCTGGCAAGGG + Intergenic
1107833951 13:44398676-44398698 CTGGGGAGTGGGAGTGGCAAGGG - Intergenic
1109169619 13:59079248-59079270 CTGAGGAGAAAAGGTGACCAAGG - Intergenic
1111328071 13:86725384-86725406 GTCAGGAGAGAGGGTGGCCATGG - Intergenic
1112788683 13:102979977-102979999 CTTCGGGGAGGGGCTGGCCATGG + Intergenic
1113434707 13:110281911-110281933 CTGAGCAGGGAAGGTGGCCAGGG - Intronic
1113647749 13:112011100-112011122 CTGGGCAGAGGGGCTGTCCAAGG - Intergenic
1114548494 14:23520177-23520199 TTGAGGGGATGGGGTGGGCAAGG - Intergenic
1114612854 14:24053648-24053670 CTGGGAGGTGGGGGTGGCCAGGG + Intronic
1115207485 14:30925220-30925242 CTGGGGGGAGGGGGCGGGCAGGG + Intronic
1115306663 14:31940666-31940688 CTGAGCAGAGGGGGTGGGAGGGG - Intergenic
1118652176 14:67908308-67908330 CAGAGAAGAGTGGGTGGCTAGGG + Intronic
1119380352 14:74224404-74224426 CTGAGGGGAGAGGGTGGGGAGGG + Intergenic
1119605717 14:76014655-76014677 CTGAGGAGAAGGAGAGGTCAAGG - Intronic
1119910590 14:78346042-78346064 CTCAGGAGAGGGAAAGGCCATGG + Intronic
1120669442 14:87347299-87347321 CTGAGGAGTGGGGGTGGGGATGG + Intergenic
1121220047 14:92278188-92278210 CTGACCAGAGGAGGTGGTCAGGG + Intergenic
1121515719 14:94548595-94548617 CTGAGGAGAGAGGGAGGGGATGG - Intergenic
1121823850 14:96994232-96994254 GTGGGGAGATGGGGTAGCCATGG + Intergenic
1122118410 14:99538891-99538913 CTGAGGTGAGGTGCTGGCTATGG - Intronic
1122267942 14:100555344-100555366 ATGAGGAACGAGGGTGGCCACGG - Intronic
1122374092 14:101247199-101247221 CTGGGGAGAGGGGTTCACCAAGG - Intergenic
1122444756 14:101760914-101760936 CCGAGGGGAGGGGCTGGCCGAGG + Intergenic
1122799726 14:104223507-104223529 CCAAGGAAAGGGGGTGGCCCAGG - Intergenic
1122870000 14:104634189-104634211 CTCAGGCCAGGGGGCGGCCAGGG - Intergenic
1122954563 14:105064622-105064644 ATGAGGATAGGGGCTGGGCACGG - Intronic
1122968889 14:105144439-105144461 CAGAGCAGTGGGTGTGGCCATGG - Intronic
1123014587 14:105367727-105367749 CTGAGGAGTAGGGGAGGCCCTGG - Intronic
1123142004 14:106088744-106088766 CTGAGGAGAGGGCAGGGCCCAGG + Intergenic
1123200470 14:106658349-106658371 CTGAGGAGAGGGCAGGGCCCAGG + Intergenic
1202840989 14_GL000009v2_random:121151-121173 TTGAGGAAAGGGGGTGGGTAAGG - Intergenic
1202910374 14_GL000194v1_random:111379-111401 TTGAGGAAAGGGGGTGGGTAAGG - Intergenic
1202937035 14_KI270725v1_random:98902-98924 CTGAGGAGAGGGATCCGCCAAGG + Intergenic
1123919405 15:25060004-25060026 CTGAGGACAGGGGAGTGCCAAGG + Intergenic
1123920330 15:25065533-25065555 CTGAGGACAGGGGAGTGCCAAGG + Intergenic
1124003644 15:25779590-25779612 CTGGGGCGAGGGGGTGGCATCGG + Intronic
1125277071 15:38004380-38004402 ATGACCAGATGGGGTGGCCAGGG - Intergenic
1125609538 15:40961129-40961151 CTGAGGCAAGGGTGAGGCCAGGG - Intergenic
1126152428 15:45535652-45535674 CTAAGGAGAAGGGGTTCCCAAGG - Intergenic
1128110261 15:65071690-65071712 CTCAGGAGAGGGCCTGGCAATGG + Intronic
1128686512 15:69690262-69690284 ATGAGGTGAGGGGGTGCACAGGG + Intergenic
1128726240 15:69990624-69990646 ATGAGGAGCTGGGATGGCCAGGG + Intergenic
1129168631 15:73794238-73794260 CTGTGGAAAGGGAGTGGTCATGG + Intergenic
1129180786 15:73873708-73873730 TTCAGGAGAGAGGGTGGTCATGG - Exonic
1129199117 15:73988361-73988383 CTGAGAAGAGGAAGTGGCCCCGG - Intronic
1129292525 15:74579271-74579293 GGGAGGGGAGGGGGTCGCCAAGG - Intronic
1129298591 15:74612986-74613008 CTGAGCAGGGGGGCAGGCCAGGG + Intronic
1129539996 15:76341372-76341394 GAGAGGGGAGGGGGTGGCCTTGG + Intronic
1129687534 15:77695271-77695293 GTGAGCAGATGGGGTGGGCAGGG + Intronic
1129755176 15:78093789-78093811 AGGTGGAGAGTGGGTGGCCAGGG + Intronic
1129775634 15:78234560-78234582 GTGAGCAGTGGGGGTGGGCATGG + Exonic
1129924501 15:79350879-79350901 CTGGTGAGAGGTGGTGGCAAAGG - Intronic
1130051121 15:80484793-80484815 CTGAGGAGTGGTGGTGGGGATGG + Intronic
1130060728 15:80567963-80567985 CTGAGGGGAGGGGATGGCGAGGG + Intronic
1130551717 15:84893659-84893681 TGGAGAAGAGGGGGTCGCCATGG - Intronic
1130597652 15:85258258-85258280 GTGAGTAGAGGGAGTGGCCTTGG - Intergenic
1131343660 15:91626717-91626739 ATGAAGAGAGGAGGGGGCCAGGG + Intergenic
1132663248 16:1070801-1070823 CTCAGGAGAGGGGGTGTCACGGG + Intergenic
1132683694 16:1153694-1153716 CAGAGGACAGGGGGTGACCCGGG - Intronic
1132870447 16:2113398-2113420 CAGAGGAGAGGAGGTGCCCGGGG + Intronic
1132879064 16:2153296-2153318 CTGCGGAGTGGGGGTGACAAGGG - Intronic
1132905849 16:2282617-2282639 CTGAGCAGAGGTGGTGCCCAGGG - Intronic
1132905873 16:2282691-2282713 CTGAGCAGAGGTGGTGCCCAGGG - Intronic
1132905897 16:2282765-2282787 CTGAGCAGAGGTGGTGCCCAGGG - Intronic
1132905920 16:2282839-2282861 CTGAGCAGAGGTGGTGCCCAGGG - Intronic
1132905943 16:2282913-2282935 CTGAGGAGAGGTGGTGCCCAGGG - Intronic
1132995401 16:2820008-2820030 CTGGGGAGAGAGGGTGGCAGAGG - Intronic
1133100410 16:3475938-3475960 ATGGGGAGAGAGGCTGGCCAGGG + Intronic
1133111426 16:3550278-3550300 CTGAGGACAGTGTGTGCCCAGGG + Intronic
1133221826 16:4322157-4322179 CTGAGGAAGGGGGGTGCCAAAGG + Intronic
1134522093 16:14923527-14923549 CAGAGGAGAGGAGGTGCCCGGGG - Intronic
1134709762 16:16322178-16322200 CAGAGGAGAGGAGGTGCCCGGGG - Intergenic
1134716976 16:16362208-16362230 CAGAGGAGAGGAGGTGGCCGGGG - Intergenic
1134949841 16:18346467-18346489 CAGAGGAGAGGAGGTGCCCGGGG + Intergenic
1134957775 16:18389951-18389973 CAGAGGAGAGGAGGTGGCCGGGG + Intergenic
1135543406 16:23349586-23349608 CTGAAGACAGAGGGTGCCCAAGG - Intronic
1135559284 16:23463139-23463161 TTGAGGCGAGAGGGTTGCCAGGG + Intergenic
1135698473 16:24610786-24610808 CTGAGGGCAGGGGGTGGAAAGGG - Intergenic
1135992170 16:27224735-27224757 CTGGGGAGCTGGGGAGGCCAAGG + Intergenic
1136269073 16:29137929-29137951 CTGCGGAGACGGGGGGCCCATGG + Intergenic
1136413520 16:30090740-30090762 GGGAGGTGAGGGGCTGGCCAGGG - Exonic
1136576463 16:31128135-31128157 ATAAGGTGAGTGGGTGGCCAGGG + Exonic
1136620844 16:31427698-31427720 CTGTGGGGAGGGCGGGGCCACGG - Intergenic
1136656384 16:31711712-31711734 GTGCAGAGAGGGAGTGGCCATGG - Intergenic
1136698633 16:32110992-32111014 CTGAGGGGAGGGATCGGCCAAGG - Intergenic
1136768975 16:32816838-32816860 CTGAGGGGAGGGATCGGCCAAGG + Intergenic
1136799135 16:33054286-33054308 CTGAGGGGAGGGATCGGCCAAGG - Intergenic
1136956818 16:34797242-34797264 CTGAGGGGAGGGATCGGCCAAGG - Intergenic
1137629403 16:49931620-49931642 CAGAGGAGAGGGGTTTGCCCAGG + Intergenic
1137661040 16:50206636-50206658 CTGAGCAGAGGGGCTGGCCGTGG + Intronic
1137861842 16:51854722-51854744 CTGGGGTGAGGGGCTGGGCATGG + Intergenic
1138247918 16:55480609-55480631 CTGAGGAGAGAGGCAGGCCAGGG + Intronic
1140062368 16:71581950-71581972 CCGAGGCGAGGGTGTGTCCATGG - Intergenic
1140097183 16:71884545-71884567 CTAAGGAGAGGGGGTGCCTGCGG - Intronic
1141140822 16:81495773-81495795 CCCAGGAGAGTGAGTGGCCATGG - Intronic
1141648601 16:85380411-85380433 CTGAACAGTGGGGTTGGCCAAGG - Intergenic
1142287204 16:89176306-89176328 CTGAGGAGAGCGGGCAGCCTCGG + Intronic
1142426091 16:90003099-90003121 CTCATGAAATGGGGTGGCCATGG - Intergenic
1203071390 16_KI270728v1_random:1078946-1078968 CTGAGGGGAGGGATCGGCCAAGG + Intergenic
1143005368 17:3829014-3829036 CAGCTGAGAGGTGGTGGCCAGGG - Intronic
1143095962 17:4478549-4478571 CTGTGGACAGAGGGTGGCCTGGG - Intronic
1143107523 17:4536980-4537002 CTAAGGAAAGGGGAAGGCCAGGG + Intronic
1143704572 17:8687637-8687659 CGGGGGAGAGGGGGTGGGAAGGG - Intergenic
1144034706 17:11354742-11354764 CTGAGGATAGGGGGTGGGGGAGG - Intronic
1144662151 17:17078088-17078110 CTGGGGACAGGGAGTGGGCAAGG - Intronic
1144828916 17:18121172-18121194 CTGAGGCGACGGGGGCGCCAAGG - Exonic
1145209516 17:21002945-21002967 CTTGGGGGAGGGGGGGGCCAGGG + Exonic
1145692790 17:26761251-26761273 CTGAGGGGAGGGATCGGCCAAGG - Intergenic
1145916470 17:28576955-28576977 CTGGGGAGGGGGTGTGGTCAGGG - Exonic
1145937876 17:28725869-28725891 CTGTGGAAATGAGGTGGCCAGGG - Intronic
1146473433 17:33142689-33142711 CTGAGTAGAGGGTGTGGTCATGG - Intronic
1146658969 17:34652000-34652022 CTGAGCAGAGGGGCTGGCTTCGG - Intergenic
1146674405 17:34763293-34763315 CTGTGGACACGGTGTGGCCATGG + Intergenic
1146936189 17:36814030-36814052 GTGTGGTGAGGGGGTGGACAGGG - Intergenic
1147327712 17:39677678-39677700 CTGAGGAGAGGGGGTGGCCAGGG + Intronic
1147391201 17:40110355-40110377 CCAAGGAGAGGGGCTGGGCATGG - Intergenic
1147426520 17:40348363-40348385 CGGGGTAGAGGGGGTGGCGAGGG - Exonic
1147951125 17:44108619-44108641 ATGGGGAGAGGGGGTGGGGAGGG + Intronic
1148246295 17:46033028-46033050 CTGTGGAGAGAGGGTGGACAGGG - Intronic
1148326943 17:46788856-46788878 CTGAGGGCAGGTGATGGCCATGG + Intronic
1148385360 17:47230611-47230633 CAGAGGAGGAGGGGTGGTCAGGG + Intergenic
1148597719 17:48870188-48870210 CTGAGGAGAGGCGGCGGCATAGG - Intergenic
1148735148 17:49860958-49860980 CTGAGGACTGGGGGTCCCCATGG + Intergenic
1148746416 17:49920734-49920756 TTGAGGAGAGGCAGAGGCCAGGG - Intergenic
1148857145 17:50584977-50584999 CAGAGGAGAGGAGGAGGGCAAGG + Intronic
1149485489 17:57039622-57039644 GTGAGGAGAGGGGGCATCCAAGG - Intergenic
1150345864 17:64404274-64404296 CTGAGGTGAGGCCGTGGGCAGGG - Intronic
1150363024 17:64554435-64554457 ATGGGGAGAGGGAGTGGTCATGG + Intronic
1151248409 17:72814570-72814592 CAGAGGAGAGGGGGATGCCCTGG + Intronic
1151393247 17:73801956-73801978 ATGAGGAGAGGCGGGTGCCAAGG - Intergenic
1151685481 17:75643696-75643718 CTGAAGACAGGTGGGGGCCATGG + Intronic
1151700898 17:75742129-75742151 CTGAGGACAGGGAGGCGCCATGG + Intronic
1151716835 17:75835391-75835413 ATGAGGTGGGGGCGTGGCCAGGG - Exonic
1152239333 17:79153285-79153307 ATGTGCAGAGGGTGTGGCCAGGG + Intronic
1152637416 17:81435800-81435822 CTGAGGAGTGGGGGAAGGCAGGG - Intronic
1152691490 17:81720176-81720198 CTGCGGAGGACGGGTGGCCACGG - Exonic
1152702309 17:81825171-81825193 GTGGGCAGAGGGGGTGGCCCTGG + Exonic
1152937641 17:83149819-83149841 GTGAGGAGTGGAGGTGGCCCTGG - Intergenic
1153632279 18:7082976-7082998 TTGAGGAGGGGAGGGGGCCAGGG + Intronic
1155220481 18:23680931-23680953 TTGAGGACAGGGGCTGGCCCAGG - Intergenic
1156029918 18:32700796-32700818 CTGGGGAGAGGGAGCGGCAAGGG + Intronic
1156449561 18:37259270-37259292 GTGAGGGGAGGGGGTGGGCGGGG + Intronic
1156490110 18:37491140-37491162 GTGAGGAGAGGAGGTGGGCATGG - Intronic
1156490120 18:37491175-37491197 GTGAGGAGAGGAGGTGGGCACGG - Intronic
1156490129 18:37491210-37491232 GTGAGGAGAGGAGGTGGGCACGG - Intronic
1156490138 18:37491244-37491266 GTGAGGAGAGGAGGTGGGCACGG - Intronic
1157202586 18:45671817-45671839 CTGAGGAGAGGCAGTGTCCTGGG - Intronic
1157511568 18:48279149-48279171 CTGAGGAGTGGGGGTGCCGGGGG - Intronic
1157757518 18:50231918-50231940 CCCAGGAGAGGGGGTGGGTAAGG - Intronic
1158938015 18:62383048-62383070 GTGTGGAGAGGGGGTGGAGAAGG + Intronic
1159018931 18:63127310-63127332 GTGAGGAGAGGCAATGGCCACGG - Exonic
1160178168 18:76612747-76612769 CAGAGGAGGTGGGGTGGCCAGGG + Intergenic
1160250385 18:77198810-77198832 CTGAGCTGACGGGGTGGCCCAGG - Intergenic
1160269867 18:77373605-77373627 CTGAGGGGAGGGGCAGGACAAGG + Intergenic
1160554984 18:79719018-79719040 GTCAGGAGCAGGGGTGGCCAGGG + Intronic
1160803169 19:979815-979837 CTGGGGAGAGGTGGGGGCCTGGG - Intergenic
1160855384 19:1214968-1214990 CAGAGGAGATGCGGTGGCCGGGG - Intronic
1160876800 19:1300187-1300209 CAGAGGAGATGGCCTGGCCACGG - Exonic
1160893230 19:1390431-1390453 GAGAGGGGAGGGAGTGGCCAAGG + Intronic
1161149576 19:2700976-2700998 CTGGGGAGCGGGGGTTGCTAGGG - Intronic
1161332413 19:3694610-3694632 CTGAGGACAGCGGGTGGCACGGG - Intronic
1161507932 19:4654062-4654084 CTGAGATGAAGGTGTGGCCAGGG - Exonic
1161845488 19:6709760-6709782 CTGAAGATAGAGGGTGACCACGG - Exonic
1161909151 19:7179741-7179763 CTGAGAACGGGGGTTGGCCAAGG - Intronic
1161966254 19:7550824-7550846 CTGGGGAGAGGGAGAGGACAGGG - Intronic
1162127833 19:8508865-8508887 CTGAGGAGTGGGGTGGGTCAAGG - Intergenic
1162174952 19:8823636-8823658 GGCAGGAGAGGGGGTGACCAAGG - Intronic
1162322701 19:9979259-9979281 CTGTTGAGTGGGGGTGGCCTAGG + Intronic
1162391859 19:10394876-10394898 ATCAGGAGAGGGTGGGGCCAGGG - Intronic
1162771574 19:12952629-12952651 CTGGGGAGAGGAGGGGACCAGGG + Intronic
1162998556 19:14351574-14351596 CAGGGGAGAGAGGGTGGTCAGGG - Intergenic
1163342017 19:16714817-16714839 CTGCGGAGAGGCGCTGGACAGGG - Intergenic
1163431271 19:17269092-17269114 GTAAGTAGAGGGGGTGGCCTGGG + Intronic
1163641811 19:18466374-18466396 ATGCTGAGAGGGGGTCGCCAAGG - Intronic
1163786668 19:19278313-19278335 CTGAGGAGAGAGGGCTGACATGG - Intronic
1164515884 19:28934778-28934800 CTGGGGAGAGGATGGGGCCAAGG + Intergenic
1164871834 19:31652009-31652031 TAGAGGAGAGGAGGGGGCCATGG - Intergenic
1165081027 19:33306025-33306047 CAGAGGACAGGGGGTGTCTAGGG + Intergenic
1165363561 19:35350997-35351019 ATAAGGTGAGGGTGTGGCCAGGG - Intergenic
1165751461 19:38263079-38263101 CTGAAGAGTGGGAGTGGCCCTGG + Intronic
1165778282 19:38417717-38417739 CTGTGGAGAGAGTGGGGCCAGGG + Intronic
1166007529 19:39917677-39917699 CTGGGGAGCAGGGGTGGTCAGGG - Intronic
1166107852 19:40606203-40606225 GAGAGGAGAGGGGTGGGCCAGGG - Intronic
1166209543 19:41297363-41297385 CTGAGGAGAGTGGGGAGTCATGG + Intronic
1166267738 19:41695530-41695552 CTGAGTAGAGAGTCTGGCCATGG - Intronic
1166294534 19:41882725-41882747 GAGAGGAGAGGTGGAGGCCAAGG + Intergenic
1166372676 19:42310737-42310759 CTGAGGAGAGGCTGAGGCTAGGG + Exonic
1166673527 19:44725446-44725468 GGGAGGAGAGGGGATGGGCAGGG + Intergenic
1166784006 19:45357184-45357206 CTGAGCAGTGGGGGAAGCCAAGG + Intronic
1166884968 19:45954571-45954593 CTGAGGGGTGGGGGAGGGCAGGG + Intronic
1167296672 19:48654553-48654575 CTGGGGACTGGGGGTGGCCAGGG - Intergenic
1167299631 19:48671297-48671319 TGGAGCAGAGGGGCTGGCCAAGG + Intronic
1167493805 19:49806631-49806653 CAGAGGAGATGGGGAGCCCAGGG - Intronic
1167558906 19:50213495-50213517 CTGAGCTAAGGTGGTGGCCAGGG + Intronic
1167703657 19:51065751-51065773 GGGTGGAGAGGGGGAGGCCAGGG - Intergenic
1167745964 19:51352043-51352065 CTGAGCAGAGGTGGTGCCCGAGG + Intronic
1167767262 19:51491752-51491774 CTCTGGGGAGGGGGTGGCCAGGG + Exonic
1168073130 19:53963519-53963541 CAGAGGAGGAGGGGTGCCCAAGG - Intronic
1168267771 19:55231740-55231762 CCGAGGCCAGGAGGTGGCCATGG - Intronic
1168312273 19:55466481-55466503 CAGAGGAGAGAGGCTGGGCACGG - Intergenic
1168327024 19:55543775-55543797 CTGAGGTTAGGGTGTGGGCATGG - Intronic
1168465154 19:56595586-56595608 CTGAGGAGAGGCCGGGGCCAGGG + Intronic
1168686860 19:58354135-58354157 GTGAGGAGAGGGGGAGGCAGGGG - Intergenic
1202631322 1_KI270706v1_random:2619-2641 TTGAGGAAAGGGGGTGGGTAAGG + Intergenic
1202657815 1_KI270708v1_random:40215-40237 TTGAGGAAAGGGGGTGGGTAAGG + Intergenic
1202682788 1_KI270712v1_random:24165-24187 CTGAGGGGAGGGATCGGCCAAGG - Intergenic
925129864 2:1487137-1487159 CTTAGCTGAGGGAGTGGCCAGGG - Intronic
925712399 2:6754141-6754163 CGGAGGAGAGGCGGAGTCCAGGG + Intergenic
926052668 2:9754714-9754736 CTGGAGAGAGAGGGTGGGCAGGG + Intergenic
926233844 2:11024598-11024620 CTGTGGGGATGGGGCGGCCAAGG - Intergenic
927214846 2:20662465-20662487 CAGAGGAGAGGGGAGGGCAAAGG + Intergenic
927873538 2:26639668-26639690 ATGAGGATGGGGGATGGCCAGGG - Intronic
930730762 2:54725254-54725276 ATCAGGTAAGGGGGTGGCCAGGG + Exonic
930826329 2:55700300-55700322 CTGAGGGGAGGGGGAGGGGAGGG - Intergenic
932440028 2:71728883-71728905 CTGGGGAGAGGGGCTGGGCTGGG - Intergenic
932606036 2:73166352-73166374 CTGAGGAGTGGGGGGGGCGCAGG - Intergenic
932631007 2:73343324-73343346 CTGAGAAAAGGGGGTGGAAAAGG + Intergenic
932667369 2:73708282-73708304 CTGGGCAGACGGGGTGGCCAGGG - Intergenic
933727804 2:85436456-85436478 CGGAGGAGAAGAGCTGGCCAGGG - Exonic
933926391 2:87094099-87094121 CTGAGGAGTGGGGGGGCGCAGGG + Intergenic
933975352 2:87504880-87504902 TTCAGGAGAGGGGGTGGGCATGG + Intergenic
934249012 2:90331010-90331032 CTGAGGGGAGGGATCGGCCAAGG + Intergenic
934260565 2:91472462-91472484 CTGAGGGGAGGGATCGGCCAAGG - Intergenic
934303881 2:91804417-91804439 CTGAGGGGAGGGATCGGCCAAGG - Intergenic
934329373 2:92048334-92048356 CTGAGGGGAGGGATCGGCCAAGG + Intergenic
934467592 2:94278251-94278273 CTGAGGGGAGGGATCGGCCAAGG + Intergenic
934613080 2:95755047-95755069 CAGAGGAGCAGGGGTGTCCAGGG + Intergenic
934686387 2:96325156-96325178 CAGCGGAGAGTGTGTGGCCACGG + Intergenic
934841194 2:97625196-97625218 CAGAGGAGCAGGGGTGTCCAGGG - Intergenic
934926827 2:98388128-98388150 CTGAAGAGAGGGCGTGGCAAGGG - Intronic
935574154 2:104691599-104691621 CTGAGGAGTGGGGCTGGAGATGG - Intergenic
935857643 2:107292481-107292503 CTGAGAAGGGGGTGTGGCCTTGG + Intergenic
936236678 2:110748182-110748204 CTGAGGAGAGGAATGGGCCAAGG + Intronic
936245218 2:110820543-110820565 CTGAGGAGAGGGAGTGGGGGTGG + Intronic
936318474 2:111445933-111445955 TTCAGGAGAGGGGGTGGGCATGG - Intergenic
936574575 2:113642378-113642400 CTGGGGGGAGGGGGTGGGGAAGG - Exonic
936738855 2:115479471-115479493 CTGAAGATAGGTGGTGGCAATGG + Intronic
937633846 2:124133586-124133608 CTGTGGAGAGGTGTTGGCAAAGG - Intronic
937989439 2:127654149-127654171 GTCAGTAGATGGGGTGGCCAGGG + Intronic
938092840 2:128444571-128444593 CAGAGAAGAGGGGGAGGCCCAGG - Intergenic
938105611 2:128527947-128527969 CTGAGCACATGGGGTGGCCAAGG - Intergenic
938173176 2:129101015-129101037 CTGGGGAGCGGGGGTGGTCAAGG + Intergenic
938578346 2:132623922-132623944 TGGAGGTGAGGGGGTGGTCAAGG - Intronic
938727598 2:134121144-134121166 CTGAGGCGAGGCAGGGGCCAGGG - Intronic
939690533 2:145254686-145254708 CTGAGGAAAGGCAGAGGCCAAGG - Intergenic
939714663 2:145569136-145569158 ATGAGGAGAGGTGCTGGCAAAGG - Intergenic
941987559 2:171523309-171523331 CTGGGTAAAGGGGCTGGCCAAGG + Intronic
942554970 2:177162460-177162482 CTGAGGAGAGGGTCTGTCGAGGG + Intergenic
943015210 2:182502048-182502070 CTGAGGACAGGAGGTGGACAGGG - Intronic
945744058 2:213699119-213699141 AAGAGGAGTGGGGGTGGCAATGG - Intronic
946286501 2:218707640-218707662 TTGTAGAGAGGGGGTTGCCAGGG + Intergenic
946401132 2:219468980-219469002 CTGAGCAGTGGGCCTGGCCATGG - Exonic
946417587 2:219548108-219548130 ATGAGAGGAGTGGGTGGCCAGGG + Intronic
947418648 2:229922265-229922287 CGGAGGGGAGGGGGTGACCCCGG - Intronic
947925565 2:233919304-233919326 CTGAGGGGAGAGGTTGGCCGTGG - Intronic
947943009 2:234075455-234075477 AGGAGGAGAAGGGGTGGACATGG - Intronic
948093602 2:235315974-235315996 CTGTGGAGAGGGGGCTGCCCAGG + Intergenic
948348291 2:237317666-237317688 CAGAGGAGAGGGTGGGGCTAAGG - Intergenic
948491266 2:238314849-238314871 CGGAGGCGGGGAGGTGGCCAGGG - Intergenic
1168906462 20:1407860-1407882 CTGAGGAGGGGTGATGGGCAGGG + Intergenic
1169068111 20:2705899-2705921 GTTAGGAGAAGGGGTGGACAAGG + Intronic
1169193406 20:3671388-3671410 CCGAGGAGTGGGGGTGACCTTGG - Intronic
1169204823 20:3733548-3733570 ATGAGGACAGGGAGGGGCCATGG + Intronic
1170072143 20:12380753-12380775 CTCAGGAGAGGGCAAGGCCAAGG + Intergenic
1170851117 20:20005289-20005311 CTGAGGACCACGGGTGGCCAGGG + Intergenic
1171388320 20:24785345-24785367 CTGAGGTGAGGGAGTGGCTGTGG - Intergenic
1171486416 20:25489566-25489588 ATGGGGAGAGGGGCTGCCCAGGG - Intronic
1171517175 20:25747015-25747037 GTGAGGAGTGGGGCTAGCCATGG + Intergenic
1171896888 20:30816060-30816082 CTGGGGCGCGGGGGTGGTCAAGG + Intergenic
1172029076 20:31968791-31968813 CCGAGGAGTGGGGGTGGCGAAGG + Intronic
1172627018 20:36353140-36353162 ATGGGGAGAAGGGGTGGCCAGGG + Intronic
1173845806 20:46187751-46187773 CTGTGGTGAGGGGGTGGGGATGG - Intronic
1173846055 20:46189420-46189442 GAGAGTAGAGGGGGCGGCCAGGG + Intronic
1174404760 20:50296011-50296033 CTGGGGAGAGGAGCTGGCGAAGG + Intergenic
1175213742 20:57378485-57378507 CTGAGGTTACGGGGTGGGCAAGG - Exonic
1175247265 20:57589705-57589727 GTGGGCAGTGGGGGTGGCCATGG - Intergenic
1175505814 20:59483469-59483491 CTGAGGAGAGCTGGTGGCCGTGG + Intergenic
1175756550 20:61533732-61533754 ATGGGGTGAGGGCGTGGCCATGG + Intronic
1175767880 20:61603622-61603644 CTGGGCAGACGGGGTGGGCATGG - Intronic
1175828132 20:61947981-61948003 TTGGGGAGAAGGGGCGGCCATGG - Intergenic
1175828175 20:61948231-61948253 TTGGGGAGAAGGGGCGGCCATGG - Intergenic
1175828193 20:61948331-61948353 TTGGTGAGAAGGGGTGGCCACGG - Intergenic
1175828201 20:61948381-61948403 TTGGGGAGAAGGGGCGGCCATGG - Intergenic
1175828235 20:61948581-61948603 TTGGGGAGAAGGGGCGGCCATGG - Intergenic
1175828245 20:61948631-61948653 TTGATGAGAAGGGGCGGCCACGG - Intergenic
1175838930 20:62014489-62014511 GTGGGGAGAGGGGCTGGGCAGGG + Intronic
1176204070 20:63878680-63878702 CTCAGGAGAGGGGGAGTGCAAGG + Intronic
1176265922 20:64209303-64209325 CTGGGGAGCAGGGCTGGCCAGGG + Intronic
1176270488 20:64233387-64233409 GGGAGGAGAGGGGGTGGGGAGGG - Intronic
1176443791 21:6800953-6800975 CTCAGGAGCGGGGATGGCCACGG - Intergenic
1176586276 21:8590074-8590096 CTGAGGAGAGGGATCGGCCAAGG - Intergenic
1176597707 21:8762557-8762579 TTGAGGAAAGGGGGTGGGTAGGG + Intergenic
1176629730 21:9126080-9126102 TTGAGGAAAGGGGGTGGGTAAGG - Intergenic
1176643541 21:9328559-9328581 TTGAGGAAAGGGGGTGGGTAAGG + Intergenic
1176742265 21:10615734-10615756 CTGGTGAGAAGTGGTGGCCAGGG + Intergenic
1176742984 21:10622793-10622815 CTGAGGGGAGGGATCGGCCAAGG - Intergenic
1176821960 21:13665992-13666014 CTCAGGAGCGGGGATGGCCACGG - Intergenic
1178481490 21:32983162-32983184 GGGAGGAGAGGGGAGGGCCAGGG - Intergenic
1179303807 21:40136630-40136652 CTGAGGGGAGGGGCTGATCAGGG + Intronic
1179413379 21:41179138-41179160 GTGAGGAGTGAGGGTGTCCAGGG + Intronic
1179413399 21:41179222-41179244 ATGAGGAGTGAGGGTGTCCAGGG + Intronic
1179459352 21:41523288-41523310 CAGTGGGGAGGGGATGGCCAGGG + Intronic
1179502088 21:41816313-41816335 CAGTGGAGAGAGGGTGGCCCTGG + Intronic
1179983748 21:44910138-44910160 TTGAGGGGAGGGTGAGGCCAGGG + Intronic
1180220281 21:46354251-46354273 ATCAGGAAAGGGGGTGGCCGGGG + Intronic
1180260386 21:46664521-46664543 CTGGGCAGCGGGGGTGGCCACGG - Exonic
1180269082 22:10566978-10567000 CTGAGGAGAGGGATCGGCCAAGG - Intergenic
1180280916 22:10694207-10694229 CTGAGGGGAGGGATCGGCCAAGG - Intergenic
1180369392 22:11970662-11970684 TTGAGGAAAGGGGGTGGGTAAGG - Intergenic
1180420733 22:12812239-12812261 TTGAGGAAAGGGGGTGGGTAGGG - Intergenic
1180564136 22:16648951-16648973 CTGGTGAGAGGTGGTGGCCAGGG + Intergenic
1180730473 22:17978376-17978398 CTCAGGAGAGGGGCTGGAGAAGG + Intronic
1181279601 22:21709741-21709763 CTGAGGATGGGGGGAGGTCATGG + Intronic
1181526487 22:23492188-23492210 CTTAGCAGAGGGGCTGTCCACGG + Intergenic
1181601584 22:23955377-23955399 ATGGGGAGAGGGGGTGGTAATGG + Intergenic
1181606916 22:23985921-23985943 ATGGGGAGAGGGGGTGGTAATGG - Intergenic
1181608282 22:23993869-23993891 CTGAGGAGAGACGATGGCCCAGG - Intergenic
1181809609 22:25395414-25395436 CTGAAGTGAGGAGGAGGCCAGGG + Intronic
1182091142 22:27595737-27595759 CTGAGGGGAGGTGGTGGCGGGGG - Intergenic
1182273415 22:29170038-29170060 CTGGGGAGAAGGGGTGGCTGGGG + Intergenic
1183225648 22:36548275-36548297 CTGGGGAGGGAGGGAGGCCAAGG - Intergenic
1183339697 22:37273369-37273391 CTGGGGCGTGGGGGAGGCCAGGG - Intergenic
1183407012 22:37635158-37635180 CTTAGGACAGGGGCTGGCCCAGG - Intronic
1183543869 22:38445209-38445231 CTGGGGAGAGGTGGTGGCTCTGG + Intronic
1183629021 22:39021962-39021984 CTTAGGAGAGGGTGTGGGGAGGG + Intronic
1183632452 22:39041411-39041433 CTTAGGAGAGGGTGTGGGGAGGG + Intronic
1183638274 22:39077807-39077829 CTTAGGAGAGGGTGTGGGGAGGG + Intronic
1183674430 22:39291701-39291723 CTGGGCAGTGGGGTTGGCCAGGG - Intergenic
1183724032 22:39578577-39578599 GGGAGGAGAGGGGGAGCCCAGGG - Intronic
1184119507 22:42440987-42441009 CAGAGTAGAGGGGGCGGGCAGGG - Intergenic
1184152796 22:42648445-42648467 CTGGGGAGAGGAGGTGGCCTGGG + Intronic
1184217566 22:43077756-43077778 CTGTGGTGTGGGGGTTGCCAGGG - Intronic
1184292467 22:43505440-43505462 CAGAGTAGTGAGGGTGGCCAGGG - Intronic
1184449833 22:44576310-44576332 CACGGGAGATGGGGTGGCCAGGG + Intergenic
1184531977 22:45061937-45061959 GTGGGGAGGGTGGGTGGCCAGGG + Intergenic
1184665427 22:45986561-45986583 CAGAGGAAAGGGGGAGGCAAGGG + Intergenic
1184806105 22:46795963-46795985 CTGAGCAGAGGGGAGGACCATGG - Intronic
1185019045 22:48362893-48362915 CTGGGGAGAGGCGGTGGGAAAGG + Intergenic
1185148665 22:49152397-49152419 CTGCTGAGAGGGGCTGGCCTGGG - Intergenic
1185202527 22:49516977-49516999 CTAATGAGATGCGGTGGCCAGGG - Intronic
1185288584 22:50013210-50013232 TTGAGGGGAGGTGGAGGCCAGGG - Intergenic
1185414506 22:50702536-50702558 CCCAGGAGCGGGGGTGGTCAGGG - Intergenic
1185425595 22:50768505-50768527 CTGCGGGGAGGGGGTGGGGAAGG + Exonic
949891166 3:8734510-8734532 CTGGGGTGAGGGGGTAGCTAGGG - Intronic
950887459 3:16374149-16374171 TTGATGAGAGGGGGTGGCCCTGG + Intronic
951907961 3:27722163-27722185 CTGAGGAGAGGGGGCCGCGCTGG + Exonic
952110843 3:30122615-30122637 GGGAGGAGAGGGGGAGGCAAAGG - Intergenic
952364392 3:32662066-32662088 CTGAGGGGAGGGAGTGGAGAGGG + Intergenic
952538373 3:34338301-34338323 CTGAGGAGGTAGGGTGGACAGGG + Intergenic
952828979 3:37547383-37547405 CTCAGGAGACCTGGTGGCCAGGG - Intronic
953403235 3:42645108-42645130 ATGAGGGGTGGGGGTGGCCCTGG - Intronic
953886701 3:46718073-46718095 GTGAGGAGAGGGAGGGGCCAAGG - Exonic
954108170 3:48420165-48420187 GTCAGGAGCAGGGGTGGCCAGGG + Exonic
954124174 3:48518991-48519013 CTTAGGGGAGCTGGTGGCCAGGG - Exonic
954691912 3:52400172-52400194 CTGATGAGGGGGTCTGGCCAGGG - Intronic
955688194 3:61564772-61564794 CTGAGGCGTGGAGGTGGCCGAGG - Intronic
956167771 3:66409366-66409388 CTGACATGATGGGGTGGCCAGGG + Intronic
956799883 3:72747568-72747590 CTGAGGACTTGGGGTGACCAAGG + Intergenic
958087695 3:88833056-88833078 TTGAGGAGAGAGGGTGGGAACGG + Intergenic
958980015 3:100709686-100709708 CTGCGGAGAGGCGGCGGCCGCGG + Exonic
960534708 3:118803061-118803083 CTGAGGAGAGTGGGTGGATGTGG + Intergenic
961357116 3:126346215-126346237 CTGAGCAGAGGAGCTGGCCCAGG + Intronic
961751200 3:129095828-129095850 CTGTGGAGAAGAGGTGCCCATGG + Intronic
962437836 3:135382956-135382978 ATGAGGAGAGGGGCTGGCCTTGG + Intergenic
962871620 3:139499890-139499912 CTGAGGAGTGGGGGTGTGCAGGG + Intergenic
965079341 3:164018302-164018324 CCAAGGAGAGGGAGTAGCCAGGG + Intergenic
965859681 3:173133498-173133520 CTGAGGAGAGAGTGTGGCCGGGG - Intronic
966441541 3:179950363-179950385 GTGAGGGGAGGGGGTGGGGAGGG + Intronic
968317434 3:197736645-197736667 CTGAGGAGAGCAGGTGGGCTGGG - Exonic
1202743341 3_GL000221v1_random:76470-76492 TTGAGGAAAGGGGGTGGGTAAGG - Intergenic
968618373 4:1592592-1592614 CCCAGGAGAGGGGCTGGGCAGGG - Intergenic
968656098 4:1779077-1779099 CTGAGGAGAGAGGGAGACCCAGG - Intergenic
968703832 4:2069206-2069228 GTGGGGAAAGGGGGTGGCCAGGG - Intergenic
968706362 4:2080267-2080289 CTCAAGAGTGTGGGTGGCCAGGG - Intronic
968899746 4:3425687-3425709 CGCAGGAGAGGGGGTGGGCGGGG + Intronic
968956440 4:3722139-3722161 CTGAGGATGGGCAGTGGCCACGG + Intergenic
969497641 4:7535151-7535173 CTGTGGTGAGGAGGTGGGCAGGG - Intronic
969594474 4:8141174-8141196 GTGGGGAGAGGGGGTGGCCAAGG - Intronic
969715739 4:8867398-8867420 CTGAGGCCGGGGGGTGGCCGTGG + Exonic
969969109 4:11027834-11027856 CACAGGAGAGGAGATGGCCATGG - Intergenic
970192142 4:13527550-13527572 ATGTGGAGAGGATGTGGCCAAGG - Intergenic
970583435 4:17493646-17493668 GGTAGGAGAGGGGGTGGGCATGG + Intronic
971301083 4:25442881-25442903 ATGGGGAGGGGTGGTGGCCACGG + Intergenic
971482254 4:27125306-27125328 CTCTGGAGAGGGGGCAGCCATGG - Intergenic
972225654 4:37008161-37008183 TTGAGGGGAGTGGGTGGACATGG + Intergenic
972279970 4:37592281-37592303 CTGAGGTGAGAGGATTGCCAGGG + Intronic
972596410 4:40533756-40533778 CTGGGGAGAGGGAGTGGCAAGGG - Intronic
973361009 4:49164811-49164833 TTGAGGAAAGGGGGTGGGTAGGG + Intergenic
973366510 4:49213423-49213445 CTGCCCAGGGGGGGTGGCCAGGG - Intergenic
974785793 4:66618671-66618693 ATGAGGATAGGGGGTGACCTAGG + Intergenic
975197342 4:71541283-71541305 GTGAGGAGAGTGGGTTGTCAGGG + Intronic
976704666 4:88007945-88007967 CGGAGGAGAAGGGGAGGCCGCGG - Exonic
977508976 4:97938015-97938037 CCTAGGGGAAGGGGTGGCCATGG - Intronic
977688346 4:99874896-99874918 CTCAGGGAAGGGGGTGCCCAAGG + Intergenic
977886018 4:102252433-102252455 CTGGGGACAGGGAGTGGCCCAGG + Intronic
978468678 4:109037483-109037505 CCCAGCAGAGGGGCTGGCCAAGG - Intronic
981455467 4:144948205-144948227 CTGAGAAGAAGGAGTGGCCTGGG - Intergenic
982082942 4:151807938-151807960 GTGGGGGGAGGGGGTGGCCTGGG - Intergenic
982090960 4:151879540-151879562 CTTAGGAGAGGAGCTGGGCAGGG + Intergenic
982380638 4:154744163-154744185 CTGAGGAGAGAGGAAGGCAAAGG - Exonic
983639342 4:169930077-169930099 CTGAGGGGAGTGGGTGGACATGG + Intergenic
985500238 5:239121-239143 CTGTGGAGAGGTGGTGGGCGGGG + Intronic
985621927 5:960344-960366 CTGCTGAGAAGGGGTTGCCAGGG - Intergenic
985681746 5:1259318-1259340 CACAGGAGAGGGAGTGGACATGG + Intronic
985681809 5:1259578-1259600 CACAGGAGAGGGAGTGGACATGG + Intronic
985703501 5:1387417-1387439 GTGAGGGGAGGAGGAGGCCAGGG + Intergenic
985737158 5:1590569-1590591 CTGTGGAGAGGTGGTGGGCGGGG - Intergenic
986105881 5:4658925-4658947 ATGAGGAGAGGGGGTGAGGAGGG + Intergenic
986128392 5:4904865-4904887 CAGAGGAGGTGGGGTGGGCAGGG + Intergenic
986206286 5:5628232-5628254 CTGAGGAGAGTGGAAGGCCGTGG + Intergenic
986278869 5:6306359-6306381 CCGAGGGGAGGGGGTGGCCAGGG - Intergenic
986739248 5:10691679-10691701 CTGAGGATATGGGGCGGGCAGGG - Intronic
987050731 5:14144671-14144693 CGGCGCAGAGGGGGTGGCCGCGG + Intronic
989142681 5:38217654-38217676 CACAGGAGAGGGGGTGGGGATGG + Intergenic
989606053 5:43245669-43245691 CTGAGGACAGCAGGTGCCCAGGG - Exonic
991501601 5:67282730-67282752 ATGAGGGGAGTGGGTGGGCAGGG - Intergenic
992295586 5:75323459-75323481 CTTAGCACAGGGGGAGGCCAAGG + Intergenic
992515458 5:77487725-77487747 ATCAGGAAAGGGGCTGGCCAAGG + Intronic
993783339 5:92097480-92097502 CTGAGCATAGGCGGTAGCCAAGG - Intergenic
995752948 5:115472728-115472750 AAGAGGAGAGAGGGAGGCCAAGG + Intergenic
996515446 5:124364242-124364264 GTGAGGAGAGGGGGTAGGGATGG + Intergenic
997415439 5:133724324-133724346 CTGAGGAGATTGGGTGGCAGAGG + Intergenic
997646103 5:135483030-135483052 CTTAGGTGAGGGGGTGGGAACGG + Intergenic
997732288 5:136190581-136190603 CTGAGGAGAAGTGGTGGGCTGGG + Intergenic
998038109 5:138933544-138933566 CTGAGGGGTGGGGGTGAGCAAGG + Intronic
998135314 5:139671376-139671398 AGGAAGAGAGGGGATGGCCAGGG - Intronic
999001872 5:147932538-147932560 CAGAGGAGAGGGGTTAGGCATGG + Intergenic
999069434 5:148728276-148728298 CTGAGGAGTGGGGGTGGAGATGG - Intergenic
999240444 5:150124500-150124522 CTGAGGAGGGGAAGAGGCCAGGG + Intronic
999254493 5:150202492-150202514 GGGAGGAGAGTGGCTGGCCAGGG + Intronic
999685715 5:154101331-154101353 CTGATGGGAGGGGCTGGCAAAGG - Intronic
999738796 5:154533522-154533544 GTGAGGCGAGGGGGTGGAAAAGG + Intergenic
999831567 5:155325272-155325294 CTGAGATGGTGGGGTGGCCAGGG + Intergenic
1001050865 5:168413241-168413263 CTTTAGAGATGGGGTGGCCAGGG + Intronic
1001122527 5:168992123-168992145 CTCAGGAGAGGGGGTGGGGCAGG - Intronic
1001304962 5:170565454-170565476 CTGAGTAGAGAGTGTGGCCAGGG + Intronic
1001444849 5:171775215-171775237 TTGAGGAAAGAAGGTGGCCAAGG - Intergenic
1001595817 5:172898115-172898137 AGCAGGAGAGTGGGTGGCCAGGG - Intronic
1001667837 5:173448104-173448126 CTGTGGACAAGGGGTGGTCAAGG - Intergenic
1001675175 5:173506289-173506311 CTGAGGGGAGGCTCTGGCCATGG + Intergenic
1001959353 5:175871168-175871190 CTGAGGAGTGGTGGGGGCAAGGG - Intronic
1002072753 5:176690080-176690102 GTGAGAAGTGGGGGTGGCCTGGG - Intergenic
1002140446 5:177134223-177134245 CTGAGGGGAGGCGGAGGCCGAGG - Intronic
1002898622 6:1393093-1393115 GCGAGGCGCGGGGGTGGCCAAGG + Intronic
1003159016 6:3619400-3619422 ATGAGGGGCGGGGGTGGCCATGG + Intergenic
1003566438 6:7226717-7226739 CTGAGGAGAGGAAGTTCCCATGG - Intronic
1004178937 6:13364658-13364680 CCGAGGGGAGAGGGTGACCATGG - Exonic
1005433579 6:25783968-25783990 CTGAAAAGGGGGAGTGGCCAAGG + Intronic
1006012872 6:31056960-31056982 CTGAGGATAAGCGGTGGGCATGG + Intergenic
1006362213 6:33593011-33593033 CTGAGCAGAGGTGCTGGCCAAGG - Intergenic
1006404214 6:33834773-33834795 CTGTGGGGAGGCGCTGGCCAAGG - Intergenic
1006472260 6:34235711-34235733 CTGAGGAGGGGGCTGGGCCAGGG + Intergenic
1006989080 6:38197943-38197965 CTGAGGAGAGGGCGAGGACTGGG + Intronic
1007477629 6:42129486-42129508 GTGAGGAGTGAGTGTGGCCAGGG + Intronic
1007633028 6:43283322-43283344 CTGAGGAGTGAGGGCAGCCAGGG - Exonic
1007685289 6:43663579-43663601 CTGAGGAGAGGGAGAGGGCTGGG + Intronic
1007697895 6:43745087-43745109 ATGAGGAGAGGGCTTGGCTAGGG + Intergenic
1009566171 6:65313711-65313733 CGTAGGAGATGGGGTGGCCTGGG - Intronic
1010123559 6:72407738-72407760 GTGAGGGGAGGGAGGGGCCATGG - Intergenic
1010548751 6:77192718-77192740 GTGAGCAGAGGGGATGGCAAAGG + Intergenic
1011134596 6:84086689-84086711 CAGAAGGGAGGGGGTGGCCATGG + Intronic
1013459338 6:110359574-110359596 CTGAGGATCTGGTGTGGCCAGGG - Intergenic
1013688940 6:112617166-112617188 CTCAGGAGAGGGCAAGGCCAAGG - Intergenic
1014847948 6:126302652-126302674 ATGAGGAGAAAGAGTGGCCAAGG - Intergenic
1017837762 6:158194662-158194684 TTGAGGAAAGGGGGTGGGTAAGG + Exonic
1018101687 6:160446080-160446102 AGAAGGAGAGGAGGTGGCCAAGG + Intronic
1018338837 6:162827780-162827802 CTGAGCAGAGGAGGTGGATATGG - Intronic
1018582273 6:165317485-165317507 CTGAGGAGCGGGGGTGGGGTGGG - Intergenic
1018635224 6:165854623-165854645 GTGAGGGGAGCGGGTGGCGAAGG + Intronic
1018849207 6:167575655-167575677 GTCAGGAGAGGGTGGGGCCAAGG + Intergenic
1019493324 7:1325072-1325094 CTCAGGAGAGGATGTGGCTATGG + Intergenic
1019547671 7:1586314-1586336 GGGAGGAGAGCGGGAGGCCACGG - Intergenic
1020087916 7:5321394-5321416 AGGAGGAGAGGGGCTGGCCACGG - Intronic
1020088219 7:5323042-5323064 CTGCGGTGATGGGCTGGCCAGGG - Intronic
1020419118 7:7980295-7980317 CTGAGGAGAAGTGGGTGCCATGG + Intronic
1020424336 7:8046755-8046777 CTGAGGAGAACATGTGGCCAAGG - Intronic
1021790118 7:24196213-24196235 CAGAGGAAAGGGGAGGGCCAGGG + Intergenic
1021877797 7:25064656-25064678 CTGAGCAGAGGGAGTGGCTAGGG + Intergenic
1022011438 7:26311044-26311066 CTTGGCTGAGGGGGTGGCCAGGG + Intronic
1022096260 7:27143317-27143339 CTGAGGAGAGTGCGTGGACGTGG + Exonic
1022317649 7:29260519-29260541 ATCTGGAGAAGGGGTGGCCATGG + Intronic
1022514118 7:30964619-30964641 CTTTGAAGAGGGTGTGGCCAGGG + Intronic
1022704533 7:32790038-32790060 CTGAGGAGGGTGGGTGGCGATGG - Intergenic
1022908708 7:34879781-34879803 CTGAGGAGGGTGAGTGGCGATGG - Intergenic
1023046020 7:36210817-36210839 GTTAGGAGATGGGGTGGTCAGGG - Intronic
1023818618 7:43968294-43968316 CTGGAGAGAGGGGAGGGCCAGGG + Intergenic
1023843862 7:44110483-44110505 CTGAGGAGTGGGGATGGGCAGGG - Intronic
1023879084 7:44308457-44308479 GTGAGGAGAGGAGGGGGACATGG - Intronic
1024655549 7:51448560-51448582 CTGATTAGAGGTGGTGGCGAGGG - Intergenic
1025206092 7:56994071-56994093 CTGCGGTGATGGGCTGGCCAGGG + Intergenic
1025206392 7:56995728-56995750 GGGAGGAGAGGGGCTGGCCACGG + Intergenic
1025481332 7:60987179-60987201 CTGAGGGGAGGGATCGGCCAAGG - Intergenic
1025665545 7:63581199-63581221 GGGAGGAGAGGGGCTGGCCACGG - Intergenic
1025665848 7:63582868-63582890 CTGCGGTGATGGGCTGGCCAGGG - Intergenic
1025834319 7:65080957-65080979 CTGAGGCGAGTGCGCGGCCAGGG + Intergenic
1025878915 7:65514624-65514646 CTGAGGGGAGGGATCGGCCAAGG + Intergenic
1025884711 7:65577511-65577533 CTGAGGGGAGGGATCGGCCAAGG + Intergenic
1025904089 7:65770477-65770499 CTGAGGCGAGTGCGCGGCCAGGG + Intergenic
1026117191 7:67505899-67505921 GTGAGGAGAAGGGCTGGCCTGGG - Intergenic
1026319954 7:69259739-69259761 CTGAGGGCATGGGGTGGGCACGG - Intergenic
1026364321 7:69632510-69632532 GGGAGGAGAGGGGGTGGAGAGGG - Intronic
1026930483 7:74220632-74220654 CTGGAGAAAGGGGGAGGCCATGG + Intronic
1027175894 7:75903247-75903269 CTGTGGAAAGGGGCTGGGCACGG + Intronic
1028033947 7:85955462-85955484 GTGAGGAAAGGGGAAGGCCAAGG + Intergenic
1029278838 7:99424119-99424141 CTGAGCAGAGGGGCTGGGCTTGG - Intronic
1029743667 7:102505259-102505281 CTGGAGAGAGGGGAGGGCCAGGG + Intronic
1029761653 7:102604422-102604444 CTGGAGAGAGGGGAGGGCCAGGG + Intronic
1029970608 7:104785252-104785274 GTGTGAAGAGGGGATGGCCAAGG - Intronic
1031656710 7:124364979-124365001 CTGAGGAGAGGGAAGGACCAAGG + Intergenic
1032423066 7:131798849-131798871 CTGAGAAGAGGGGAGGGCAATGG - Intergenic
1032523045 7:132560888-132560910 CTGATCAAAGGGGGTGGCAAAGG - Intronic
1033125220 7:138701399-138701421 CTGAGAAGAGGGTGTGCCCTAGG - Intergenic
1034398660 7:150846950-150846972 CTGATGACAGGGGCTGGCCCTGG - Intronic
1034503816 7:151469460-151469482 CTGCGGAGAGGGGCGGGGCAGGG + Intronic
1034557680 7:151860387-151860409 GGGAGGAGAGGGGGTGGGCAAGG - Intronic
1034629962 7:152523140-152523162 CTGAGGACAGAGGAGGGCCACGG + Intergenic
1035175725 7:157049257-157049279 CGGAGCACAGGGAGTGGCCACGG - Intergenic
1035213928 7:157350431-157350453 CTGGGGAGCGGGGGTCTCCAAGG - Intronic
1035224972 7:157427953-157427975 CTGAGCAGAGTGAGTGGTCAGGG + Intergenic
1035294803 7:157861018-157861040 CTGTGGAGAGGTGGGGGGCAGGG + Intronic
1035335481 7:158125130-158125152 TTGAGGCAGGGGGGTGGCCATGG - Intronic
1035519788 8:266780-266802 CTGAGGAGCGGGCGAGGCCGGGG + Intergenic
1035708395 8:1695032-1695054 CCGAGGAGAGGAGGGGGGCACGG + Intronic
1036169431 8:6468404-6468426 CCAAGAAGAGGGGCTGGCCAGGG - Intronic
1036748888 8:11430742-11430764 GTGAGGGGAGGGTGTGGCAAGGG + Intronic
1037120310 8:15277247-15277269 CTGAGGAAGGAGTGTGGCCAGGG + Intergenic
1039474835 8:37834138-37834160 GTCAGCAGAGGGGGTGGCCCTGG + Intronic
1042456264 8:69007601-69007623 CTGAGTAGAGGAGGTGAACAGGG + Intergenic
1042852154 8:73226914-73226936 CTGTGAACAGGGGTTGGCCATGG + Intergenic
1044727547 8:95205562-95205584 GTGAGGCGAAGGTGTGGCCAAGG + Intergenic
1045342899 8:101270198-101270220 GTGAGGGGAGGGAGTGGACATGG + Intergenic
1049258090 8:141624552-141624574 CAGAGCAGAGGGAGGGGCCATGG + Intergenic
1049333048 8:142065296-142065318 CTGATGAGAGACAGTGGCCAGGG + Intergenic
1049345050 8:142134252-142134274 CTGGGGACAGGTGATGGCCAAGG + Intergenic
1049361780 8:142215503-142215525 CTGAGGGGTGGTGGTGGACAAGG - Intronic
1049374076 8:142280826-142280848 CTGGGGAGAGGAGGTGGTAAGGG + Intronic
1049397964 8:142410560-142410582 GTGAAGAGAGGTGGGGGCCAAGG - Intergenic
1049451938 8:142666660-142666682 CTGTGGGGAGAGGGTGGCCCCGG + Intronic
1049592835 8:143470359-143470381 CTGAGGCGTGTGGGGGGCCAGGG + Intronic
1049702821 8:144022841-144022863 CTGAGGAGAGAGGGTCCTCAGGG - Intronic
1049702993 8:144023454-144023476 CTGAGGAGAGAGGGTCCTCAGGG - Intronic
1049846280 8:144803367-144803389 CTGTGGAGAGGGCGAGGCCAAGG + Intronic
1049964496 9:766449-766471 CTGAGGACTGGGGGTGGCTCCGG + Intergenic
1050204883 9:3186087-3186109 CTGAGGAGAGTGGGTGGATGTGG + Intergenic
1051412207 9:16801524-16801546 GTGAGGAATGGGGCTGGCCACGG - Intronic
1052360073 9:27544878-27544900 CTGGGGAGAGGCGGTGGGCTGGG - Intergenic
1053545779 9:39021401-39021423 CTGGGGAGACGGGCTGGGCACGG - Intergenic
1053578899 9:39382427-39382449 GTGAGGGGAGGGGGTGGAGAGGG + Intergenic
1053698004 9:40656323-40656345 CTGAGGGGAGGGATCGGCCAAGG + Intergenic
1053787203 9:41660683-41660705 CTGTGGTGAGGGGATGTCCAAGG - Intergenic
1053810097 9:41843051-41843073 CTGGGGAGATGGGCTGGGCACGG - Intergenic
1053843414 9:42210502-42210524 GTGAGGGGAGGGGGTGGAGAGGG + Intergenic
1053944015 9:43286531-43286553 CTGAGGGGAGGGATCGGCCAAGG + Intergenic
1054100482 9:60941231-60941253 GTGAGGGGAGGGGGTGGAGAGGG + Intergenic
1054121879 9:61216856-61216878 GTGAGGGGAGGGGGTGGAGAGGG + Intergenic
1054175480 9:61872022-61872044 CTGTGGTGAGGGGATGTCCAAGG - Intergenic
1054309295 9:63455731-63455753 CTGAGGGGAGGGATCGGCCAAGG + Intergenic
1054441237 9:65263679-65263701 CTGAGGGGAGGGATCGGCCAAGG + Intergenic
1054489039 9:65757810-65757832 CTGAGGGGAGGGATCGGCCAAGG - Intergenic
1054585865 9:66965655-66965677 GTGAGGGGAGGGGGTGGAGAGGG - Intergenic
1054620496 9:67344377-67344399 CTGGGGAGATGGGCTGGGCACGG + Intergenic
1054662057 9:67708788-67708810 CTGTGGTGAGGGGATGTCCAAGG + Intergenic
1056034037 9:82584941-82584963 CTCTGTAGAGGAGGTGGCCAAGG + Intergenic
1056275007 9:84985908-84985930 ATGAGGAGAGGGTGTGGGAAGGG + Intronic
1056331944 9:85528530-85528552 CTGTGGATACGGGGTAGCCATGG - Intergenic
1056822239 9:89851441-89851463 CAGACAAGAGAGGGTGGCCATGG + Intergenic
1057110893 9:92469761-92469783 CTGAGGGGAGGCGGTGGCGGGGG + Intronic
1057854756 9:98593798-98593820 CTGAGGAATGAGTGTGGCCACGG - Intronic
1058461924 9:105190868-105190890 CTGGGGGCAGGAGGTGGCCAAGG - Intergenic
1058834853 9:108851978-108852000 CTGAGGAGGGGTGGTGCCCGTGG - Intergenic
1059165013 9:112069128-112069150 GTGAGGAGAGATGGGGGCCAAGG + Intronic
1059259119 9:112959085-112959107 CGGTGGAGAGAGGGTGGCCCAGG - Intergenic
1059431948 9:114255609-114255631 CTGAGGAGATGGGGTGGGGTGGG - Intronic
1059457617 9:114409564-114409586 CTGAGGGCAGTGGGTTGCCATGG + Intronic
1059560388 9:115328926-115328948 GTGAGGAGAGGGGGAGGAGAAGG + Intronic
1060044205 9:120327207-120327229 CTGGGGAGGGGAAGTGGCCAGGG + Intergenic
1060486747 9:124052472-124052494 ATGAGGAGATGGGGTGGGCGGGG + Intergenic
1060915313 9:127385505-127385527 CTGAGGATAGAGGGTGGGAAAGG - Intronic
1061073723 9:128328051-128328073 CTGAGTAGAGGGAATGGCAAGGG + Intronic
1061366111 9:130172999-130173021 CTGCGGAGAGGGGGCCGCCAGGG - Intronic
1061752809 9:132792573-132792595 CCCTGGAGAGGGGGTGCCCAGGG + Intronic
1061804595 9:133131035-133131057 GGGAGGAGAGGGTGTGGGCAGGG + Intronic
1062161746 9:135084112-135084134 CTGCCGAGAGGGAGTGCCCAGGG + Intronic
1062320659 9:135989184-135989206 CTGTGGGGAGGGGGAGGTCAGGG - Intergenic
1062337598 9:136079235-136079257 CTGAGCTGAGGGGGAGACCAGGG + Intronic
1062388607 9:136325117-136325139 CTGATGGGAGGGGGTGGCAGTGG + Intergenic
1062520257 9:136954665-136954687 GTGAGGGGAGGAGGTGGCCCAGG - Intronic
1062528740 9:136990251-136990273 CAGAGGAGAGGGGTGGACCATGG - Intergenic
1062573199 9:137194843-137194865 ATGGGCAGAGGGTGTGGCCAGGG + Intronic
1202780368 9_KI270717v1_random:29513-29535 CTGAGGGGAGGGATCGGCCAAGG + Intergenic
1203525409 Un_GL000213v1:83574-83596 CTCAGGAGCGGGGATGGCCACGG + Intergenic
1203690046 Un_GL000214v1:33900-33922 TTGAGGAAAGGGGGTGGGTAAGG + Intergenic
1203752564 Un_GL000218v1:93761-93783 TTGAGGAAAGGGGGTGGGTAAGG - Intergenic
1203711977 Un_KI270742v1:106434-106456 TTGAGGAAAGGGGGTGGGTAAGG - Intergenic
1203555585 Un_KI270743v1:204762-204784 TTGAGGAAAGGGGGTGGGTAGGG - Intergenic
1203582156 Un_KI270746v1:18496-18518 CTGAGGGGAGGGATCGGCCAAGG - Intergenic
1203587150 Un_KI270747v1:15109-15131 CTGAGGGGAGGGATCGGCCAAGG + Intergenic
1203616184 Un_KI270749v1:67589-67611 CTGAGGAGAGGGATTCGCCAAGG - Intergenic
1203646229 Un_KI270751v1:70153-70175 TTGAGGAAAGGGGGTGGGTAAGG - Intergenic
1185456317 X:312618-312640 CCCAGGAGAGGGGGTTCCCATGG - Intronic
1185867099 X:3633786-3633808 CTGAGGACCGGGGCTGGCCTTGG + Intronic
1185895131 X:3851664-3851686 CAGAGGAGAGGGGATGGAGAAGG - Intergenic
1185900249 X:3890089-3890111 CAGAGGAGAGGGGATGGAGAAGG - Intergenic
1185905365 X:3928520-3928542 CAGAGGAGAGGGGATGGAGAAGG - Intergenic
1186253718 X:7697608-7697630 TTGTGGGGAGGGGGTGTCCAGGG - Intergenic
1186925882 X:14332966-14332988 CTAAGGAGAAGGGATGGCAAAGG - Intergenic
1188676814 X:32951608-32951630 CTGAGGACTGGGGGTGGGAAAGG - Intronic
1189047747 X:37611336-37611358 CGGAGCAGAGGAGATGGCCAAGG - Intronic
1190048544 X:47132076-47132098 CTGGGGGGAGGGGGTGGGAAGGG - Intergenic
1190220765 X:48511125-48511147 CTGGGTAGAGGGCGTAGCCAGGG - Intronic
1190261538 X:48800836-48800858 CGGGGGAGAGGGGGTGCCTAGGG + Intergenic
1190821996 X:53982169-53982191 CACAGTAGAGTGGGTGGCCAGGG + Intronic
1192208580 X:69112347-69112369 GTGAGGAGATGGAATGGCCATGG + Intergenic
1192260140 X:69501204-69501226 CTGAGAAGAAGGACTGGCCAGGG + Intergenic
1194959517 X:100219020-100219042 TTGTGGGGAGGGGGTGGTCAGGG - Intergenic
1195073834 X:101307033-101307055 CTGAGAAGAGGAGGGGGCAAGGG + Intergenic
1195283167 X:103356933-103356955 CTGTGGAGAGGGGGTGAACTAGG + Intronic
1195372405 X:104190320-104190342 CTGAGGTGTGGGGGTGGGCAAGG + Exonic
1195768361 X:108320506-108320528 CTGAGCACAGGCGGTGGGCAAGG + Intronic
1195981368 X:110581745-110581767 ATGAGTAGAGGGGGTTGACAAGG + Intergenic
1196684250 X:118496641-118496663 CTGGGGAGAGAGGGTGGTGATGG + Intronic
1199885361 X:152015755-152015777 CTGAGAAGAGGGTGGGGGCAAGG + Intergenic
1200045869 X:153400862-153400884 CTGGGGTGAGGGGGTGTCGAGGG - Intergenic
1200286727 X:154830030-154830052 CTGAGGAGAGGGAGTATCCCAGG + Intronic
1200825150 Y:7630068-7630090 TTGAGGAAAGGGGGTGGGTAAGG + Intergenic
1201166213 Y:11211373-11211395 TTGAGGAAAGGGGGTGGGTAAGG - Intergenic
1201678055 Y:16610246-16610268 CTGGGAAGTGGGGGTGGGCAGGG - Intergenic
1201912426 Y:19146397-19146419 TTGAGGAGAGGGGGTGGGTAAGG + Intergenic
1202234905 Y:22701018-22701040 TTGAGGAAAGGGGGTGGGTAAGG - Intergenic
1202308254 Y:23495150-23495172 TTGAGGAAAGGGGGTGGGTAAGG + Intergenic
1202562547 Y:26175436-26175458 TTGAGGAAAGGGGGTGGGTAAGG - Intergenic
1202600586 Y:26589918-26589940 CTGGTGAGAGGTGGTGGCCAGGG + Intergenic